Next Article in Journal
Molecular Bases of Mechanisms Accounting for Drug Resistance in Gastric Adenocarcinoma
Next Article in Special Issue
Thyroid Lobectomy for Low to Intermediate Risk Differentiated Thyroid Cancer
Previous Article in Journal
Oncogenic Serine 45-Deleted β-Catenin Remains Susceptible to Wnt Stimulation and APC Regulation in Human Colonocytes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

TERT Promoter Mutation and Extent of Thyroidectomy in Patients with 1–4 cm Intrathyroidal Papillary Carcinoma

1
Department of Endocrine Surgery, Nippon Medical School, Tokyo 113-8603, Japan
2
Pathology Project for Molecular Targets, The Cancer Institute, Japanese Foundation for Cancer Research, Tokyo 135-8550, Japan
3
Division of Pathology, The Cancer Institute, Japanese Foundation for Cancer Research, Tokyo 135-8550, Japan
4
Department of Anesthesiology, Nippon Medical School, Tokyo 113-8603, Japan
5
Division of Head and Neck, Cancer Institute Hospital, Tokyo 135-8550, Japan
6
Clinical Pathology Center, The Cancer Institute Hospital, Japanese Foundation for Cancer Research, Tokyo 135-8550, Japan
*
Author to whom correspondence should be addressed.
Cancers 2020, 12(8), 2115; https://doi.org/10.3390/cancers12082115
Submission received: 4 July 2020 / Revised: 24 July 2020 / Accepted: 28 July 2020 / Published: 30 July 2020
(This article belongs to the Special Issue 2020 Update on the Management of Thyroid Cancer)

Abstract

There are concerns regarding overtreatment in papillary thyroid carcinoma (PTC). BRAF V600E and TERT promoter mutations play important roles in the development of PTC. However, initial surgical approaches for PTC based on genetic characteristics remain unclear. The present study aimed to identify genetic mutations as predictors of prognosis and to establish proper indications for lobectomy (LT) in patients with 1–4 cm intrathyroidal PTC. Prospectively accumulated data from 685 consecutive patients with PTC who underwent primary thyroid surgery at the Cancer Institute Hospital, Tokyo, Japan, between 2001 and 2012 were retrospectively reviewed. Of the 685 patients examined, 538 (78.5%) had BRAF V600E mutation and 133 (19.4%) had TERT promoter mutations. Patients with TERT promoter mutations displayed significantly worse outcomes than those without mutations (10-year cause-specific survival (CSS): 73.7% vs. 98.1%, p < 0.001; 10-year disease-free survival (DFS): 53.7% vs. 93.3%, p < 0.001). As for extent of thyroidectomy among TERT mutation-negative patients with 1–4 cm intrathyroidal PTC, patients who underwent LT showed no significant differences in 10-year CSS and 10-year DFS compared to patients who had total thyroidectomy (TT) under propensity score-matching. Avoiding TT for those patients indicates a possible pathway to prevent overtreatment and reduce postoperative complications.

1. Introduction

The incidence of thyroid cancer has been increasing dramatically in developed countries. Most cases involve low-risk papillary thyroid carcinoma (PTC), showing favorable treatment outcomes. Thus, mortality due to thyroid cancer has remained stable and debate is growing regarding the overdiagnosis and overtreatment of thyroid cancers [1]. Traditionally, total thyroidectomy (TT) had been the standard surgical procedure for PTC in Western countries, whereas lobectomy (LT) to preserve postoperative thyroid function has been widely performed in Japan. Recently, risk-adapted management has been considered as a cornerstone to the treatment of patients with differentiated thyroid carcinoma. This policy determines the therapeutic strategy, including the extent of thyroidectomy and postoperative adjuvant therapies based on the risks of cancer recurrence and mortality [2]. The 2015 American Thyroid Association (ATA) guidelines recommended either TT or LT as the initial surgical approach for patients with 1–4 cm intrathyroidal PTC [3]. They acknowledged that LT alone might be sufficient for low-risk PTC. Indeed, the rate of patients who undergo LT has since been increasing [4]; however, the majority of patients with PTC in the United States still undergo TT [5]. This might be partially due to a lack of decisive factors to determine indications for LT among such patients.
Several studies have investigated the genetic molecular profiles of PTC and revealed BRAF V600E mutation and TERT promoter mutation as major mutations playing important roles in PTC development [6,7]. Although some studies have examined relationships between those mutations and prognosis, no studies have clarified the initial surgical approach for patients with PTC based on genetic characteristics. The aim of the present study was to identify mutations as predictors of prognosis and to suggest appropriate indications for LT in patients with 1–4 cm intrathyroidal PTC using the genetic status of the tumor.

2. Results

Table 1 shows baseline characteristics of the 685 patients. Mean duration of follow-up after initial surgery was 10 ± 3 years. Mean age was 52 ± 14 years. The proportion of women was 75.9% (520 cases).

