Efficacy of 5-Aminolevulinic Acid in Photodynamic Detection and Photodynamic Therapy in Veterinary Medicine
Abstract
:1. Introduction
2. Results
2.1. Photodynamic Detection (PDD)
2.2. Photodynamic Therapy (PDT) in Dogs and Cats
2.3. Photodynamic Therapy (PDT) In Vitro
2.4. Expression of mRNA Associated with PpIX Accumulation
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Photodynamic Detection
4.2.1. Animals
4.2.2. PDD Using 5-ALA
4.2.3. Histology
4.3. PDT in Dogs and Cats
4.3.1. Animals
4.3.2. PDT Using 5-ALA
4.4. PDT In Vitro
4.4.1. Primary Cells
4.4.2. Cell Culture Conditions
4.4.3. Evaluation of the Cytotoxic Effects of Different 5-ALA Doses on Different Primary Cells
4.4.4. Intracellular PpIX Concentration in Different Primary Cells
4.4.5. Detection of mRNA Levels by Quantitative Real-Time Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Dougherty, T.J.; Gomer, C.J.; Henderson, B.W.; Jori, G.; Kessel, D.; Korbelik, M.; moan, J.; Peng, Q. Photodynamic therapy. J. Natl. Cancer Inst. 1998, 90, 889–905. [Google Scholar] [CrossRef]
- Sibata, C.H.; Colussi, V.C.; Oleinick, N.L.; Kinsella, T.J. Photodynamic therapy: A new concept in medical treatment. Braz. J. Med. Biol. Res. 2000, 33, 869–880. [Google Scholar] [CrossRef]
- Yoon, I.; Li, J.Z.; Shim, Y.K. Advance in photosensitizers and light delivery for photodynamic therapy. Clin. Endosc. 2013, 46, 7–23. [Google Scholar] [CrossRef]
- Agostinis, P.; Berg, K.; Cengel, K.A.; Foster, T.H.; Girotti, A.W.; Golinick, S.O.; Hahn, S.M.; Hamblin, M.R.; Juzeniene, A.; Kessel, D.; et al. Photodynamic therapy of cancer: An update. CA Cancer J. Clin. 2011, 61, 250–281. [Google Scholar] [CrossRef]
- Silva, Z.S., Jr.; Bussadori, S.K.; Fernandes, K.P.; Huang, Y.Y.; Hamblin, M.R. Animal models for photodynamic therapy (PDT). Biosci. Rep. 2015, 35, e00265. [Google Scholar] [CrossRef] [PubMed]
- Jocham, D.; Stepp, H.; Waidelich, R. Photodynamic diagnosis in urology: State-of-the-art. Eur. Urol. 2008, 53, 1138–1148. [Google Scholar] [CrossRef]
- Nokes, B.; Apel, M.; Jones, C.; Brown, G.; Lang, J.E. Aminolevulinic acid (ALA): Photodynamic detection and potential therapeutic applications. J. Surg. Res. 2013, 181, 262–271. [Google Scholar] [CrossRef] [PubMed]
- Peng, Q.; Warloe, T.; Berg, K.; Moan, J.; Kongshaug, M.; Giercksky, K.E.; Nesland, J.M. 5-Aminolevulinic acid-based photodynamic therapy. Clinical research and future challenges. Cancer 1997, 79, 2282–2308. [Google Scholar] [CrossRef]
- Wachowska, M.; Muchowicz, A.; Firczuk, M.; Gabrysiak, M.; Winiarska, M.; Wańczyk, M.; Bojarczuk, K.; Golab, J. Aminolevulinic acid (ALA) as a prodrug in photodynamic therapy of cancer. Molecules 2011, 16, 4140–4164. [Google Scholar] [CrossRef]
- Kausch, I.; Sommerauer, M.; Montorsi, F.; Stenzl, A.; Jacqmin, D.; Jichlinski, P.; Jocham, D.; Ziegler, A.; Vonthein, R. Photodynamic diagnosis in non-muscle-invasive bladder cancer: A systematic review and cumulative analysis of prospective studies. Eur. Urol. 2010, 57, 595–606. [Google Scholar] [CrossRef] [PubMed]
- D’Hallewin, M.A.; Bezdetnaya, L.; Guillemin, F. Fluorescence detection of bladder cancer: A review. Eur. Urol. 2002, 42, 417–425. [Google Scholar]
