Activation of LXR Receptors and Inhibition of TRAP1 Causes Synthetic Lethality in Solid Tumors
Abstract
:1. Introduction
2. Results
2.1. TRAP1 Regulates Mevalonate and Cholesterol Biosynthesis Through Modulation of SREBP2
2.2. Activation of Liver-X-Receptors Coupled with Inhibition of Mitochondrial Matrix Chaperones Elicit Synergistic Induction of Apoptosis
2.3. LXR Activation and Mitochondrial Matrix Chaperone Inhibition Induces Synergistic Endoplasmic Reticulum Stress with an Increase in ATF4
2.4. The Combination Treatment of Gamitrinib and LXR623 Elicits Anti-Cancer Activity in Conventional and Patient-Derived Xenograft Model Systems
3. Discussion
4. Material and Methods
4.1. Reagents and Antibodies
4.2. Cell Cultures and Transfection
4.3. Total Cholesterol Measurement
4.4. Cell Viability Assays
4.5. Measurement of Apoptosis and Mitochondrial Membrane Potential
4.6. Western Blot Analysis and Capillary Electrophoresis on Wes Instrument (ProteinSimple)
4.7. Real-Time PCR Analysis
4.8. Transcriptome Analysis
4.9. Subcutaneous Xenograft Models
4.10. Statistical Analysis
4.11. Study Approval
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Molina, J.R.; Sun, Y.; Protopopova, M.; Gera, S.; Bandi, M.; Bristow, C.; McAfoos, T.; Morlacchi, P.; Ackroyd, J.; Agip, A.A.; et al. An inhibitor of oxidative phosphorylation exploits cancer vulnerability. Nat. Med. 2018, 24, 1036–1046. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vander Heiden, M.G.; DeBerardinis, R.J. Understanding the Intersections between Metabolism and Cancer Biology. Cell 2017, 168, 657–669. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luengo, A.; Gui, D.Y.; Vander Heiden, M.G. Targeting Metabolism for Cancer Therapy. Cell Chem. Biol. 2017, 24, 1161–1180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mayers, J.R.; Vander Heiden, M.G. Nature and Nurture: What Determines Tumor Metabolic Phenotypes? Cancer Res. 2017, 77, 3131–3134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abate, M.; Laezza, C.; Pisanti, S.; Torelli, G.; Seneca, V.; Catapano, G.; Montella, F.; Ranieri, R.; Notarnicola, M.; Gazzerro, P.; et al. Deregulated expression and activity of Farnesyl Diphosphate Synthase (FDPS) in Glioblastoma. Sci. Rep. 2017, 7, 14123. [Google Scholar] [CrossRef] [PubMed]
- Villa, G.R.; Hulce, J.J.; Zanca, C.; Bi, J.; Ikegami, S.; Cahill, G.L.; Gu, Y.; Lum, K.M.; Masui, K.; Yang, H.; et al. An LXR-Cholesterol Axis Creates a Metabolic Co-Dependency for Brain Cancers. Cancer Cell 2016, 30, 683–693. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, D.; Reinitz, F.; Youssef, M.; Hong, C.; Nathanson, D.; Akhavan, D.; Kuga, D.; Amzajerdi, A.N.; Soto, H.; Zhu, S.; et al. An LXR agonist promotes glioblastoma cell death through inhibition of an EGFR/AKT/SREBP-1/LDLR-dependent pathway. Cancer Discov. 2011, 1, 442–456. [Google Scholar] [CrossRef]
- Pencheva, N.; Buss, C.G.; Posada, J.; Merghoub, T.; Tavazoie, S.F. Broad-spectrum therapeutic suppression of metastatic melanoma through nuclear hormone receptor activation. Cell 2014, 156, 986–1001. [Google Scholar] [CrossRef]
- Kang, B.H.; Plescia, J.; Song, H.Y.; Meli, M.; Colombo, G.; Beebe, K.; Scroggins, B.; Neckers, L.; Altieri, D.C. Combinatorial drug design targeting multiple cancer signaling networks controlled by mitochondrial Hsp90. J. Clin. Investig. 2009, 119, 454–464. [Google Scholar] [CrossRef] [Green Version]
- Leav, I.; Plescia, J.; Goel, H.L.; Li, J.; Jiang, Z.; Cohen, R.J.; Languino, L.R.; Altieri, D.C. Cytoprotective mitochondrial chaperone TRAP-1 as a novel molecular target in localized and metastatic prostate cancer. Am. J. Pathol. 2010, 176, 393–401. [Google Scholar] [CrossRef]
