Fatty Acid Synthase Inhibitor G28 Shows Anticancer Activity in EGFR Tyrosine Kinase Inhibitor Resistant Lung Adenocarcinoma Models
Abstract
1. Introduction
2. Results
2.1. EGFRm GR NSCLC Models Are Sensitive to FASN Inhibition
2.1.1. EGFRm NSCLC Models Overexpress FASN
2.1.2. PC9-GR3 Model Is Resistant to Gefitinib and Osimertinib
2.1.3. FASN Inhibitors Present Cytotoxic Effects in NSCLC Models
2.1.4. G28 Inhibits FASN in EGFRm NSCLC Models
2.1.5. Apoptosis Induction of FASN Inhibitors and EGFR TKIs Treatments
2.2. G28 Increases EGFR Activation in EGFRm NSCLC Models
2.3. G28 Reduces STAT3 Activation in T790M+ GR Models Alone or in Combination with Gefitinib
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Culture Conditions
4.2. Cell Proliferation Assays
4.3. Western Blot Analysis of Cell Lysates
4.4. Quantitative Real-Time PCR (qRT-PCR) Analysis
4.5. Inhibition of Fatty Acid Synthase Activity
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Testa, U.; Castelli, G.; Pelosi, E. Lung Cancers: Molecular Characterization, Clonal Heterogeneity and Evolution, and Cancer Stem Cells. Cancers 2018, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, W.; Song, L.; Ai, T.; Zhang, Y.; Gao, Y.; Cui, J. Prognostic value of MET, cyclin D1 and MET gene copy number in non-small cell lung cancer. J. Biomed. Res. 2013, 27, 220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choo, J.R.E.; Tan, C.S.; Soo, R.A. Treatment of EGFR T790M−Positive Non-Small Cell Lung Cancer. Target. Oncol. 2018, 13, 141–156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lynch, T.J.; Bell, D.W.; Sordella, R.; Gurubhagavatula, S.; Okimoto, R.A.; Brannigan, B.W.; Harris, P.L.; Haserlat, S.M.; Supko, J.G.; Haluska, F.G.; et al. Activating Mutations in the Epidermal Growth Factor Receptor Underlying Responsiveness of Non–Small-Cell Lung Cancer to Gefitinib. N. Engl. J. Med. 2004, 350, 2129–2139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cohen, M.H.; Williams, G.A.; Sridhara, R.; Chen, G.; McGuinn, W.D.; Morse, D.; Abraham, S.; Rahman, A.; Liang, C.; Lostritto, R.; et al. United States Food and Drug Administration Drug Approval summary: Gefitinib (ZD1839; Iressa) tablets. Clin. Cancer Res. 2004, 10, 1212–1218. [Google Scholar] [CrossRef] [Scilit]
- Barnes, T.A.; O’Kane, G.M.; Vincent, M.D.; Leighl, N.B. Third-Generation Tyrosine Kinase Inhibitors Targeting Epidermal Growth Factor Receptor Mutations in Non-Small Cell Lung Cancer. Front. Oncol. 2017, 7, 113. [Google Scholar] [CrossRef] [Scilit]
- Bean, J.; Brennan, C.; Shih, J.-Y.; Riely, G.; Viale, A.; Wang, L.; Chitale, D.; Motoi, N.; Szoke, J.; Broderick, S.; et al. MET amplification occurs with or without T790M mutations in EGFR mutant lung tumors with acquired resistance to gefitinib or erlotinib. Proc. Natl. Acad. Sci. USA 2007, 104, 20932–20937. [Google Scholar] [CrossRef] [Scilit]
- Marks, J.L.; Gong, Y.; Chitale, D.; Golas, B.; McLellan, M.D.; Kasai, Y.; Ding, L.; Mardis, E.R.; Wilson, R.K.; Solit, D.; et al. Novel MEK1 mutation identified by mutational analysis of epidermal growth factor receptor signaling pathway genes in lung adenocarcinoma. Cancer Res. 2008, 68, 5524–5528. [Google Scholar] [CrossRef] [Scilit]