- Ferraro, N.; Barbarite, E.; Albert, T.R.; Berchmans, E.; Shah, A.H.; Bregy, A.; Ivan, M.E.; Brown, T.; Komotar, R.J. The role of 5-aminolevulinic acid in brain tumor surgery: A systematic review. Neurosurg. Rev. 2016, 39, 545–555. [Google Scholar] [CrossRef] [PubMed]
- Kaneko, S.; Kaneko, S. Fluorescence-guided resection of malignant glioma with 5-ALA. Int. J. Biomed. Imaging 2016, 2016, 6135293. [Google Scholar] [CrossRef] [PubMed]
- Buinauskaite, E.; Maciulaitis, R.; Buinauskiene, J.; Valiukeviciene, S. Topical photodynamic therapy of actinic keratoses with 5-aminolevulinic acid: Randomized controlled trial with six months follow-up. J. Dermatol. Treat. 2014, 25, 519–522. [Google Scholar] [CrossRef]
- Truchuelo, M.T.; Pérez, B.; Fernández-Guarino, M.; Moreno, C.; Jaén-Olasolo, P. Fluorescence diagnosis and photodynamic therapy for Bowen’s disease treatment. J. Eur. Acad. Dermatol. Venereol. 2014, 28, 86–93. [Google Scholar] [CrossRef]
- Griškjans, Ž.; Derjabo, A.; Čēma, I. 5-Aminolevulinic acid based photodynamic therapy for basal cell carcinoma: A 10-years follow-up study. Stomatologija 2013, 15, 32–36. [Google Scholar] [PubMed]
- Osaki, T.; Yokoe, I.; Ogura, S.; Takahashi, K.; Murakami, K.; Inoue, K.; Ishizuka, M.; Tanaka, T.; Li, L.; Sugiyama, A.; et al. Photodynamic detection of canine mammary gland tumours after oral administration of 5-aminolevulinic acid. Vet. Comp. Oncol. 2017, 15, 731–739. [Google Scholar] [CrossRef]
- Stell, A.J.; Dobson, J.M.; Langmack, K. Photodynamic therapy of feline superficial squamous cell carcinoma using topical 5-aminolaevulinic acid. J. Small Anim. Pract. 2001, 42, 164–169. [Google Scholar] [CrossRef]
- Bexfield, N.H.; Stell, A.J.; Gear, R.N.; Dobson, J.M. Photodynamic therapy of superficial nasal planum squamous cell carcinomas in cats: 55 cases. J. Vet. Intern. Med. 2008, 22, 1385–1389. [Google Scholar] [CrossRef]
- Lucroy, M.D.; Ridgway, T.D.; Peavy, G.M.; Krasieva, T.B.; Higbee, R.G.; Campbell, G.A.; Blaik, M.A. Preclinical evaluation of 5-aminolevulinic acid-based photodynamic therapy for canine transitional cell carcinoma. Vet. Comp. Oncol. 2003, 1, 76–85. [Google Scholar] [CrossRef] [PubMed]
- Ridgway, T.D.; Lucroy, M.D. Phototoxic effects of 635-nm light on canine transitional cell carcinoma cells incubated with 5-aminolevulinic acid. Am. J. Vet. Res. 2003, 64, 131–136. [Google Scholar] [CrossRef]
- Grimbergen, M.C.; van Swol, C.F.; Jonges, T.G.; Boon, T.A.; van Moorselaar, R.J. Reduced specificity of 5-ALA induced fluorescence in photodynamic diagnosis of transitional cell carcinoma after previous intravesical therapy. Eur. Urol. 2003, 44, 51–56. [Google Scholar] [CrossRef]
- Koenig, F.; McGovern, F.J.; Larne, R.; Enquist, H.; Schomacker, K.T.; Deutsch, T.F. Diagnosis of bladder carcinoma using protoporphyrin IX fluorescence induced by 5-aminolae- vulinic acid. BJU Int. 1999, 83, 129–135. [Google Scholar] [CrossRef] [PubMed]
