Cold-Atmospheric Plasma Induces Tumor Cell Death in Preclinical In Vivo and In Vitro Models of Human Cholangiocarcinoma
Abstract
:1. Introduction
2. Results
2.1. Cold Atmospheric Plasma Treatment Reduces Cholangiocarcinoma Progression in a Murine Xenograft Model
2.2. Cold Atmospheric Plasma Induces Apoptosis in Cholangiocarcinoma Cells In Vivo
2.3. Cold Atmospheric Plasma Reduces Viability of Cholangiocarcinoma Cells but Not of Normal Hepatocytes In Vitro
2.4. Cold Atmospheric Plasma Induces Cell Cycle Arrest and Apoptosis in Cholangiocarcinoma Cells
2.5. Cold Atmospheric Plasma Affects the Phenotype of Tumor-Associated Macrophage
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Treatment
4.2. Isolation and Culture of Human Hepatocytes
4.3. Xenograft Tumor Model
4.4. Cold Atmospheric Plasma Treatment
4.5. Biochemistry
4.6. Histology and (Immuno)Histochemistry
4.7. Cell Viability
4.8. RONS Determination in Culture Media
4.9. ROS Determination in Cell Lysates
4.10. Apoptosis Assay
4.11. Immunofluorescence
4.12. Western Blot Analysis
4.13. Cell Cycle Analysis
4.14. RNA and Reverse Transcription-PCR
4.15. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Banales, J.M.; Cardinale, V.; Carpino, G.; Marzioni, M.; Andersen, J.B.; Invernizzi, P.; Lind, G.E.; Folseraas, T.; Forbes, S.J.; Fouassier, L.; et al. Expert consensus document: Cholangiocarcinoma: Current knowledge and future perspectives consensus statement from the European Network for the Study of Cholangiocarcinoma (ENS-CCA). Nat. Rev. Gastroenterol. Hepatol. 2016, 13, 261–280. [Google Scholar] [CrossRef] [PubMed]
- Valle, J.; Wasan, H.; Palmer, D.H.; Cunningham, D.; Anthoney, A.; Maraveyas, A.; Madhusudan, S.; Iveson, T.; Hughes, S.; Pereira, S.P.; et al. Cisplatin plus gemcitabine versus gemcitabine for biliary tract cancer. New Engl. J. Med. 2010, 362, 1273–1281. [Google Scholar] [CrossRef] [Green Version]
- Dai, X.; Bazaka, K.; Richard, D.J.; Thompson, E.R.W.; Ostrikov, K.K. The Emerging Role of Gas Plasma in Oncotherapy. Trends Biotechnol. 2018, 36, 1183–1198. [Google Scholar] [CrossRef] [PubMed]
- Yan, D.; Sherman, J.H.; Keidar, M. Cold atmospheric plasma, a novel promising anti-cancer treatment modality. Oncotarget 2017, 8, 15977–15995. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smolkova, B.; Lunova, M.; Lynnyk, A.; Uzhytchak, M.; Churpita, O.; Jirsa, M.; Kubinova, S.; Lunov, O.; Dejneka, A. Non-Thermal Plasma, as a New Physicochemical Source, to Induce Redox Imbalance and Subsequent Cell Death in Liver Cancer Cell Lines. Cell. Physiol. Biochem. 2019, 52, 119–140. [Google Scholar]
- Vandamme, M.; Robert, E.; Lerondel, S.; Sarron, V.; Ries, D.; Dozias, S.; Sobilo, J.; Gosset, D.; Kieda, C.; Legrain, B.; et al. ROS implication in a new antitumor strategy based on non-thermal plasma. Int. J. Cancer 2012, 130, 2185–2194. [Google Scholar] [CrossRef]
- Ahn, H.J.; Kim, K.I.; Hoan, N.N.; Kim, C.H.; Moon, E.; Choi, K.S.; Yang, S.S.; Lee, J.S. Targeting cancer cells with reactive oxygen and nitrogen species generated by atmospheric-pressure air plasma. PLoS ONE 2014, 9, e86173. [Google Scholar] [CrossRef]
- Adachi, T.; Tanaka, H.; Nonomura, S.; Hara, H.; Kondo, S.; Hori, M. Plasma-activated medium induces A549 cell injury via a spiral apoptotic cascade involving the mitochondrial-nuclear network. Free Radic. Biol. Med. 2015, 79, 28–44. [Google Scholar] [CrossRef]