2.1. Gene Mutations and Outcome

Among the 685 patients, 538 (78.5%) had BRAF V600E mutation and 133 (19.4%) had TERT promoter mutations (C228T-positive, 112 cases; C250T-positive, 21 cases). Kaplan–Meier survival analysis showed that BRAF V600E mutations had no significant effect on 10-year cause-specific survival (CSS) (positive vs. negative: 93.1% vs. 93.6%, respectively; p = 0.998) and 10-year disease-free survival (DFS) (86.0% vs. 88.2%, respectively; p = 0.872) (Figure 1). In contrast, patients with TERT promoter mutations (TERT+) displayed significantly worse outcomes than those without TERT promoter mutations (TERT−) (10-year CSS: 73.7% vs. 98.1%, p < 0.001; 10-year DFS: 53.7% vs. 93.3%, p < 0.001, respectively) (Figure 2). As shown in Figure 3, patients with coexisting BRAF V600E and TERT promoter mutations (B+/T+) showed worse CSS and DFS than those with neither mutation (B−/T−) (10-year CSS: 75.3% vs. 96.4%, p < 0.001; 10-year DFS: 55.5% vs. 90.9%, p < 0.001). Only 7 patients displayed TERT promoter mutation alone (B−/T+), but these patients also showed significantly worse outcomes compared to patients with B−/T− (10-year CSS: 35.7%, p < 0.001; 7-year DFS: 20.0%, p < 0.001). On the other hand, BRAF V600E mutation alone (B+/T−) was not significantly poorer than patients with B−/T− (10-year CSS: 98.7%, p = 0.021; 10-year DFS: 94.1%, p = 0.086). Multivariate Cox proportional hazard regression analysis for genetic mutation status revealed that B+/T+ and B−/T+ were independently associated with poor cause-specific survival (Table 2).
The characteristics of patients with/without BRAF V600E mutation and with/without TERT promoter mutation are shown in Table 3 and Table 4, respectively. BRAF V600E mutation was significantly more common among older patients (p < 0.001) and cases with higher T and stage at diagnosis (p < 0.001); however, it was inversely associated with higher N and M. TERT promoter mutations were significantly more common among older patients (p < 0.001), men (p < 0.001), and cases with higher stage at diagnosis (p < 0.001). Multivariate Cox proportional hazard regression analysis showed that TERT promoter mutations (HR = 5.23, 95% CI 2.33–12.78, p < 0.001), age ≥55 years (HR = 2.47, 95% CI 1.09–6.38, p = 0.030), tumor size >4 cm (HR = 3.90, 95% CI 1.89–8.42, p < 0.001), N1b (HR = 3.27, 95% CI 1.30–8.82, p = 0.011) and M1 (HR = 2.46, 95% CI 1.17–5.15, p = 0.018) were independent risk factors associated with mortality (Table 5).

2.2. Extent of Thyroidectomy and TERT Promoter Mutations for Patients with 1–4 cm Intrathyroidal PTC

A total of 309 patients had intrathyroidal PTC with a maximal diameter of 1–4 cm without extrathyroidal extension, clinical evidence of any lymph node metastasis and distant sites. Here, we included T3b tumor invading only the strap muscles into intrathyroidal PTC. We investigated the relationship between extent of thyroidectomy and outcomes according to positivity for TERT promoter mutations (TERT+/TERT−) in this patient group, which comprised 33 TERT+ patients and 276 TERT− patients. Among TERT− patients, 59 patients underwent TT and 217 patients received LT as the initial thyroidectomy. Table 6 shows patient characteristics in the TERT− group according to the extent of thyroidectomy. Patients who underwent TT were significantly older, presenting with a higher proportion of T3b tumors and bilateral disease compared to LT patients. We thus conducted propensity score-matching to compare treatment outcomes between patients who underwent TT and LT. Before matching, no significant differences were evident in 10-year CSS (LT vs. TT: 100% each, p = 0.575) or 10-year DFS (97.4% vs. 96.9%, p = 0.773) (Figure 4). Likewise, no significant differences were seen in 10-year CSS (LT vs. TT; 100% each, p = 0.308) or 10-year DFS (96.6% vs. 96.9%, p = 0.554) when comparing LT to TT after matching (Figure 5). Incidences of temporary and permanent postoperative hypoparathyroidism in TT were significantly higher than those in LT. Five patients showed recurrence after LT in the TERT− group, comprising cervical lymph node recurrence in 4 cases and distant recurrence in the remaining 1 case. All patients with cervical recurrence were able to be cured by salvage surgery. One female patient who developed lung metastasis 5 years after the first operation did not undergo remnant thyroid resection and radioactive iodine (RAI) therapy because she was 85 years old at that time. She died 10.4 years after the first operation.
As for the TERT+ group, no significant differences in 10-year CSS (100% each, not significant) was seen comparing LT to TT. However, the 10-year DFS of patients treated by LT tended to be worse than that of TT (64.5% vs. 100%, p = 0.094) (Figure 6).