- Kriegmair, M.; Baumgartner, R.; Knüchel, R.; Stepp, H.; Hofstädter, F.; Hofstetter, A. Detection of early bladder cancer by 5-aminolevulinic acid induced porphyrin fluorescence. J. Urol. 1996, 155, 105–109. [Google Scholar] [CrossRef]
- Riedl, C.R.; Plas, E.; Pflüger, H. Fluorescence detection of bladder tumors with 5-amino-levulinic acid. J. Endourol. 1999, 13, 755–759. [Google Scholar] [CrossRef] [PubMed]
- Filbeck, T.; Roessler, W.; Knuechel, R.; Straub, M.; Kiel, H.J.; Wieland, W.F. Clinical results of the transurethral resection and evaluation of superficial bladder carcinomas by means of fluorescence diagnosis after intravesical instillation of 5-aminolevulinic acid. J. Endourol. 1999, 13, 117–121. [Google Scholar] [CrossRef] [PubMed]
- Zaak, D.; Hungerhuber, E.; Schneede, P.; Stepp, H.; Frimberger, D.; Corvin, S.; Schmeller, N.; Kriegmair, M.; Hofstetter, A.; Knuechel, R. Role of 5-aminolevulinic acid in the detection of urothelial premalignant lesions. Cancer 2002, 95, 1234–1238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hungerhuber, E.; Stepp, H.; Kriegmair, M.; Stief, C.; Hofstetter, A.; Hartmann, A.; Knuechel, R.; Karl, A.; Tritschier, S.; Zaak, D. Seven years’ experience with 5-aminolevulinic acid in detection of transitional cell carcinoma of the bladder. Urology 2007, 69, 260–264. [Google Scholar] [CrossRef]
- Panciani, P.P.; Fontanella, M.; Schatlo, B.; Garbossa, D.; Agnoletti, A.; Ducati, A.; Lanotte, M. Fluorescence and image guided resection in high grade glioma. Clin. Neurol. Neurosurg. 2012, 114, 37–41. [Google Scholar] [CrossRef]
- Roberts, D.W.; Valdés, P.A.; Harris, B.T.; Fontaine, K.M.; Hartov, A.; Fan, X.; Ji, S.; Lollis, S.S.; Pogue, B.W.; Leblond, F.; et al. Coregistered fluorescence-enhanced tumor resection of malignant glioma: Relationships between δ-aminolevulinic acid-induced protoporphyrin IX fluorescence, magnetic resonance imaging enhancement, and neuropathological parameters. Clinical article. J. Neurosurg. 2011, 114, 595–603. [Google Scholar] [CrossRef]
- Díez Valle, R.; Tejada Solis, S.; Idoate Gastearena, M.A.; García de Eulate, R.; Domínguez Echávarri, P.; Aristu Mendiroz, J. Surgery guided by 5-aminolevulinic fluorescence in glioblastoma: Volumetric analysis of extent of resection in single-center experience. J. Neurooncol. 2011, 102, 105–113. [Google Scholar] [CrossRef]
- Hefti, M.; von Campe, G.; Moschopulos, M.; Siegner, A.; Looser, H.; Landolt, H. 5-Aminolevulinic acid induced protoporphyrin IX fluorescence in high-grade glioma surgery: A one-year experience at a single institutuion. Swiss Med. Wkly. 2008, 138, 180–185. [Google Scholar] [PubMed]
- Stummer, W.; Novotny, A.; Stepp, H.; Goetz, C.; Bise, K.; Reulen, H.J. Fluorescence-guided resection of glioblastoma multiforme by using 5-aminolevulinic acid-induced porphyrins: A prospective study in 52 consecutive patients. J. Neurosurg. 2000, 93, 1003–1013. [Google Scholar] [CrossRef]
- Hadjipanayis, C.G.; Widhalm, G.; Stummer, W. What is the surgical benefit of utilizing 5-aminolevulinic acid for fluorescence-guided surgery of malignant gliomas? Neurosurg. 2015, 77, 663–673. [Google Scholar] [CrossRef]