- Judée, F.; Vaquero, J.; Guégan, S.; Fouassier, L.; Dufour, T. Atmospheric pressure plasma jets applied to cancerology: Correlating electrical configuration with in vivo toxicity and therapeutic efficiency. J. Phys. D Appl. Phys. 2019, 52, 245201. [Google Scholar] [CrossRef] [Green Version]
- Lin, G.; Lin, K.J.; Wang, F.; Chen, T.C.; Yen, T.C.; Yeh, T.S. Synergistic antiproliferative effects of an mTOR inhibitor (rad001) plus gemcitabine on cholangiocarcinoma by decreasing choline kinase activity. Dis. Model. Mech. 2018, 11. [Google Scholar] [CrossRef] [Green Version]
- Luo, X.Y.; Meng, X.J.; Cao, D.C.; Wang, W.; Zhou, K.; Li, L.; Guo, M.; Wang, P. Transplantation of bone marrow mesenchymal stromal cells attenuates liver fibrosis in mice by regulating macrophage subtypes. Stem Cell Res. Ther. 2019, 10, 16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brulle, L.; Vandamme, M.; Ries, D.; Martel, E.; Robert, E.; Lerondel, S.; Trichet, V.; Richard, S.; Pouvesle, J.M.; Le Pape, A. Effects of a non thermal plasma treatment alone or in combination with gemcitabine in a MIA PaCa2-luc orthotopic pancreatic carcinoma model. PLoS ONE 2012, 7, e52653. [Google Scholar] [CrossRef] [PubMed]
- Hattori, N.; Yamada, S.; Torii, K.; Takeda, S.; Nakamura, K.; Tanaka, H.; Kajiyama, H.; Kanda, M.; Fujii, T.; Nakayama, G.; et al. Effectiveness of plasma treatment on pancreatic cancer cells. Int. J. Oncol. 2015, 47, 1655–1662. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Utsumi, F.; Kajiyama, H.; Nakamura, K.; Tanaka, H.; Mizuno, M.; Ishikawa, K.; Kondo, H.; Kano, H.; Hori, M.; Kikkawa, F. Effect of indirect nonequilibrium atmospheric pressure plasma on anti-proliferative activity against chronic chemo-resistant ovarian cancer cells in vitro and in vivo. PLoS ONE 2013, 8, e81576. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiang, L.; Xu, X.; Zhang, S.; Cai, D.; Dai, X. Cold atmospheric plasma conveys selectivity on triple negative breast cancer cells both in vitro and in vivo. Free Radic. Biol. Med. 2018, 124, 205–213. [Google Scholar] [CrossRef] [PubMed]
- Freund, E.; Liedtke, K.R.; van der Linde, J.; Metelmann, H.R.; Heidecke, C.D.; Partecke, L.I.; Bekeschus, S. Physical plasma-treated saline promotes an immunogenic phenotype in CT26 colon cancer cells in vitro and in vivo. Sci. Rep. 2019, 9, 634. [Google Scholar] [CrossRef]
- Binenbaum, Y.; Ben-David, G.; Gil, Z.; Slutsker, Y.Z.; Ryzhkov, M.A.; Felsteiner, J.; Krasik, Y.E.; Cohen, J.T. Cold Atmospheric Plasma, Created at the Tip of an Elongated Flexible Capillary Using Low Electric Current, Can Slow the Progression of Melanoma. PLoS ONE 2017, 12, e0169457. [Google Scholar] [CrossRef] [Green Version]
- Chen, Z.; Simonyan, H.; Cheng, X.; Gjika, E.; Lin, L.; Canady, J.; Sherman, J.H.; Young, C.; Keidar, M. A Novel Micro Cold Atmospheric Plasma Device for Glioblastoma Both In Vitro and In Vivo. Cancers (Basel) 2017, 9, 61. [Google Scholar] [CrossRef] [Green Version]
- Dubuc, A.; Monsarrat, P.; Virard, F.; Merbahi, N.; Sarrette, J.P.; Laurencin-Dalicieux, S.; Cousty, S. Use of cold-atmospheric plasma in oncology: A concise systematic review. Ther. Adv. Med. Oncol. 2018, 10, 1758835918786475. [Google Scholar] [CrossRef]