- Shien, K.; Toyooka, S.; Yamamoto, H.; Soh, J.; Jida, M.; Thu, K.L.; Hashida, S.; Maki, Y.; Ichihara, E.; Asano, H.; et al. Acquired Resistance to EGFR Inhibitors Is Associated with a Manifestation of Stem cell–like Properties in Cancer Cells. Cancer Res. 2013, 73, 3051. [Google Scholar] [CrossRef] [Scilit]
- Byers, L.A.; Diao, L.; Wang, J.; Saintigny, P.; Girard, L.; Peyton, M.; Shen, L.; Fan, Y.; Giri, U.; Tumula, P.K.; et al. An Epithelial-Mesenchymal Transition Gene Signature Predicts Resistance to EGFR and PI3K Inhibitors and Identifies Axl as a Therapeutic Target for Overcoming EGFR Inhibitor Resistance. Clin. Cancer Res. 2013, 19, 279–290. [Google Scholar] [CrossRef] [Scilit]
- Takezawa, K.; Pirazzoli, V.; Arcila, M.E.; Nebhan, C.A.; Song, X.; de Stanchina, E.; Ohashi, K.; Janjigian, Y.Y.; Spitzler, P.J.; Melnick, M.A.; et al. HER2 amplification: A potential mechanism of acquired resistance to EGFR inhibition in EGFR-mutant lung cancers that lack the second-site EGFR T790M mutation. Cancer Discov. 2012, 2, 922–933. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohashi, K.; Sequist, L.V.; Arcila, M.E.; Moran, T.; Chmielecki, J.; Lin, Y.-L.; Pan, Y.; Wang, L.; de Stanchina, E.; Shien, K.; et al. Lung cancers with acquired resistance to EGFR inhibitors occasionally harbor BRAF gene mutations but lack mutations in KRAS, NRAS, or MEK1. Proc. Natl. Acad. Sci. USA 2012, 109, E2127–E2133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zulkifli, A.A.; Tan, F.H.; Putoczki, T.L.; Stylli, S.S.; Luwor, R.B. STAT3 signaling mediates tumour resistance to EGFR targeted therapeutics. Mol. Cell. Endocrinol. 2017, 451, 15–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Germain, D.; Frank, D.A. Targeting the Cytoplasmic and Nuclear Functions of Signal Transducers and Activators of Transcription 3 for Cancer Therapy. Clin. Cancer Res. 2007, 13, 5665–5669. [Google Scholar] [CrossRef] [Scilit]
- Frank, D.A. STAT3 as a central mediator of neoplastic cellular transformation. Cancer Lett. 2007, 251, 199–210. [Google Scholar] [CrossRef] [Scilit]
- Aggarwal, B.B.; Kunnumakkara, A.B.; Harikumar, K.B.; Gupta, S.R.; Tharakan, S.T.; Koca, C.; Dey, S.; Sung, B. Signal transducer and activator of transcription-3, inflammation, and cancer: How intimate is the relationship? Ann. N. Y. Acad. Sci. 2009, 1171, 59–76. [Google Scholar] [CrossRef] [Scilit]
- Rosell, R.; Karachaliou, N. Large-scale screening for somatic mutations in lung cancer. Lancet 2016, 387, 1354–1356. [Google Scholar] [CrossRef] [Scilit]
- Levy, D.E.; Darnell, J.E. Stats: Transcriptional control and biological impact. Nat. Rev. Mol. Cell Biol. 2002, 3, 651–662. [Google Scholar] [CrossRef] [Scilit]
- Yu, Y.; Zhao, Q.; Wang, Z.; Liu, X.Y. Activated STAT3 correlates with prognosis of non-small cell lung cancer and indicates new anticancer strategies. Cancer Chemother. Pharmacol. 2015, 75, 917–922. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.H.; Lu, S. A meta-analysis of STAT3 and phospho-STAT3 expression and survival of patients with non-small-cell lung cancer. Eur. J. Surg. Oncol. 2014, 40, 311–317. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.J.; Zhuang, G.; Cao, Y.; Du, P.; Kim, H.J.; Settleman, J. Drug resistance via feedback activation of stat3 in oncogene-addicted cancer cells. Cancer Cell 2014, 26, 207–221. [Google Scholar] [CrossRef] [Scilit]