- Teshigawara, T.; Mizuno, M.; Ishii, T.; Kitajima, Y.; Utsumi, F.; Sakata, J.; Kajiyama, H.; Shibata, K.; Ishizuka, M.; Kikkawa, F. Novel potential photodynamic therapy strategy using 5-aminolevulinic acid for ovarian clear-cell carcinoma. Photodiagnosis Photodyn. Ther. 2018, 21, 121–127. [Google Scholar] [CrossRef]
- Wang, H.P.; Qian, S.Y.; Schafer, F.Q.; Domann, F.E.; Oberley, L.W.; Buettner, G.R. Phospholipid hydroperoxide glutathione peroxidase protects against singlet oxygen-induced cell damage of photodynamic therapy. Free Radic. Biol. Med. 2001, 30, 825–835. [Google Scholar] [CrossRef]
- Nakai, Y.; Tatsumi, Y.; Miyake, M.; Anai, S.; Kuwada, M.; Onishi, S.; Chihara, Y.; Tanaka, N.; Hirao, Y.; Fujimoto, K. Expression of ferrochelatase has a strong correlation in protoporphyrin IX accumulation with photodynamic detection of bladder cancer. Photodiagnosis Photodyn. Ther. 2016, 13, 225–232. [Google Scholar] [CrossRef] [PubMed]
- Teng, L.; Nakada, M.; Zhao, S.G.; Endo, Y.; Furuyama, N.; Nambu, E.; Pyko, I.V.; Hayashi, Y.; Jamada, J.I. Silencing of ferrochelatase enhances 5-aminolevulinic acid-based fluorescence and photodynamic therapy efficacy. Br. J. Cancer 2011, 104, 798–807. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Osaki, T.; Sunden, Y.; Sugiyama, A.; Azuma, K.; Murahata, Y.; Tsuka, T.; Ito, N.; Imagawa, T.; Okamoto, Y. Establishment of a canine mammary gland tumor cell line and characterization of its miRNA expression. J. Vet. Sci. 2016, 17, 385–390. [Google Scholar] [CrossRef] [Green Version]
Malignant Tumors (103/116) 1 | Benign Tumors (8/14) | Non-Neoplastic Lesions (6/14) | ||
---|---|---|---|---|
Carcinomas (57/64) | Sarcomas (32/36) | Other Tumors (14/16) | ||
Mammary gland tumor (29/32) | Osteosarcoma (7/8) | Mast cell tumor (11/13) | Skin appendage tumor (2/3) | Lymphadenopathy (1/4) |
Transitional cell carcinoma (5/5) | Leiomyosarcoma (5/5) | Lymphoma (3/3) | Lipoma (0/2) | Nodular hyperplasia (2/2) |
Adenocarcinoma (5/5) | Melanoma (5/5) | Sebaceous gland tumor (1/1) | Adenomatous hyperplasia (1/1) | |
Sertoli cell tumor (2/4) | Liposarcoma (5/5) | Histiocytoma (1/1) | Cystitis (1/2) | |
Thyroid carcinoma (3/3) | Hemangiosarcoma (2/5) | Plasmacytoma (1/1) | Panniculitis (1/2) | |
Schwanoma (2/3) | Hemangiopericytoma (3/3) | Trichoepithelioma (1/1) | Granuloma (0/1) | |
Hepatocellular carcinoma (3/3) | Sarcoma (1/1) | Transitional cell papilloma (1/1) | Rhinitis (0/1) | |
Squamous cell carcinoma (3/3) | Chondrosarcoma (1/1) | Granular cell tumor (1/1) | Testitis (0/1) | |
Perianal gland tumor (1/1) | Fibrosarcoma (1/1) | Fibroma (0/1) | ||
Salivary gland carcinoma (1/1) | Gastrointestinal stromal tumor (1/1) | Leiomyoma (0/1) | ||
Malignant trichoepithelioma (1/1) | Histiocytic sarcoma (1/1) | Myelolipoma (0/1) | ||
Sebaceous gland carcinoma (1/1) | ||||
Glioblastoma (1/1) | ||||
Astrocytoma (0/1) |
No. | Species | Breed | Age (y) | Sex 1 | Weight (kg) | Tumor Type | Tumor Site | Simultaneous Therapy | Fluorescence |
---|---|---|---|---|---|---|---|---|---|
1 | Dog | Minatare Schnauzer | 6 | M | 8 | Histiocytoma | Nasal planum | + | |
2 | Dog | Dogo Argentino | 9 | F | 30 | Mast cell tumor/Mast cell tumor | Skin | +/+ | |