3. Discussion

Previously, a “one-size-fits-all” policy was the mainstream when determining the initial treatment procedure for patients with PTC. This took the form of TT and radioactive iodine (RAI) in Western countries, and LT in Japan. However, risk-adapted management policies based on appropriate risk stratification systems have been widely adopted more recently.
The 2015 ATA guidelines have expanded the indications for LT based on evidence that T1 or T2N0M0 can provide good long-term prognosis [8,9], and either TT or LT can be safely indicated for patients with 1–4 cm PTC without gross extrathyroidal extension, lymph node metastasis (LNM) or distant metastasis [3]. As a result, the rate of LT for thyroid cancer increased significantly from 17.3% to 22.0% in the United States after the release of the guidelines [4]. However, treatment teams are still apt to choose TT to enable RAI therapy or enhance follow-up based upon disease features and/or patient preferences. Indeed, Welch et al. reported that about 80% of patients with localized PTC ≤ 2 cm underwent TT [5]. They suggested that further efforts to reduce overtreatment by TT are needed, because TT is associated with a significantly higher risk of complications like hypoparathyroidism and recurrent laryngeal nerve palsy compared to LT, even among high-volume surgeons [10]. Moreover, all patients who undergo TT require lifelong thyroid hormone-replacement therapy.
On the other hand, LT has been the preferred operative approach for the majority of patients with PTC in Japan [11,12]. We designed our own risk group classification for predicting cause-specific death from PTC and have recommended LT as the treatment option for low-risk patients [13]. The risk-group definition described in the Materials and Methods section featured a wider range for the low-risk group compared to other risk-group stratification systems. We reported the validity of the definition in 2014 and showed that the 10-year CSS for patients with low-risk PTC was 99% and did not differ between patients who underwent TT versus LT [14]. However, cause-specific mortality (1%) and tumor recurrence (8.3%) were seen even within the low-risk group. We therefore attempted to identify a decisive genetic marker to predict prognosis of PTC and to determine the initial treatment procedure.
Several genetic alterations have been identified in PTC, mainly involving genes of the MAP kinase pathway (BRAF and RAS point mutations). Although BRAF V600E mutation is the most prevalent point mutation in PTC, the contribution of BRAF V600E mutation to PTC outcomes remains controversial [6,15,16,17,18,19]. In Japan, Ito et al. reported a relatively high prevalence (38.4%) of BRAF mutation among 631 patients with PTC, but the mutation did not correlate with high-risk features or DFS [19]. Indeed, we also found a high incidence (78.5%) of BRAF V600E mutation and no impact of this mutation on CSS and DFS in this Japanese series. Further study would be needed to clarify the reason why Japanese patients showed higher incidence of BRAF mutation than other countries.
TERT promoter mutations were found in 3.5–14.0% of PTC [20,21,22], mostly comprising C228T mutations. They are known as effective risk factors for patients with PTC. Several investigators have shown that TERT promoter mutations are significantly more common among older patients, bigger tumor size, more aggressive subtype, tumors with extrathyroidal invasion, distant metastasis or higher stage at diagnosis, and are related to poor outcomes [7,23,24,25,26,27,28]. In addition, Xing et al. reported that coexisting BRAF V600E and TERT promoter mutations represented a strong predictor for the most aggressive PTCs with the highest recurrence rate [29]. Some meta-analyses have verified that coexistence of both mutations has a synergistic effect on aggressive clinicopathological characteristics and even cancer-related mortality for patients with PTC [30,31]. In this series, the incidence of TERT promoter mutations was 19.4% and we revealed that TERT promoter mutations alone and coexisting BRAF V600E and TERT promoter mutations were independently related to CSS for patients with PTC. However, most (126 of 133) patients with TERT promoter mutations also had BRAF mutation and only 7 patients showed TERT mutations alone. Consequently, BRAF V600E mutation was not a better indicator associated with CSS and DFS compared to TERT mutations in this population. Thus, we simply applied TERT promoter mutation to examine the relationship between extent of thyroidectomy and outcomes for patients with 1–4 cm intrathyroidal PTC. We revealed that LT could provide favorable outcomes identical to TT for those patients without TERT promoter mutations. The recent advent of molecular tests using fine-needle aspiration cytology specimens has enabled preoperative diagnosis of the existence of TERT promoter mutations [32]. Therefore, surgeons can decide the initial surgical approach for patients with PTC based on the status of this genetic marker.
The strength of our study lies in the large cohort treated under a uniform strategy and accompanied by long-term, precise outcome information. Conversely, the study was a retrospective analysis of prospectively accumulated data from a single, tertiary oncology referral center in Japan, where RAI therapy had not been utilized much compared to Western countries. Global, prospective verification involving multiple institutions is expected in the near future. In addition, our series included only five patients under 18 years old (2 were positive for BRAF mutation but no one had TERT mutations). Thus, the conclusions provided should be applied only for adult patients so far.

4. Materials and Methods

4.1. Study Design and Patients

After approval by the institutional review board (IRB number 2013–1128, 24 January 2014), we retrospectively reviewed the prospectively accumulated data of 685 consecutive patients with PTC who underwent primary thyroid surgery at the Cancer Institute Hospital, Tokyo, Japan, between 2001 and 2012. All subjects gave their informed consent for inclusion before they participated in the study. Patients with papillary microcarcinoma (maximal diameter, ≤1.0 cm) were excluded. Patients were classified preoperatively into low- and high-risk groups according to our risk group classification system [13]. That is, patients with distant metastasis and older patients (≥50 years) with massive extrathyroidal invasion or large LNM (maximal diameter, ≥3 cm) were defined as high risk and all other patients were classified as low risk. Although we presented the treatment options (including both LT and TT) to establish shared decision-making for patients with low-risk PTC, we basically recommended LT when the tumor was unilateral. Radioactive iodine (RAI) treatment was usually performed for patients with high-risk features [14]. Extent of lymph node dissection was determined under the previously reported principle [33]: a) Dissection of the central compartment (level VI) alone for patients with LNM only in the central zone or with no LNM; and b) lateral neck dissection (basically, levels II, III, IV, and VI) when the patient was diagnosed with lateral neck LNM. Bilateral neck dissection was performed only when preoperative imaging showed bilateral neck LNM. Postoperative surveillance to evaluate recurrent lesions was conducted every 6 or 12 months, using cervical ultrasound, chest X-rays or computed tomography. Patients with distant metastasis at the time of initial presentation were excluded from the analysis of recurrence or DFS.

4.2. DNA Extraction and Mutation Screening

Genomic DNA was extracted using a DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) from fresh frozen specimens. To analyze the presence of BRAF V600E mutation and TERT promoters C228T and C250T, multiplex genomic PCR was performed with the primers at the adjusted concentrations shown in Table 1 using PrimeSTAR® GXL DNA Polymerase (TaKaRa Bio, Shiga, Japan). The template genomic DNA was subjected to 35 cycles of denaturation at 98 °C for 10 s, annealing at 60 °C for 15 s, and polymerization at 68 °C for 15 s. The PCR product was separated by agarose gel electrophoresis. After purification with Sephadex G-75 (GE Healthcare, Buckinghamshire, UK), the amplified PCR product was used for the single-base extension reaction, using a SNaPshot® Multiplex System (Thermo Fisher Scientific, Waltham, MA, USA) according to the instructions from the manufacturer. Concentrations of primers were optimized as described in Table 7. To confirm the results from SNaPshot, Sanger sequencing analysis of the BRAF V600E mutation and TERT promoters C228T and C250T were also performed on some cases.

4.3. Digital PCR for TERT Promoter Mutations

To confirm the presence of TERT promoters C228T and C250T, digital PCR using a QuantStudio™ 3D Digital PCR System (Thermo Fisher Scientific) was also performed in some cases. Mutation analysis was conducted with TaqMan Liquid Biopsy dPCR Assays (Thermo Fisher Scientific) which were specifically designed for TERT promoters C228T and C250T (Hs000000092_rm and Hs000000093_rm, respectively).