- Ninomiya, T.; Takigawa, N.; Ichihara, E.; Ochi, N.; Murakami, T.; Honda, Y.; Kubo, T.; Minami, D.; Kudo, K.; Tanimoto, M.; et al. Afatinib Prolongs Survival Compared with Gefitinib in an Epidermal Growth Factor Receptor-Driven Lung Cancer Model. Mol. Cancer Ther. 2013, 12, 589–597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaib, I.; Karachaliou, N.; Pilotto, S.; Servat, J.C.; Cai, X.; Li, X.; Drozdowskyj, A.; Servat, C.C.; Yang, J.; Hu, C.; et al. Co-activation of STAT3 and YES-Associated Protein 1 (YAP1) Pathway in EGFR-Mutant NSCLC. J. Natl. Cancer Inst. 2017, 109, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanahan, D.; Weinberg, R.A.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jayakumar, A.; Tai, M.H.; Huang, W.Y.; al-Feel, W.; Hsu, M.; Abu-Elheiga, L.; Chirala, S.S.; Wakil, S.J. Human fatty acid synthase: Properties and molecular cloning. Proc. Natl. Acad. Sci. USA 1995, 92, 8695–8699. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuhajda, F.P. Fatty acid synthase and cancer: New application of an old pathway. Cancer Res. 2006, 66, 5977–5980. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.; Liu, J.-Y.; Wu, X.; Zhang, J.-T. Biochemistry, molecular biology, and pharmacology of fatty acid synthase, an emerging therapeutic target and diagnosis/prognosis marker. Int. J. Biochem. Mol. Biol. 2010, 1, 69–89. [Google Scholar]
- Puig, T.; Vázquez-Martín, A.; Relat, J.; Pétriz, J.; Menéndez, J.A.; Porta, R.; Casals, G.; Marrero, P.F.; Haro, D.; Brunet, J.; et al. Fatty acid metabolism in breast cancer cells: Differential inhibitory effects of epigallocatechin gallate (EGCG) and C75. Breast Cancer Res. Treat. 2008, 109, 471–479. [Google Scholar] [CrossRef] [Scilit]
- Jiang, B.; Li, E.-H.; Lu, Y.-Y.; Jiang, Q.; Cui, D.; Jing, Y.-F.; Xia, S.-J. Inhibition of Fatty-acid Synthase Suppresses P-AKT and Induces Apoptosis in Bladder Cancer. Urology 2012, 80, 484.e9–484.e15. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Liu, H.; Li, Z.; Zhao, Z.; Yip-Schneider, M.; Fan, Q.; Schmidt, C.M.; Chiorean, E.G.; Xie, J.; Cheng, L.; et al. Role of fatty acid synthase in gemcitabine and radiation resistance of pancreatic cancers. Int. J. Biochem. Mol. Biol. 2011, 2, 89–98. [Google Scholar]
- Zhan, N.; Li, B.; Xu, X.; Xu, J.; Hu, S. Inhibition of FASN expression enhances radiosensitivity in human non-small cell lung cancer. Oncol. Lett. 2018, 15, 4578–4584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flavin, R.; Peluso, S.; Nguyen, P.L.; Loda, M. Fatty acid synthase as a potential therapeutic target in cancer. Futur. Oncol. 2010, 6, 551–562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Colomer, R.; Sarrats, A.; Lupu, R.; Puig, T. Natural Polyphenols and their Synthetic Analogs as Emerging Anticancer Agents. Curr. Drug Targets 2016, 18, 147–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chakrawarti, L.; Agrawal, R.; Dang, S.; Gupta, S.; Gabrani, R. Therapeutic effects of EGCG: A patent review. Expert Opin. Ther. Pat. 2016, 26, 907–916. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Tian, W. Green Tea Epigallocatechin Gallate: A Natural Inhibitor of Fatty-Acid Synthase. Biochem. Biophys. Res. Commun. 2001, 288, 1200–1206. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Du, J.; Fu, X.; Liu, B.; Cao, H.; Li, T.; Su, T.; Xu, J.; Tse, A.K.-W.; Yu, Z.-L. Icaritin, a novel FASN inhibitor, exerts anti-melanoma activities through IGF-1R / STAT3 signaling. Oncotarget 2016, 7, 51251–51269. [Google Scholar] [CrossRef] [Scilit]
- Ou, Y.-C.; Li, J.-R.; Kuan, Y.-H.; Raung, S.-L.; Wang, C.-C.; Hung, Y.-Y.; Pan, P.-H.; Lu, H.-C.; Chen, C.-J. Luteolin sensitizes human 786-O renal cell carcinoma cells to TRAIL-induced apoptosis. Life Sci. 2014, 100, 110–117. [Google Scholar] [CrossRef] [Scilit]
- Blancafort, A.; Giró-Perafita, A.; Oliveras, G.; Palomeras, S.; Turrado, C.; Campuzano, Ò.; Carrión-Salip, D.; Massaguer, A.; Brugada, R.; Palafox, M.; et al. Dual fatty acid synthase and HER2 signaling blockade shows marked antitumor activity against breast cancer models resistant to anti-HER2 drugs. PLoS ONE 2015, 10, e0131241. [Google Scholar] [CrossRef] [Scilit]
- Giró-Perafita, A.; Rabionet, M.; Puig, T.; Ciurana, J. Optimization of Poli(ϵ-caprolactone) Scaffolds Suitable for 3D Cancer Cell Culture. Procedia CIRP 2016, 49, 61–66. [Google Scholar] [CrossRef] [Scilit]
- Relat, J.; Blancafort, A.; Oliveras, G.; Cufí, S.; Haro, D.; Marrero, P.F.; Puig, T. Different fatty acid metabolism effects of (-)-epigallocatechin-3-gallate and C75 in adenocarcinoma lung cancer. BMC Cancer 2012, 12, 280. [Google Scholar] [CrossRef] [Scilit]
- Ali, A.; Levantini, E.; Teo, J.T.; Goggi, J.; Clohessy, J.G.; Wu, C.S.; Chen, L.; Yang, H.; Krishnan, I.; Kocher, O.; et al. Fatty acid synthase mediates EGFR palmitoylation in EGFR mutated non-small cell lung cancer. EMBO Mol. Med. 2018, 10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vazquez-Martin, A.; Colomer, R.; Brunet, J.; Lupu, R.; Menendez, J.A. Overexpression of fatty acid synthase gene activates HER1/HER2 tyrosine kinase receptors in human breast epithelial cells. Cell Prolif. 2008, 41, 59–85. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Crous-Masó, J.; Palomeras, S.; Relat, J.; Camó, C.; Martínez-Garza, Ú.; Planas, M.; Feliu, L.; Puig, T. (−)-Epigallocatechin 3-gallate synthetic analogues inhibit fatty acid synthase and show anticancer activity in triple negative breast cancer. Molecules 2018, 23. [Google Scholar] [CrossRef] [Scilit]
- Giró-Perafita, A.; Rabionet, M.; Planas, M.; Feliu, L.; Ciurana, J.; Ruiz-Martínez, S.; Puig, T. EGCG-Derivative G28 Shows High Efficacy Inhibiting the Mammosphere-Forming Capacity of Sensitive and Resistant TNBC Models. Molecules 2019, 24, 1027. [Google Scholar] [CrossRef] [Scilit]