- Condelli, V.; Maddalena, F.; Sisinni, L.; Lettini, G.; Matassa, D.S.; Piscazzi, A.; Palladino, G.; Amoroso, M.R.; Esposito, F.; Landriscina, M. Targeting TRAP1 as a downstream effector of BRAF cytoprotective pathway: A novel strategy for human BRAF-driven colorectal carcinoma. Oncotarget 2015, 6, 22298–22309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chae, Y.C.; Angelin, A.; Lisanti, S.; Kossenkov, A.V.; Speicher, K.D.; Wang, H.; Powers, J.F.; Tischler, A.S.; Pacak, K.; Fliedner, S.; et al. Landscape of the mitochondrial Hsp90 metabolome in tumours. Nat. Commun. 2013, 4, 2139. [Google Scholar] [CrossRef] [PubMed]
- Caino, M.C.; Chae, Y.C.; Vaira, V.; Ferrero, S.; Nosotti, M.; Martin, N.M.; Weeraratna, A.; O’Connell, M.; Jernigan, D.; Fatatis, A.; et al. Metabolic stress regulates cytoskeletal dynamics and metastasis of cancer cells. J. Clin. Investig. 2013, 123, 2907–2920. [Google Scholar] [CrossRef] [PubMed]
- Siegelin, M.D.; Dohi, T.; Raskett, C.M.; Orlowski, G.M.; Powers, C.M.; Gilbert, C.A.; Ross, A.H.; Plescia, J.; Altieri, D.C. Exploiting the mitochondrial unfolded protein response for cancer therapy in mice and human cells. J. Clin. Investig. 2011, 121, 1349–1360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghosh, J.C.; Siegelin, M.D.; Vaira, V.; Faversani, A.; Tavecchio, M.; Chae, Y.C.; Lisanti, S.; Rampini, P.; Giroda, M.; Caino, M.C.; et al. Adaptive mitochondrial reprogramming and resistance to PI3K therapy. J. Natl. Cancer Inst. 2015, 107. [Google Scholar] [CrossRef] [PubMed]
- Karpel-Massler, G.; Ishida, C.T.; Bianchetti, E.; Shu, C.; Perez-Lorenzo, R.; Horst, B.; Banu, M.; Roth, K.A.; Bruce, J.N.; Canoll, P.; et al. Inhibition of Mitochondrial Matrix Chaperones and Antiapoptotic Bcl-2 Family Proteins Empower Antitumor Therapeutic Responses. Cancer Res. 2017, 77, 3513–3526. [Google Scholar] [CrossRef] [Green Version]
- Albert, M.C.; Brinkmann, K.; Kashkar, H. Noxa and cancer therapy: Tuning up the mitochondrial death machinery in response to chemotherapy. Mol. Cell. Oncol. 2014, 1, e29906. [Google Scholar] [CrossRef]
- Iurlaro, R.; Munoz-Pinedo, C. Cell death induced by endoplasmic reticulum stress. FEBS J. 2016, 283, 2640–2652. [Google Scholar] [CrossRef]
- DeBerardinis, R.J.; Chandel, N.S. Fundamentals of cancer metabolism. Sci. Adv. 2016, 2, e1600200. [Google Scholar] [CrossRef]
- Block, K.I.; Gyllenhaal, C.; Lowe, L.; Amedei, A.; Amin, A.; Amin, A.; Aquilano, K.; Arbiser, J.; Arreola, A.; Arzumanyan, A.; et al. Designing a broad-spectrum integrative approach for cancer prevention and treatment. Semin. Cancer Biol. 2015, 35, S276–S304. [Google Scholar] [CrossRef]
- Alizadeh, J.; Zeki, A.A.; Mirzaei, N.; Tewary, S.; Rezaei Moghadam, A.; Glogowska, A.; Nagakannan, P.; Eftekharpour, E.; Wiechec, E.; Gordon, J.W.; et al. Mevalonate Cascade Inhibition by Simvastatin Induces the Intrinsic Apoptosis Pathway via Depletion of Isoprenoids in Tumor Cells. Sci. Rep. 2017, 7, 44841. [Google Scholar] [CrossRef]
- Eyler, C.E.; Rich, J.N. Survival of the fittest: Cancer stem cells in therapeutic resistance and angiogenesis. J. Clin. Oncol. 2008, 26, 2839–2845. [Google Scholar] [CrossRef]
- Wang, X.; Huang, Z.; Wu, Q.; Prager, B.C.; Mack, S.C.; Yang, K.; Kim, L.J.Y.; Gimple, R.C.; Shi, Y.; Lai, S.; et al. MYC-Regulated Mevalonate Metabolism Maintains Brain Tumor-Initiating Cells. Cancer Res. 2017, 77, 4947–4960. [Google Scholar] [CrossRef]
- Park, H.K.; Hong, J.H.; Oh, Y.T.; Kim, S.S.; Yin, J.; Lee, A.J.; Chae, Y.C.; Kim, J.H.; Park, S.H.; Park, C.K.; et al. Interplay between TRAP1 and Sirtuin-3 Modulates Mitochondrial Respiration and Oxidative Stress to Maintain Stemness of Glioma Stem Cells. Cancer Res. 2019, 79, 1369–1382. [Google Scholar] [CrossRef]