4.4. Statistical Analysis

Clinical data were recorded and tabulated in Excel software (Microsoft, Redmond, WA, USA). All analyses were performed using JMP for Windows v11.0.0 (SAS Institute, Cary, NC, USA). Values of p < 0.05 were considered significant. Results are expressed in the form of mean ± standard deviation or n (%). Clinical characteristics were compared between groups using the chi-square test for categorical variables and Mann–Whitney’s U test for continuous variables. Survival curves were determined using the Kaplan–Meier method. Cox proportional hazard modeling and log-rank testing were used to compare time-to-event distributions. Using the propensity score-matching method, patients with or without genetic mutations related to prognosis who underwent LT and TT were matched by age, sex, tumor size, and extrathyroidal invasion of the strap muscles in a 1:1 ratio. After propensity score-matching, baseline characteristics were compared between the two groups as matched pairs. Kaplan–Meier curves were constructed, and the log-rank test was used to compare CSS and DFS.

5. Conclusions

In summary, we found that TERT promoter mutations were independently related to poor outcomes for patients with PTC. In contrast, BRAF V600E mutation alone was not significantly associated with aggressiveness. In addition, patients with 1–4 cm intrathyroidal PTC without TERT promoter mutations could obtain favorable outcomes from LT. The present findings suggest a pathway to prevent oversurgery and reduce postoperative complications for those patients, leading to alleviation of physical, psychological, and economic burdens on patients.