3 | Dog | Chihuahua | 12 | SF | 2.8 | Transitional cell carcinoma | Nasal cavity | + | |
4 | Cat | American shorthair | 11 | F | 3.3 | Sebaceous gland carcinoma | Skin | + | |
5 | Cat | Mix | 11 | SF | 4.3 | Fibrosarcoma | Subcutis | N.A. 2 | |
6 | Cat | Mix | 8 | F | 4.6 | Mammary gland tumor | Mammary gland | + | |
7 | Cat | Mix | 13 | F | 4.5 | Mammary gland tumor | Lymph node | + | |
8 | Dog | Mix | 15 | M | 6.8 | Hemangiopericytoma | Skin | + | |
9 | Dog | Golden Retriever | 6 | CM | 30 | Myeloma | Calcaneus | Melphalan | N.A. |
10 | Dog | Mix | 12 | F | 21.3 | Adenocarcinoma | Paranasal sinus | Doxorubicin, Carboplatin | + |
11 | Dog | Mix | 11 | M | 17.4 | Transitional cell carcinoma | Lower urinary tract | Doxorubicin, Carboplatin | N.A. |
12 | Dog | Minatare Dachshund | 13 | SF | 4.2 | Adenocarcinoma | Nasal cavity | Lapatinib | + |
13 | Dog | Mix | 10 | M | 15 | Chondrosarcoma | Nasal cavity | Lapatinib | + |
14 | Dog | Minatare Dachshund | 9 | F | 3.6 | Inflammatory mammary gland tumor | Mammary gland | Lapatinib | - |
No. | Light Equipment | Light Intensity (mW/cm2) 1 (mW/cm) 2 | Total Light Fluence (J/cm2) 3 (J/cm) 4 | Number of Treatments | Response 5 | Survival Time/Follow-up Period | Outcome | ||
---|---|---|---|---|---|---|---|---|---|
1 | LED | 200 | 240 | 5 | CR | 82 | Alive | ||
2 | LED | 200 | 60 | 1/1 | CR/SD | 47/39 | -/Surgical extraction | ||
3 | LED | 200 | 300 | 3 | PR | 75 | PDT with another PS 6 | ||
4 | LED | 200 | 120 | 4 | PR | 70 | PDT with another PS | ||
5 | Diode laser | 150 | 270 | 5 | SD | 74 | Surgical extraction | ||
6 | Diode laser | 50 | 20 | 3 | PR | 14 | Died (metastasis) | ||
7 | Diode laser | 200 | 200 | 4 | SD | 114 | Euthanized | ||
8 | Diode laser | 300 | 200 | 11 | PR | 58 | Surgical extraction | ||
9 | Diode laser | 200 | 270 | 16 | PD | 334 | Died (progress of disease) | ||
10 | Diode laser | 150 | 270 | 15 | CR | 718 | Died (progression of brain tumor) | ||
11 | Diode laser | 150 | 270 | 15 | PR | 393 | Died (old age) | ||
12 | Diode laser | 300 | 700 | 19 | PR | 355 | Treatment interruption | ||
13 | Diode laser | 320 | 800 | 16 | PD | 232 | Died (progress of disease) | ||
14 | Diode laser | 250 | 1,000 | 5 | PD | 10 | Treatment interruption |
PpIX vs. | PEPT1 | PEPT2 | GAT2 | TAUT | PAT1 | ABCG2 | ABCB6 | |
Carcinomas | r | −0.1493 | 0.2446 | −0.03814 | −0.1145 | −0.5074 | 0.08762 | −0.02171 |
R square | 0.02230 | 0.05985 | 0.001454 | 0.01312 | 0.2575 | 0.007678 | 0.0004713 | |
P values | 0.3507 | 0.2629 | 0.4612 | 0.3846 | 0.0816 | 0.4113 | 0.4779 | |
Sarcomas | r | −0.4824 | 0.1172 | −0.7321 | 0.09674 | −0.6289 | −0.2354 | −0.2986 |
R square | 0.2327 | 0.01374 | 0.5360 | 0.009359 | 0.3955 | 0.05540 | 0.08914 | |
P values | 0.1663 | 0.4125 | 0.0490 | 0.4277 | 0.0905 | 0.3267 | 0.2827 | |
PpIX vs. | HMBS | UROS | UROD | CPOX | FECH | HO-1 | ||
Carcinomas | r | −0.2590 | −0.4702 | −0.4961 | −0.3044 | −0.6368 | −0.4461 | |
R square | 0.06709 | 0.2211 | 0.2461 | 0.09268 | 0.4055 | 0.1990 | ||
P values | 0.2505 | 0.1007 | 0.0872 | 0.2129 | 0.0326 | 0.1144 | ||