- Jacobsen, K.; Bertran-Alamillo, J.; Molina, M.A.; Teixidó, C.; Karachaliou, N.; Pedersen, M.H.; Castellví, J.; Garzón, M.; Codony-Servat, C.; Codony-Servat, J.; et al. Convergent Akt activation drives acquired EGFR inhibitor resistance in lung cancer. Nat. Commun. 2017, 8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, L.; Fang, S.; Chen, Y.; Yang, Z.; Yuan, Y.; Zhang, J.; Ye, L.; Gu, W. Inhibition of FASN suppresses the malignant biological behavior of non-small cell lung cancer cells via deregulating glucose metabolism and AKT/ERK pathway. Lipids Health Dis. 2019, 18, 118. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Liu, Y.; Zhang, J.-T. A new mechanism of drug resistance in breast cancer cells: Fatty acid synthase overexpression-mediated palmitate overproduction. Mol. Cancer Ther. 2008, 7, 263–270. [Google Scholar] [CrossRef] [Scilit]
- Chou, T.C.; Talalay, P. Quantitative analysis of dose-effect relationships: The combined effects of multiple drugs or enzyme inhibitors. Adv. Enzym. Regul. 1984, 22, 27–55. [Google Scholar] [CrossRef] [Scilit]
- Wu, X.; Qin, L.; Fako, V.; Zhang, J.-T. Molecular mechanisms of fatty acid synthase (FASN)-mediated resistance to anti-cancer treatments. Adv. Biol. Regul. 2014, 54, 214–221. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Wu, X.; Dong, Z.; Luo, Z.; Zhao, Z.; Xu, Y.; Zhang, J.-T. Fatty acid synthase causes drug resistance by inhibiting TNF-α and ceramide production. J. Lipid Res. 2013, 54, 776–785. [Google Scholar] [CrossRef] [Scilit]
- Giró-Perafita, A.; Palomeras, S.; Lum, D.H.; Blancafort, A.; Viñas, G.; Oliveras, G.; Pérez-Bueno, F.; Sarrats, A.; Welm, A.L.; Puig, T. Preclinical Evaluation of Fatty Acid Synthase and EGFR Inhibition in Triple Negative Breast Cancer. Clin. Cancer Res. 2016, 22, 4687–4697. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.C.; Li, C.; Gao, F.; Xu, Y.; Jiang, Z.B.; Liu, J.X.; Jin, L.Y. Epigallocatechin gallate inhibits the growth of human lung cancer by directly targeting the EGFR signaling pathway. Oncol. Rep. 2014, 31, 1343–1349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minnelli, C.; Laudadio, E.; Mobbili, G.; Galeazzi, R. Conformational Insight on WT- and Mutated-EGFR Receptor Activation and Inhibition by Epigallocatechin-3-Gallate: Over a Rational Basis for the Design of Selective Non-Small-Cell Lung Anticancer Agents. Int. J. Mol. Sci. 2020, 21, 1721. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Namiki, K.; Wongsirisin, P.; Yokoyama, S.; Sato, M.; Rawangkan, A.; Sakai, R.; Iida, K.; Suganuma, M. (−)-Epigallocatechin gallate inhibits stemness and tumourigenicity stimulated by AXL receptor tyrosine kinase in human lung cancer cells. Sci. Rep. 2020, 10, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, C.; Wei, Y.; Wei, X. AXL receptor tyrosine kinase as a promising anti-cancer approach: Functions, molecular mechanisms and clinical applications. Mol. Cancer 2019, 18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yousef, M.; Vlachogiannis, I.; Tsiani, E. Effects of Resveratrol against Lung Cancer: In Vitro and In Vivo Studies. Nutrients 2017, 9, 1231. [Google Scholar] [CrossRef] [Scilit]
- Bailon-Moscoso, N.; Cevallos-Solorzano, G.; Romero-Benavides, J.C.; Orellana, M.I.R. Natural Compounds as Modulators of Cell Cycle Arrest: Application for Anticancer Chemotherapies. Curr. Genom. 2017, 18, 106–131. [Google Scholar] [CrossRef] [Scilit]
- Hasima, N.; Ozpolat, B. Regulation of autophagy by polyphenolic compounds as a potential therapeutic strategy for cancer. Cell Death Dis. 2014, 5, e1509. [Google Scholar] [CrossRef] [Scilit]
- Lin, H.-Y.; Hou, S.-C.; Chen, S.-C.; Kao, M.-C.; Yu, C.-C.; Funayama, S.; Ho, C.-T.; Way, T.-D. (−)-Epigallocatechin Gallate Induces Fas/CD95-Mediated Apoptosis through Inhibiting Constitutive and IL-6-Induced JAK/STAT3 Signaling in Head and Neck Squamous Cell Carcinoma Cells. J. Agric. Food Chem. 2012, 60, 2480–2489. [Google Scholar] [CrossRef] [Scilit]
- Tang, S.-N.; Fu, J.; Shankar, S.; Srivastava, R.K. EGCG Enhances the Therapeutic Potential of Gemcitabine and CP690550 by Inhibiting STAT3 Signaling Pathway in Human Pancreatic Cancer. PLoS ONE 2012, 7, e31067. [Google Scholar] [CrossRef] [Scilit]
- Codony-servat, C.; Codony-servat, J.; Karachaliou, N.; Angel, M.; Chaib, I.; Ramirez, J.L.; Gil, M.D.L.L.; Solca, F. Activation of signal transducer and activator of transcription 3 (STAT3) signaling in EGFR mutant non-small-cell lung cancer (NSCLC). Oncotarget 2017, 8, 47305–47316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steelman, L.S.; Chappell, W.H.; Abrams, S.L.; Kempf, C.R.; Long, J.; Laidler, P.; Mijatovic, S.; Maksimovic-Ivanic, D.; Stivala, F.; Mazzarino, M.C.; et al. Roles of the Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR pathways in controlling growth and sensitivity to therapy-implications for cancer and aging. Aging (Albany. N.Y.) 2011, 3, 192–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| FASN | Forward | CAGGCACACACGATGGAC |
| Reverse | CGGAGTGAATCTGGGTTGAT | |
| STAT3 | Forward | CACCTTCAGGATGTCCGGAA |
| Reverse | ATCCTGGAGATTCTCTACCACTTTCA | |
| EGFR7 | Forward | CATGTCGATGGACTTCCAGA |
| Reverse | GGGACAGCTTGGATCACACT | |
| GAPDH | Forward | TCTTCCAGGAGCGAGATC |
| Reverse | CAGAGATGATGACCCTTTTG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Polonio-Alcalá, E.; Palomeras, S.; Torres-Oteros, D.; Relat, J.; Planas, M.; Feliu, L.; Ciurana, J.; Ruiz-Martínez, S.; Puig, T. Fatty Acid Synthase Inhibitor G28 Shows Anticancer Activity in EGFR Tyrosine Kinase Inhibitor Resistant Lung Adenocarcinoma Models. Cancers 2020, 12, 1283. https://doi.org/10.3390/cancers12051283
Polonio-Alcalá E, Palomeras S, Torres-Oteros D, Relat J, Planas M, Feliu L, Ciurana J, Ruiz-Martínez S, Puig T. Fatty Acid Synthase Inhibitor G28 Shows Anticancer Activity in EGFR Tyrosine Kinase Inhibitor Resistant Lung Adenocarcinoma Models. Cancers. 2020; 12(5):1283. https://doi.org/10.3390/cancers12051283
Chicago/Turabian StylePolonio-Alcalá, Emma, Sònia Palomeras, Daniel Torres-Oteros, Joana Relat, Marta Planas, Lidia Feliu, Joaquim Ciurana, Santiago Ruiz-Martínez, and Teresa Puig. 2020. "Fatty Acid Synthase Inhibitor G28 Shows Anticancer Activity in EGFR Tyrosine Kinase Inhibitor Resistant Lung Adenocarcinoma Models" Cancers 12, no. 5: 1283. https://doi.org/10.3390/cancers12051283
APA StylePolonio-Alcalá, E., Palomeras, S., Torres-Oteros, D., Relat, J., Planas, M., Feliu, L., Ciurana, J., Ruiz-Martínez, S., & Puig, T. (2020). Fatty Acid Synthase Inhibitor G28 Shows Anticancer Activity in EGFR Tyrosine Kinase Inhibitor Resistant Lung Adenocarcinoma Models. Cancers, 12(5), 1283. https://doi.org/10.3390/cancers12051283