Author Contributions

Conceptualization, A.E. and I.S.; methodology, K.T.; validation, K.T. and I.S.; formal analysis, A.E. and M.I.; investigation, A.E., Y.T., S.B., Y.S., S.S., and H.M.; resources, A.E. and I.S.; data curation, M.I.; writing—original draft preparation, A.E. and M.I.; writing—review and editing, I.S.; visualization, A.E.; supervision, K.T. and I.S.; project administration, K.T. and I.S.; funding acquisition, K.T. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by JSPS KAKENHI Grant Number 18H02635.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Davies, L.; Welch, H.G. Increasing incidence of thyroid cancer in the United States, 1973–2002. JAMA 2006, 295, 2164–2167. [Google Scholar] [CrossRef] [Scilit]
  2. Cady, B.; Rossi, R. An expanded view of risk-group definition in differentiated thyroid carcinoma. Surgery 1988, 104, 947–953. [Google Scholar]
  3. Haugen, B.R.; Alexander, E.K.; Bible, K.C.; Doherty, G.M.; Mandel, S.J.; Nikiforov, Y.E.; Pacini, F.; Randolph, G.W.; Sawka, A.M.; Schlumberger, M.; et al. 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer: The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer. Thyroid 2016, 26, 1–133. [Google Scholar] [CrossRef] [Scilit]
  4. Ullmann, T.M.; Gray, K.D.; Stefanova, D.; Limberg, J.; Buicko, J.L.; Finnerty, B.; Zarnegar, R.; Fahey, T.J., III; Beninato, T. The 2015 American Thyroid Association guidelines are associated with an increasing rate of hemithyroidectomy for thyroid cancer. Surgery 2019, 166, 349–355. [Google Scholar] [CrossRef] [Scilit]
  5. Welch, H.G.; Doherty, G.M. Saving Thyroids—Overtreatment of Small Papillary Cancers. N. Engl. J. Med. 2018, 379, 310–312. [Google Scholar] [CrossRef] [Scilit]
  6. Nikiforova, M.N.; Kimura, E.T.; Gandhi, M.; Biddinger, P.W.; Knauf, J.A.; Basolo, F.; Zhu, Z.; Giannini, R.; Salvatore, G.; Fusco, A.; et al. BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. J. Clin. Endocrinol. Metab. 2003, 88, 5399–5404. [Google Scholar] [CrossRef] [Scilit]
  7. Landa, I.; Ganly, I.; Chan, T.A.; Mitsutake, N.; Matsuse, M.; Ibrahimpasic, T.; Ghossein, R.A.; Fagin, J.A. Frequent somatic TERT promoter mutations in thyroid cancer: Higher prevalence in advanced forms of the disease. J. Clin. Endocrinol. Metab. 2013, 98, E1562–E1566. [Google Scholar] [CrossRef] [Scilit]
  8. Nixon, I.J.; Ganly, I.; Patel, S.G.; Palmer, F.L.; Whitcher, M.M.; Tuttle, R.M.; Shaha, A.; Shah, J.P. Thyroid lobectomy for treatment of well differentiated intrathyroid malignancy. Surgery 2012, 151, 571–579. [Google Scholar] [CrossRef] [Scilit]
  9. Matsuzu, K.; Sugino, K.; Masudo, K.; Nagahama, M.; Kitagawa, W.; Shibuya, H.; Ohkuwa, K.; Uruno, T.; Suzuki, A.; Magoshi, S.; et al. Thyroid lobectomy for papillary thyroid cancer: Long-term follow-up study of 1,088 cases. World J. Surg. 2014, 38, 68–79. [Google Scholar] [CrossRef] [Scilit]
  10. Hauch, A.; Al-Qurayshi, Z.; Randolph, G.; Kandil, E. Total thyroidectomy is associated with increased risk of complications for low- and high-volume surgeons. Ann. Surg. Oncol. 2014, 21, 3844–3852. [Google Scholar] [CrossRef] [Scilit]
  11. Sugitani, I.; Fujimoto, Y. Management of low-risk papillary thyroid carcinoma: Unique conventional policy in Japan and our efforts to improve the level of evidence. Surg. Today 2010, 40, 199–215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Shigematsu, N.; Takami, H.; Kubo, A. Unique treatment policy for well-differentiated thyroid cancer in Japan: Results of a questionnaire distributed to members of the Japanese Society of Thyroid Surgery and the International Association of Endocrine Surgeons. Endocr. J. 2006, 53, 829–839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Sugitani, I.; Kasai, N.; Fujimoto, Y.; Yanagisawa, A. A novel classification system for patients with PTC: Addition of the new variables of large (3 cm or greater) nodal metastases and reclassification during the follow-up period. Surgery 2004, 135, 139–148. [Google Scholar] [CrossRef] [Scilit]
  14. Ebina, A.; Sugitani, I.; Fujimoto, Y.; Yamada, K. Risk-adapted management of papillary thyroid carcinoma according to our own risk group classification system: Is thyroid lobectomy the treatment of choice for low-risk patients? Surgery 2014, 156, 1579–1589. [Google Scholar] [CrossRef] [Scilit]
  15. Nikiforov, Y.E.; Nikiforova, M.N. Molecular genetics and diagnosis of thyroid cancer. Nat. Rev. Endocrinol. 2011, 7, 569–580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Xing, M. Molecular pathogenesis and mechanisms of thyroid cancer. Nat. Rev. Cancer 2013, 13, 184–199. [Google Scholar] [CrossRef] [Scilit]
  17. Kim, T.Y.; Kim, W.B.; Rhee, Y.S.; Song, J.Y.; Kim, J.M.; Gong, G.; Lee, S.; Kim, S.Y.; Kim, S.C.; Hong, S.J.; et al. The BRAF mutation is useful for prediction of clinical recurrence in low-risk patients with conventional papillary thyroid carcinoma. Clin. Endocrinol. 2006, 65, 364–368. [Google Scholar] [CrossRef] [Scilit]
  18. Fugazzola, L.; Puxeddu, E.; Avenia, N.; Romei, C.; Cirello, V.; Cavaliere, A.; Faviana, P.; Mannavola, D.; Moretti, S.; Rossi, S.; et al. Correlation between B-RAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: Data from a multicentric Italian study and review of the literature. Endocr. Relat. Cancer 2006, 13, 455–464. [Google Scholar] [CrossRef] [Scilit]
  19. Ito, Y.; Yoshida, H.; Maruo, R.; Morita, S.; Takano, T.; Hirokawa, M.; Yabuta, T.; Fukushima, M.; Inoue, H.; Tomoda, C.; et al. BRAF mutation in papillary thyroid carcinoma in a Japanese population: Its lack of correlation with high-risk clinicopathological features and disease-free survival of patients. Endocr. J. 2009, 56, 89–97. [Google Scholar] [CrossRef] [Scilit]
  20. Bullock, M.; Ren, Y.; O’Neill, C.; Gill, A.; Aniss, A.; Sywak, M.; Sidhu, S.; Delbridge, L.; Learoyd, D.; de Vathaire, F.; et al. TERT promoter mutations are a major indicator of recurrence and death due to papillary thyroid carcinomas. Clin. Endocrinol. 2016, 85, 283–290. [Google Scholar] [CrossRef] [Scilit]