Sarcomas | r | 0.2535 | 0.7561 | 0.04538 | 0.3548 | −0.001319 | 0.4609 | |
R square | 0.06428 | 0.5717 | 0.002059 | 0.1259 | 1.739e-006 | 0.2124 | ||
P values | 0.3139 | 0.0410 | 0.4660 | 0.2450 | 0.4990 | 0.1788 |
No. | Primary Tumor Cell Name | Tumor Type (Origin) | Passage |
---|---|---|---|
Carcinomas | |||
1 | INT | Basal cell carcinoma (peritoneal dissemination) | 8 |
2 | Jack | Prostate cancer (Prostate) | 14 |
3 | Gal | Squamous cell carcinoma (Nasal cavity) | 16 |
4 | YDP | Transitional cell carcinoma (Bladder) | 9 |
5 | HDC | Adenocarcinoma (Lung) | 8 |
6 | LuBi | Adenocarcinoma (Lung) | 20 |
7 | JDM | Adenocarcinoma (Lung) | 25 |
8 | FBC | Adenocarcinoma (Nasal cavity) | 20 |
9 | SNP | Mammary gland tumor (Malignant pleural effusion) | 91 |
Sarcomas | |||
10 | SGR | Osteosarcoma (Tibia) | 17 |
11 | KLC | Chondrosarcoma (Nasal cavity) | 9 |
12 | DML | Liposarcoma (Subcutis) | 60 |
13 | YCC | Melanoma (Oral cavity) | 10 |
14 | ITP | Melanoma (Oral cavity) | 6 |
15 | HTR | Melanoma (Oral cavity) | 12 |
Primer | Sequence | Primer | Sequence |
---|---|---|---|
PEPT1 (NM_001003036) | Fw: TTCTCCAATCATCCAACCTTGA Rv: TGCTCTGCGTTCCGATTACA | HMBS (XM_014113375.1) | Fw: CATGTATGCTGTGGGTCAGG Rv: CAGGTACAGTTGCCCATCCT |
PEPT2 (XM_545128) | Fw: CAAACGGTACACACAGTCCTATCAT Rv: TGATACCTCCTGTTCCCAAAGC | UROS (XM_005637839.2) | Fw: TGGCCAAGATCCATACATCA Rv: ACAGCTCCACTGCTTCCACT |
GAT2 (XM_003639941) | Fw: TCATTCTTGGCGTGTCTGTCA Rv: ACATACCGCCCTCTGTAAGCA | UROD (XM_005629077.2) | Fw: GCAGTGGCCTCTGAACTAGG Rv: ATTCGAAGCAGCTGGTGACT |
TAUT (NM_001003311) | Fw: TGGCGCAGGCATCAAGTT Rv: GATGGCATAGGAGAAGAATATTTGG | CPOX (XM_545070) | Fw: CGCGCGATGGGAGTACAT Rv: TCGGATGGCGCAGAACTT |
PAT1 (XM_536073) | Fw: CAGCGTGTCGCCATTGC Rv: GCGCTGATGTTGCCTCATC | FECH (XM_847843) | Fw: TGGACCGAGACCTCATGACA Rv: GGCGTTTGGCGATGATTG |
ABCG2 (NM_001048021) | Fw: TCTGGATGAGCCCACAACTG Rv: TTCAGGAGCAAAAGGACAGCAT | HO-1 (NM_001194969) | Fw: GGCAGAGGGTCATCGAAGAG Rv: CTCCTCAAACAGCTGAATGTTCA |
ABCB6 (XM_536073) | Fw: CAGCGTGTCGCCATTGC Rv: GCGCTGATGTTGCCTCATC | β-actin (NM_001195845) | Fw: GGCACCCAGCACAATGAAG Rv: GAGCCCCCAATCCACACA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Osaki, T.; Yokoe, I.; Sunden, Y.; Ota, U.; Ichikawa, T.; Imazato, H.; Ishii, T.; Takahashi, K.; Ishizuka, M.; Tanaka, T.; et al. Efficacy of 5-Aminolevulinic Acid in Photodynamic Detection and Photodynamic Therapy in Veterinary Medicine. Cancers 2019, 11, 495. https://doi.org/10.3390/cancers11040495
Osaki T, Yokoe I, Sunden Y, Ota U, Ichikawa T, Imazato H, Ishii T, Takahashi K, Ishizuka M, Tanaka T, et al. Efficacy of 5-Aminolevulinic Acid in Photodynamic Detection and Photodynamic Therapy in Veterinary Medicine. Cancers. 2019; 11(4):495. https://doi.org/10.3390/cancers11040495
Chicago/Turabian StyleOsaki, Tomohiro, Inoru Yokoe, Yuji Sunden, Urara Ota, Tomoki Ichikawa, Hideo Imazato, Takuya Ishii, Kiwamu Takahashi, Masahiro Ishizuka, Tohru Tanaka, and et al. 2019. "Efficacy of 5-Aminolevulinic Acid in Photodynamic Detection and Photodynamic Therapy in Veterinary Medicine" Cancers 11, no. 4: 495. https://doi.org/10.3390/cancers11040495