- Liedtke, K.R.; Bekeschus, S.; Kaeding, A.; Hackbarth, C.; Kuehn, J.P.; Heidecke, C.D.; von Bernstorff, W.; von Woedtke, T.; Partecke, L.I. Non-thermal plasma-treated solution demonstrates antitumor activity against pancreatic cancer cells in vitro and in vivo. Sci. Rep. 2017, 7, 8319. [Google Scholar] [CrossRef]
- Furuta, T.; Shi, L.; Toyokuni, S. Non-thermal plasma as a simple ferroptosis inducer in cancer cells: A possible role of ferritin. Pathol. Int. 2018, 68, 442–443. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, K.; Peng, Y.; Utsumi, F.; Tanaka, H.; Mizuno, M.; Toyokuni, S.; Hori, M.; Kikkawa, F.; Kajiyama, H. Novel Intraperitoneal Treatment With Non-Thermal Plasma-Activated Medium Inhibits Metastatic Potential of Ovarian Cancer Cells. Sci. Rep. 2017, 7, 6085. [Google Scholar] [CrossRef] [PubMed]
- Takeda, S.; Yamada, S.; Hattori, N.; Nakamura, K.; Tanaka, H.; Kajiyama, H.; Kanda, M.; Kobayashi, D.; Tanaka, C.; Fujii, T.; et al. Intraperitoneal Administration of Plasma-Activated Medium: Proposal of a Novel Treatment Option for Peritoneal Metastasis From Gastric Cancer. Ann. Surg. Oncol. 2017, 24, 1188–1194. [Google Scholar] [CrossRef] [PubMed]
- Arndt, S.; Wacker, E.; Li, Y.F.; Shimizu, T.; Thomas, H.M.; Morfill, G.E.; Karrer, S.; Zimmermann, J.L.; Bosserhoff, A.K. Cold atmospheric plasma, a new strategy to induce senescence in melanoma cells. Exp. Dermatol. 2013, 22, 284–289. [Google Scholar] [CrossRef]
- Schneider, C.; Gebhardt, L.; Arndt, S.; Karrer, S.; Zimmermann, J.L.; Fischer, M.J.M.; Bosserhoff, A.K. Cold atmospheric plasma causes a calcium influx in melanoma cells triggering CAP-induced senescence. Sci. Rep. 2018, 8, 10048. [Google Scholar] [CrossRef]
- Shi, L.; Ito, F.; Wang, Y.; Okazaki, Y.; Tanaka, H.; Mizuno, M.; Hori, M.; Hirayama, T.; Nagasawa, H.; Richardson, D.R.; et al. Non-thermal plasma induces a stress response in mesothelioma cells resulting in increased endocytosis, lysosome biogenesis and autophagy. Free Radic. Biol. Med. 2017, 108, 904–917. [Google Scholar] [CrossRef]
- Ito, T.; Ando, T.; Suzuki-Karasaki, M.; Tokunaga, T.; Yoshida, Y.; Ochiai, T.; Tokuhashi, Y.; Suzuki-Karasaki, Y. Cold PSM, but not TRAIL, triggers autophagic cell death: A therapeutic advantage of PSM over TRAIL. Int. J. Oncol. 2018, 53, 503–514. [Google Scholar] [CrossRef]
- Ruwan Kumara, M.H.; Piao, M.J.; Kang, K.A.; Ryu, Y.S.; Park, J.E.; Shilnikova, K.; Jo, J.O.; Mok, Y.S.; Shin, J.H.; Park, Y.; et al. Non-thermal gas plasma-induced endoplasmic reticulum stress mediates apoptosis in human colon cancer cells. Oncol. Rep. 2016, 36, 2268–2274. [Google Scholar] [CrossRef] [Green Version]
- Chang, J.W.; Kang, S.U.; Shin, Y.S.; Kim, K.I.; Seo, S.J.; Yang, S.S.; Lee, J.S.; Moon, E.; Lee, K.; Kim, C.H. Non-thermal atmospheric pressure plasma inhibits thyroid papillary cancer cell invasion via cytoskeletal modulation, altered MMP-2/-9/uPA activity. PLoS ONE 2014, 9, e92198. [Google Scholar] [CrossRef] [Green Version]
- Nguyen Ho-Bouldoires, T.H.; Claperon, A.; Mergey, M.; Wendum, D.; Desbois-Mouthon, C.; Tahraoui, S.; Fartoux, L.; Chettouh, H.; Merabtene, F.; Scatton, O.; et al. Mitogen-activated protein kinase-activated protein kinase 2 mediates resistance to hydrogen peroxide-induced oxidative stress in human hepatobiliary cancer cells. Free Radic. Biol. Med. 2015, 89, 34–46. [Google Scholar] [CrossRef] [Green Version]
- Matt, S.; Hofmann, T.G. The DNA damage-induced cell death response: A roadmap to kill cancer cells. Cell Mol. Life Sci. 2016, 73, 2829–2850. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Yu, L.; Zou, F.; Hu, H.; Liu, K.; Lin, Z. Gene expression profiling and functional analysis reveals that p53 pathway-related gene expression is highly activated in cancer cells treated by cold atmospheric plasma-activated medium. PeerJ 2017, 5, e3751. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Babington, P.; Rajjoub, K.; Canady, J.; Siu, A.; Keidar, M.; Sherman, J.H. Use of cold atmospheric plasma in the treatment of cancer. Biointerphases 2015, 10, 029403. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Keidar, M.; Walk, R.; Shashurin, A.; Srinivasan, P.; Sandler, A.; Dasgupta, S.; Ravi, R.; Guerrero-Preston, R.; Trink, B. Cold plasma selectivity and the possibility of a paradigm shift in cancer therapy. Br. J. Cancer 2011, 105, 1295–1301. [Google Scholar] [CrossRef]
- Zucker, S.N.; Zirnheld, J.; Bagati, A.; DiSanto, T.M.; Des Soye, B.; Wawrzyniak, J.A.; Etemadi, K.; Nikiforov, M.; Berezney, R. Preferential induction of apoptotic cell death in melanoma cells as compared with normal keratinocytes using a non-thermal plasma torch. Cancer Biol. Ther. 2012, 13, 1299–1306. [Google Scholar] [CrossRef]
- Biscop, E.; Lin, A.; Boxem, W.V.; Loenhout, J.V.; Backer, J.; Deben, C.; Dewilde, S.; Smits, E.; Bogaerts, A.A. Influence of Cell Type and Culture Medium on Determining Cancer Selectivity of Cold Atmospheric Plasma Treatment. Cancers (Basel) 2019, 11, 1287. [Google Scholar] [CrossRef] [Green Version]
- Aoudjehane, L.; Podevin, P.; Scatton, O.; Jaffray, P.; Dusanter-Fourt, I.; Feldmann, G.; Massault, P.P.; Grira, L.; Bringuier, A.; Dousset, B.; et al. Interleukin-4 induces human hepatocyte apoptosis through a Fas-independent pathway. FASEB J. 2007, 21, 1433–1444. [Google Scholar] [CrossRef]
- Kurake, N.; Tanaka, H.; Ishikawa, K.; Kondo, T.; Sekine, M.; Nakamura, K.; Kajiyama, H.; Kikkawa, F.; Mizuno, M.; Hori, M. Cell survival of glioblastoma grown in medium containing hydrogen peroxide and/or nitrite, or in plasma-activated medium. Arch. Biochem. Biophys. 2016, 605, 102–108. [Google Scholar] [CrossRef]
- Liedtke, K.R.; Diedrich, S.; Pati, O.; Freund, E.; Flieger, R.; Heidecke, C.D.; Partecke, L.I.; Bekeschus, S. Cold Physical Plasma Selectively Elicits Apoptosis in Murine Pancreatic Cancer Cells In Vitro and In Ovo. Anticancer Res. 2018, 38, 5655–5663. [Google Scholar] [CrossRef]
- Ye, F.; Kaneko, H.; Nagasaka, Y.; Ijima, R.; Nakamura, K.; Nagaya, M.; Takayama, K.; Kajiyama, H.; Senga, T.; Tanaka, H.; et al. Plasma-activated medium suppresses choroidal neovascularization in mice: A new therapeutic concept for age-related macular degeneration. Sci. Rep. 2015, 5, 7705. [Google Scholar] [CrossRef] [Green Version]
- Kaushik, N.K.; Kaushik, N.; Adhikari, M.; Ghimire, B.; Linh, N.N.; Mishra, Y.K.; Lee, S.J.; Choi, E.H. Preventing the Solid Cancer Progression via Release of Anticancer-Cytokines in Co-Culture with Cold Plasma-Stimulated Macrophages. Cancers (Basel) 2019, 11, 842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Azzariti, A.; Iacobazzi, R.M.; Di Fonte, R.; Porcelli, L.; Gristina, R.; Favia, P.; Fracassi, F.; Trizio, I.; Silvestris, N.; Guida, G.; et al. Plasma-activated medium triggers cell death and the presentation of immune activating danger signals in melanoma and pancreatic cancer cells. Sci. Rep. 2019, 9, 4099. [Google Scholar] [CrossRef] [PubMed]