  21. Ren, H.; Shen, Y.; Hu, D.; He, W.; Zhou, J.; Cao, Y.; Mao, Y.; Dou, Y.; Xiong, W.; Xiao, Q.; et al. Co-existence of BRAFV600E and TERT promoter mutations in papillary thyroid carcinoma is associated with tumor aggressiveness, but not with lymph node metastasis. Cancer Manag. Res. 2018, 10, 1005–1013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Nasirden, A.; Saito, T.; Fukumura, Y.; Hara, K.; Akaike, K.; Kurisaki-Arakawa, A.; Asahina, M.; Yamashita, A.; Tomomasa, R.; Hayashi, T.; et al. In Japanese patients with papillary thyroid carcinoma, TERT promoter mutation is associated with poor prognosis, in contrast to BRAFV600E mutation. Virchows Arch. 2016, 469, 687–696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Gandolfi, G.; Ragazzi, M.; Frasoldati, A.; Piana, S.; Ciarrocchi, A.; Sancisi, V. TERT promoter mutations are associated with distant metastases in papillary thyroid carcinoma. Eur. J. Endocrinol. 2015, 172, 403–413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Melo, M.; da Rocha, A.G.; Vinagre, J.; Batista, R.; Peixoto, J.; Tavares, C.; Celestino, R.; Almeida, A.; Salgado, C.; Eloy, C.; et al. TERT promoter mutations are a major indicator of poor outcome in differentiated thyroid carcinomas. J. Clin. Endocrinol. Metab. 2014, 99, E754–E765. [Google Scholar] [CrossRef] [Scilit]
  25. Tanaka, A.; Matsuse, M.; Saenko, V.; Nakao, T.; Yamanouchi, K.; Sakimura, C.; Yano, H.; Nishihara, E.; Hirokawa, M.; Suzuki, K.; et al. TERT mRNA Expression as a Novel Prognostic Marker in Papillary Thyroid Carcinomas. Thyroid 2019, 29, 1105–1114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Kim, T.H.; Kim, Y.E.; Ahn, S.; Kim, J.Y.; Ki, C.S.; Oh, Y.L.; Kim, K.; Yun, J.W.; Park, W.Y.; Choe, J.H.; et al. TERT promoter mutations and long-term survival in patients with thyroid cancer. Endocr. Relat. Cancer 2016, 23, 813–823. [Google Scholar] [CrossRef] [Scilit]
  27. Liu, X.; Bishop, J.; Shan, Y.; Pai, S.; Liu, D.; Murugan, A.K.; Sun, H.; El-Naggar, A.K.; Xing, M. Highly prevalent TERT promoter mutations in aggressive thyroid cancers. Endocr. Relat. Cancer 2013, 20, 603–610. [Google Scholar] [CrossRef] [Scilit]
  28. Pestana, A.; Batista, R.; Celestino, R.; Canberk, S.; Sobrinho-Simoes, M.; Soares, P. Comprehensive Assessment of TERT mRNA Expression across a Large Cohort of Benign and Malignant Thyroid Tumours. Cancers 2020, 12, 1846. [Google Scholar] [CrossRef] [Scilit]
  29. Xing, M.; Liu, R.; Liu, X.; Murugan, A.K.; Zhu, G.; Zeiger, M.A.; Pai, S.; Bishop, J. BRAFV600E and TERT promoter mutations cooperatively identify the most aggressive papillary thyroid cancer with highest recurrence. J. Clin. Oncol. 2014, 32, 2718–2726. [Google Scholar] [CrossRef] [Scilit]
  30. Moon, S.; Song, Y.S.; Kim, Y.A.; Lim, J.A.; Cho, S.W.; Moon, J.H.; Hahn, S.; Park, D.J.; Park, Y.J. Effects of Coexistent BRAFV600E and TERT Promoter Mutations on Poor Clinical Outcomes in Papillary Thyroid Cancer: A Meta-Analysis. Thyroid 2017, 27, 651–660. [Google Scholar] [CrossRef] [Scilit]
  31. Vuong, H.G.; Altibi, A.M.A.; Duong, U.N.P.; Hassell, L. Prognostic implication of BRAF and TERT promoter mutation combination in papillary thyroid carcinoma—A meta-analysis. Clin. Endocrinol. 2017, 87, 411–417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Nikiforova, M.N.; Mercurio, S.; Wald, A.I.; Barbi de Moura, M.; Callenberg, K.; Santana-Santos, L.; Gooding, W.E.; Yip, L.; Ferris, R.L.; Nikiforov, Y.E. Analytical performance of the ThyroSeq v3 genomic classifier for cancer diagnosis in thyroid nodules. Cancer 2018, 124, 1682–1690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Sugitani, I.; Fujimoto, Y.; Yamada, K.; Yamamoto, N. Prospective outcomes of selective lymph node dissection for papillary thyroid carcinoma based on preoperative ultrasonography. World J. Surg. 2008, 32, 2494–2502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Cause-specific and disease-free survival curves for patients with or without BRAF V600E mutation. (A) Cause-specific survival; (B) disease-free survival.
Figure 1. Cause-specific and disease-free survival curves for patients with or without BRAF V600E mutation. (A) Cause-specific survival; (B) disease-free survival.
Cancers 12 02115 g001
Figure 2. Cause-specific and disease-free survival curves for patients with or without TERT promoter mutations. (A) Cause-specific survival; (B) disease-free survival.
Figure 2. Cause-specific and disease-free survival curves for patients with or without TERT promoter mutations. (A) Cause-specific survival; (B) disease-free survival.
Cancers 12 02115 g002
Figure 3. Cause-specific and disease-free survival curves for patients with TERT promoter mutations alone, BRAF mutation alone, both mutations and neither mutation. (A) Cause-specific survival; (B) disease-free survival. B+, BRAF V600E mutation-positive; B−, BRAF V600E mutation-negative; T+, TERT promoter mutation-positive; T−, TERT promoter mutation-negative.
Figure 3. Cause-specific and disease-free survival curves for patients with TERT promoter mutations alone, BRAF mutation alone, both mutations and neither mutation. (A) Cause-specific survival; (B) disease-free survival. B+, BRAF V600E mutation-positive; B−, BRAF V600E mutation-negative; T+, TERT promoter mutation-positive; T−, TERT promoter mutation-negative.
Cancers 12 02115 g003
Figure 4. Cause-specific and disease-free survival curves for patients without TERT promoter mutations who underwent lobectomy and total thyroidectomy for patients with intrathyroidal PTC with a maximal diameter of 1–4 cm. (A) Cause-specific survival; (B) disease-free survival. LT, lobectomy; TT, total thyroidectomy.
Figure 4. Cause-specific and disease-free survival curves for patients without TERT promoter mutations who underwent lobectomy and total thyroidectomy for patients with intrathyroidal PTC with a maximal diameter of 1–4 cm. (A) Cause-specific survival; (B) disease-free survival. LT, lobectomy; TT, total thyroidectomy.
Cancers 12 02115 g004
Figure 5. Cause-specific and disease-free survival curves for patients without TERT promoter mutations who underwent lobectomy and total thyroidectomy after propensity score-matching for patients with intrathyroidal PTC with a maximal diameter of 1–4 cm. (A) Cause-specific survival; (B) disease-free survival. LT, lobectomy; TT, total thyroidectomy.
Figure 5. Cause-specific and disease-free survival curves for patients without TERT promoter mutations who underwent lobectomy and total thyroidectomy after propensity score-matching for patients with intrathyroidal PTC with a maximal diameter of 1–4 cm. (A) Cause-specific survival; (B) disease-free survival. LT, lobectomy; TT, total thyroidectomy.
Cancers 12 02115 g005
Figure 6. Cause-specific and disease-free survival curves for patients with TERT promoter mutations who underwent lobectomy and total thyroidectomy for patients with intrathyroidal PTC with a maximal diameter of 1–4 cm. (A) Cause-specific survival; (B) disease-free survival. n.s., non-significant, LT, lobectomy; TT, total thyroidectomy.
Figure 6. Cause-specific and disease-free survival curves for patients with TERT promoter mutations who underwent lobectomy and total thyroidectomy for patients with intrathyroidal PTC with a maximal diameter of 1–4 cm. (A) Cause-specific survival; (B) disease-free survival. n.s., non-significant, LT, lobectomy; TT, total thyroidectomy.