- Deng, Y.Z.; Cai, Z.; Shi, S.; Jiang, H.; Shang, Y.R.; Ma, N.; Wang, J.J.; Guan, D.X.; Chen, T.W.; Rong, Y.F.; et al. Cilia loss sensitizes cells to transformation by activating the mevalonate pathway. J. Exp. Med. 2018, 215, 177–195. [Google Scholar] [CrossRef]
- Wen, Y.A.; Xiong, X.; Zaytseva, Y.Y.; Napier, D.L.; Vallee, E.; Li, A.T.; Wang, C.; Weiss, H.L.; Evers, B.M.; Gao, T. Downregulation of SREBP inhibits tumor growth and initiation by altering cellular metabolism in colon cancer. Cell Death Dis. 2018, 9, 265. [Google Scholar] [CrossRef]
- Che, L.; Chi, W.; Qiao, Y.; Zhang, J.; Song, X.; Liu, Y.; Li, L.; Jia, J.; Pilo, M.G.; Wang, J.; et al. Cholesterol biosynthesis supports the growth of hepatocarcinoma lesions depleted of fatty acid synthase in mice and humans. Gut 2019. [Google Scholar] [CrossRef]
- Griffiths, B.; Lewis, C.A.; Bensaad, K.; Ros, S.; Zhang, Q.; Ferber, E.C.; Konisti, S.; Peck, B.; Miess, H.; East, P.; et al. Sterol regulatory element binding protein-dependent regulation of lipid synthesis supports cell survival and tumor growth. Cancer Metab. 2013, 1, 3. [Google Scholar] [CrossRef]
- Svensson, R.U.; Parker, S.J.; Eichner, L.J.; Kolar, M.J.; Wallace, M.; Brun, S.N.; Lombardo, P.S.; Van Nostrand, J.L.; Hutchins, A.; Vera, L.; et al. Inhibition of acetyl-CoA carboxylase suppresses fatty acid synthesis and tumor growth of non-small-cell lung cancer in preclinical models. Nat. Med. 2016, 22, 1108–1119. [Google Scholar] [CrossRef] [Green Version]
- Campos, B.; Wan, F.; Farhadi, M.; Ernst, A.; Zeppernick, F.; Tagscherer, K.E.; Ahmadi, R.; Lohr, J.; Dictus, C.; Gdynia, G.; et al. Differentiation therapy exerts antitumor effects on stem-like glioma cells. Clin. Cancer Res. 2010, 16, 2715–2728. [Google Scholar] [CrossRef]
- Karpel-Massler, G.; Ishida, C.T.; Bianchetti, E.; Zhang, Y.; Shu, C.; Tsujiuchi, T.; Banu, M.A.; Garcia, F.; Roth, K.A.; Bruce, J.N.; et al. Induction of synthetic lethality in IDH1-mutated gliomas through inhibition of Bcl-xL. Nat. Commun. 2017, 8, 1067. [Google Scholar] [CrossRef]
Gene | Forward Sequence | Reserve Sequence |
---|---|---|
HMGCS1 | AAGTCACACAAGATGCTACACCG | TCAGCGAAGACATCTGGTGCCA |
HMGCR | GACGTGAACCTATGCTGGTCAG | GGTATCTGTTTCAGCCACTAAGG |
MVK | GGAAAGTGGACCTCAGCTTACC | GCTTCTCCACTTGCTCTGAGGT |
PMVK | GCCTTTCGGAAGGACATGATCC | ACTCTCCGTGTGTCACTCACCA |
DHCR7 | TCCACAGCCATGTGACCAATGC | CGAAGTGGTCATGGCAGATGTC |
XBP1 | CTGCCAGAGATCGAAAGAAGGC | CTCCTGGTTCTCAACTACAAGGC |
CEBPB | AGAAGACCGTGGACAAGCACAG | CTCCAGGACCTTGTGCTGCGT |
CHOP (DDIT3) | GGTATGAGGACCTGCAAGAGGT | CTTGTGACCTCTGCTGGTTCTG |
Noxa (PMAIP1) | CTGGAAGTCGAGTGTGCTACTC | TGAAGGAGTCCCCTCATGCAAG |
GRP78 (HSPA5) | CTGTCCAGGCTGGTGTGCTCT | CTTGGTAGGCACCACTGTGTTC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nguyen, T.T.T.; Ishida, C.T.; Shang, E.; Shu, C.; Bianchetti, E.; Karpel-Massler, G.; Siegelin, M.D. Activation of LXR Receptors and Inhibition of TRAP1 Causes Synthetic Lethality in Solid Tumors. Cancers 2019, 11, 788. https://doi.org/10.3390/cancers11060788
Nguyen TTT, Ishida CT, Shang E, Shu C, Bianchetti E, Karpel-Massler G, Siegelin MD. Activation of LXR Receptors and Inhibition of TRAP1 Causes Synthetic Lethality in Solid Tumors. Cancers. 2019; 11(6):788. https://doi.org/10.3390/cancers11060788
Chicago/Turabian StyleNguyen, Trang Thi Thu, Chiaki Tsuge Ishida, Enyuan Shang, Chang Shu, Elena Bianchetti, Georg Karpel-Massler, and Markus D. Siegelin. 2019. "Activation of LXR Receptors and Inhibition of TRAP1 Causes Synthetic Lethality in Solid Tumors" Cancers 11, no. 6: 788. https://doi.org/10.3390/cancers11060788