- Aoudjehane, L.; Gautheron, J.; Le Goff, W.; Goumard, C.; Gilaizeau, J.; Nget, C.S.; Savier, E.; Atif, M.; Lesnik, P.; Morichon, R.; et al. Novel defatting strategies reduce lipid accumulation in primary human culture models of liver steatosis. Dis. Model. Mech. 2020. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vaquero, J.; Lobe, C.; Tahraoui, S.; Claperon, A.; Mergey, M.; Merabtene, F.; Wendum, D.; Coulouarn, C.; Housset, C.; Desbois-Mouthon, C.; et al. The IGF2/IR/IGF1R Pathway in Tumor Cells and Myofibroblasts Mediates Resistance to EGFR Inhibition in Cholangiocarcinoma. Clin. Cancer Res. 2018, 24, 4282–4296. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Name | Species | Manufacturer | Reference | Dilution | Antigen Unmasking |
---|---|---|---|---|---|
8-oxoguanine | M | Abcam | ab206461 | 1/100 (IHC) | EDTA pH8 |
cCaspase3 | R | CST | CST9664 | 1/100 (IHC) | Citrate pH6 |
cPARP | R | CST | CST5625 | 1/1000 (WB) | |
CHK1 | M | CST | CST2360 | 1/1000 (WB) | |
pCHK1 | R | CST | CST2348 | 1/1000 (WB) | |
F4/80 | R | Spring Bioscience | M4154 | 1/100 (IHC) | Citrate pH6 |
GAPDH | M | Santa Cruz | sc-32233 | 1/5000 (WB) | |
p53 | M | Santa Cruz | sc-126 | 1/500 (WB) | |
pp53 | R | CST | CST9284 | 1/1000 (WB) | |
γH2A.X | R | CST | CST9718 | 1/1000 (WB), 1/200 (IF) |
Gene | Protein | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|---|
Acta2 | α-Sma | CTGTCAGGAACCCTGAGACGCT | TACTCCCTGATGTCTGGGAC |
Pecam1 | CD31 | AGCCTCCAGGCTGAGGAAAA | GATGTCCACAAGGCACTCCA |
Ccr2 | Ccr2 | GGCCACCACACCGTATGACTA | AGAGATGGCCAAGTTGAGCAGATAG |
Adgre1 | F4-80 | CTTTGGCTATGGGCTTCCAGTC | GCAAGGAGGACAGAGTTTATCGTG |
Il1b | Il1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
Ccl2 | Mcp1 | GCCTGCTGTTCACAGTTGC | CAGGTGAGTGGGGCGTTA |
Tnfa | Tnfa | CCCTCACACTCAGATCATCTTCT | GCTACGACGTGGGCTACAG |
Tnfsf10 | Trail | GCTCCTGCAGGCTGTGTC | CCAATTTTGGAGTAATTGTCCTG |
Hprt1 | Hprt | TCAGTCAACGGGGGACATAA | TGCTTAACCAGGGAAAGCAAA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vaquero, J.; Judée, F.; Vallette, M.; Decauchy, H.; Arbelaiz, A.; Aoudjehane, L.; Scatton, O.; Gonzalez-Sanchez, E.; Merabtene, F.; Augustin, J.; et al. Cold-Atmospheric Plasma Induces Tumor Cell Death in Preclinical In Vivo and In Vitro Models of Human Cholangiocarcinoma. Cancers 2020, 12, 1280. https://doi.org/10.3390/cancers12051280
Vaquero J, Judée F, Vallette M, Decauchy H, Arbelaiz A, Aoudjehane L, Scatton O, Gonzalez-Sanchez E, Merabtene F, Augustin J, et al. Cold-Atmospheric Plasma Induces Tumor Cell Death in Preclinical In Vivo and In Vitro Models of Human Cholangiocarcinoma. Cancers. 2020; 12(5):1280. https://doi.org/10.3390/cancers12051280
Chicago/Turabian StyleVaquero, Javier, Florian Judée, Marie Vallette, Henri Decauchy, Ander Arbelaiz, Lynda Aoudjehane, Olivier Scatton, Ester Gonzalez-Sanchez, Fatiha Merabtene, Jérémy Augustin, and et al. 2020. "Cold-Atmospheric Plasma Induces Tumor Cell Death in Preclinical In Vivo and In Vitro Models of Human Cholangiocarcinoma" Cancers 12, no. 5: 1280. https://doi.org/10.3390/cancers12051280