Cancers 12 02115 g006
Table 1. Baseline characteristics of patients.
Table 1. Baseline characteristics of patients.
Characteristicsn = 685
Follow-up duration, years (range)10 ± 3 (1–17)
Age, years (range)52 ± 14 (15–86)
Age, n (%)
≥55 years322 (47.0%)
<55 years363 (53.0%)
Sex, female, n (%)520 (75.9%)
T, n (%) AJCC/UICC 8th edition
1b211 (30.8%)
282 (12.0%)
3a20 (2.9%)
3b229 (33.5%)
4a142 (20.7%)
4b1 (0.1%)
N, n (%) AJCC/UICC 8th edition
0362 (52.9%)
1a87 (12.7%)
1b236 (34.4%)
M, n (%) AJCC/UICC 8th edition
0635 (92.7%)
150 (7.3%)
Stage classification AJCC/UICC 8th edition, n (%)
I409 (59.6%)
II170 (24.9%)
III78 (11.4%)
IVA0 (0%)
IVB28 (4.1%)
Tumor size, n (%)
<4 cm583 (85.1%)
≥4 cm 102 (14.9%)
Total thyroidectomy, n (%)225 (32.8%)
Radioactive iodine therapy, ≥30 mCi, n (%)102 (14.9%)
Table 2. Cox proportional hazard regression analysis of genetic mutation status associated with outcomes.
Table 2. Cox proportional hazard regression analysis of genetic mutation status associated with outcomes.
MutationsCause-Specific DeathRecurrence
HR95% CIp ValueHR95% CIp Value
No mutations1 1
BRAF V600E mutation only0.560.28–3.120.1310.40.07–3.100.347
TERT promoter mutation only22.836.25–67.91<0.00114.340.67–149.970.078
BRAF V600E + TERT promoter mutations5.83.12–11.79<0.0019.182.63–57.91<0.001
HR, hazard ratio; CI, confidence interval.
Table 3. Characteristics of patients with and without BRAF V600E mutation.
Table 3. Characteristics of patients with and without BRAF V600E mutation.
CharacteristicsBRAFV600E Status, n (%)
Wild TypeMutatedp Value
N147538
Follow-up duration, years (range)9 ± 3 (1–16)10 ± 3 (1–17)<0.001
Age, years (range)46 ± 15 (15–81)54 ± 14 (15–86)<0.001
Age, n (%)
≥55 years44 (29.9%)270 (50.2%)<0.001
<55 years103 (70.1%)268 (49.8%)
Sex, female, n (%)103 (70.1%)417 (77.5%)0.066
T, n (%) AJCC/UICC 8th edition
153 (36.1%)158 (29.4%)<0.001
230 (20.4%)52 (9.7%)
3a9 (6.1%)11 (2.0%)
3b34 (23.1%)195 (36.2%)
4a21 (14.3%)121 (22.5%)
4b0 (0%)1 (0.2%)
N, n (%) AJCC/UICC 8th edition
070 (47.6%)292 (54.3%)0.045
1a14 (9.5%)73 (13.6%)
1b63 (42.9%)173 (32.2%)
M, n (%) AJCC/UICC 8th edition
0128 (87.1%)507 (94.2%)0.006
119 (12.9%)31 (5.8%)
Stage classification AJCC/UICC 8th edition, n (%)
I107 (72.8%)302 (56.1%)<0.001
II24 (16.4%)146 (27.1%)
III8 (5.4%)70 (13.1%)
IVA0 (0%)0 (0%)
IVB8 (5.4%)20 (3.7%)
Tumor size, n (%)
<4 cm120 (81.6%)463 (86.1%)0.191
≥4 cm27 (18.4%)75 (13.9%)
Total thyroidectomy, n (%)49 (33.3%)176 (32.7%)0.887
Radioactive iodine therapy, ≥30 mCi, n (%)27 (18.4%)75 (13.9%)0.191
Table 4. Characteristics of patients with and without TERT promoter mutations.
Table 4. Characteristics of patients with and without TERT promoter mutations.
CharacteristicsTERT Status, n (%)
Wild TypeMutatedp Value
N552133
Follow-up duration, years (range)12 ± 5 (1–25)9 ± 3 (1–17)0.03
Age, years (range)52 ± 13 (15–86)64 ± 10 (27–86)<0.001
Age, n (%)
≥55 years214 (38.8%)108 (81.2%)<0.001
<55 years338 (61.2%)25 (18.8%)
Sex, female, n (%)435 (78.8%)85 (63.9%)<0.001
T, n (%) AJCC/UICC 8th edition
1206 (37.3%)5 (3.8%)<0.001
265 (11.8%)17 (12.8%)
3a14 (2.6%)6 (4.4%)
3b189 (34.2%)40 (30.1%)
4a78 (14.1%)64 (48.1%)
4b0 (0%)1 (0.8%)
N, n (%) AJCC/UICC 8th edition
0308 (55.8%)54 (40.6%)0.003
1a70 (12.7%)17 (12.8%)
1b174 (31.5%)62 (46.6%)
M, n (%) AJCC/UICC 8th edition
0525 (95.1%)110 (82.7%)<0.001
127 (4.9%)23 (17.3%)
Stage classification AJCC/UICC 8th edition, n (%)
I382 (69.1%)27 (20.3%)<0.001
II123 (22.4%)47 (35.3%)
III38 (6.9%)40 (30.1%)
IVA0 (0%)0 (0%)
IVB9 (1.6%)19 (14.3%)
Tumor size, n (%)
<4 cm495 (89.7%)88 (66.2%)<0.001
≥4 cm57 (10.3%)45 (33.8%)
Total thyroidectomy, n (%)163 (29.5%)72 (54.1%)<0.001
Radioactive iodine therapy, ≥30 mCi, n (%)57 (10.3%)45 (33.8%)<0.001
Table 5. Cox proportional hazard regression analysis of variables associated with outcome.
Table 5. Cox proportional hazard regression analysis of variables associated with outcome.
CharacteristicsCause-Specific DeathRecurrence
HR95%CIp ValueHR95%CIp Value
Age ≥55 years2.471.09–6.380.031.931.13–3.350.014
Sex1.510.78–2.910.2161.220.75–1.970.41
T ≥4a1.30.56–3.140.551.060.63–1.790.82
Tumor size >4 cm3.91.89–8.42<0.0013.722.31–5.93<0.001
N1b3.271.30–8.820.0113.522.10–5.95<0.001
M12.461.17–5.150.018
TERT promoter mutation5.232.33–12.78<0.0016.463.90–10.83<0.001
HR, hazard ratio; CI, confidence interval.
Table 6. Characteristics of patients in the TERT− group before and after propensity score-matching.
Table 6. Characteristics of patients in the TERT− group before and after propensity score-matching.
CharacteristicsTERT (−)
AllBefore MatchingAfter Matching
TTLTp ValueTTLTp Value
N27659217 5959
Follow-up duration, y9.7 ± 3.210.2 ± 3.49.6 ± 3.00.30710.2 ± 0.49.6 ± 0.40.439
Age ≥55 years, n (%)115 (41.7%)33 (55.9%)82 (33.2%)0.01733 (55.9%)34 (57.6%)0.645
Sex, female, n (%)234 (84.8%)51 (86.4%)183 (84.3%)0.83951 (86.4%)53 (89.8%)0.777
Tumor dimeter, mm18.0 ± 5.118.1 ± 5.118.0 ± 6.80.25718.1 ± 5.118.4 ± 5.60.944
Bilateral tumor40 (14.5%)40 (67.8%)0 (0%)<0.00140 (67.8%)0 (0%)<0.001
T3b, n (%)98 (35.5%)28 (47.5%)70 (32.3%)0.03328 (47.5%)27 (45.8%)1.000
Pathological lymph node metastasis, n (range)0.8 ± 1.4 (0–8)1.0 ± 1.7 (0–8)0.8 ± 1.4 (0–8)0.3541.0 ± 0.7 (0–8)0.7±1.1 (0–4)0.355
Outcome
cause-specific death1 (1.7%)1 (1.7%)0 (0%)1.000 1 (1.7%)0 (0%)1.000
recurrence6 (2.2%)1 (1.7%)5 (2.3%)1.000 1 (1.7%)2 (3.4%)1.000
Complication
Hypoparathyroidism
temporary16 (5.8%)16 (27.1%)0 (0%)<0.00116 (27.1%)0 (0%)<0.001
permanent5 (1.8%)5 (8.5%)0 (0%)<0.0015 (8.5%)0 (0%)0.057
Recurrent laryngeal nerve paralysis
temporary14 (5.1%)3 (5.1%)11 (5.1%)1.000 3 (5.1%)2 (3.4%)1.000
permanent5 (1.8%)2 (3.4%)3 (1.4%)0.2912 (3.4%)0 (0%)0.496
LT, lobectomy; TT, total thyroidectomy, pN, pathologic lymph node.
Table 7. Primer sequences and concentrations for PCR.
Table 7. Primer sequences and concentrations for PCR.
(A) For Genomic PCR
GenePrimer namePrimer sequence (5′→3′)Product size (bp)Concentration (μM)
BRAFBRAF-int14_5FGCAGGTTATATAGGCTAAATAGAACTAATC3340.2
BRAF-int15_RTAGCCTCAATTCTTACCATCCAC0.2
TERT promotorTERT promotor_1FCGTCCTGCCCCTTCACCTTC1190.1
TERT promotor_1RGAAAGGAAGGGGAGGGGCTG0.1
(B) For SNaPshot
Target mutationPrimer namePrimer sequence (5′→3′)Concentration (μM)
BRAF V600EBRAF_c.1799T > A_F_60merATGCATGCATGCATGCATGCATGCATGCATGCATGCATGGTGATTTTGGTCTAGCTACAG0.3
TERT promotor C250TTERT promotor_C250T_30merATGCGCGGACCCCGCCCCGTCCCGACCCCT0.2
TERT promotor C228TTERT promotor_C228T_45merATGCATGCATGCATGCATGCATGCCCGGGTCCCCGGCCCAGCCCC0.2
(C) For direct sequencing
GenePrimer namePrimer sequence (5′→3′)
BRAFBRAF-int14_5FGCAGGTTATATAGGCTAAATAGAACTAATC
TERT promotorTERT promotor_2FCACCTTCCAGCTCCGCCTCCTC

Share and Cite

MDPI and ACS Style

Ebina, A.; Togashi, Y.; Baba, S.; Sato, Y.; Sakata, S.; Ishikawa, M.; Mitani, H.; Takeuchi, K.; Sugitani, I. TERT Promoter Mutation and Extent of Thyroidectomy in Patients with 1–4 cm Intrathyroidal Papillary Carcinoma. Cancers 2020, 12, 2115. https://doi.org/10.3390/cancers12082115

AMA Style

Ebina A, Togashi Y, Baba S, Sato Y, Sakata S, Ishikawa M, Mitani H, Takeuchi K, Sugitani I. TERT Promoter Mutation and Extent of Thyroidectomy in Patients with 1–4 cm Intrathyroidal Papillary Carcinoma. Cancers. 2020; 12(8):2115. https://doi.org/10.3390/cancers12082115

Chicago/Turabian Style

Ebina, Aya, Yuki Togashi, Satoko Baba, Yukiko Sato, Seiji Sakata, Masashi Ishikawa, Hiroki Mitani, Kengo Takeuchi, and Iwao Sugitani. 2020. "TERT Promoter Mutation and Extent of Thyroidectomy in Patients with 1–4 cm Intrathyroidal Papillary Carcinoma" Cancers 12, no. 8: 2115. https://doi.org/10.3390/cancers12082115

APA Style

Ebina, A., Togashi, Y., Baba, S., Sato, Y., Sakata, S., Ishikawa, M., Mitani, H., Takeuchi, K., & Sugitani, I. (2020). TERT Promoter Mutation and Extent of Thyroidectomy in Patients with 1–4 cm Intrathyroidal Papillary Carcinoma. Cancers, 12(8), 2115. https://doi.org/10.3390/cancers12082115

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop