Cx43 Expression Correlates with Breast Cancer Metastasis in MDA-MB-231 Cells In Vitro, In a Mouse Xenograft Model and in Human Breast Cancer Tissues
Abstract
1. Introduction
2. Results
2.1. Validation of Cx43 Knock-Down or Over-Expression in MDA-MB-231 Cells
2.2. Cx43 Upregulation Decreases Formation of Invasive Cell Aggregates in 3D Cultures
2.3. Cx43 Overexpression Decreases the Expression of EMT Markers
2.4. Cx43 Knock-Down Enhances the Invasion of MDA-MB-231 Cells
2.5. Cx43 Over-Expression Sequesters β-Catenin at the Cell Membrane in MDA-MB-231 Cells
2.6. Cx43 Over-Expression Delays Tumor Onset, Decreases Tumor Volume and Increases Overall Survival
2.7. Down-Regulation of Cx43 Enhances Breast Cancer Metastasis to the Lung and Liver
2.8. Cx43 Expression is Down-Regulated in TNBC Patients
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Migration, Invasion and Proliferation Assays
4.3. Three-Dimensional Cell Culture and Sphere Counting
4.4. Fluorescence Recovery After Photobleaching
4.5. RNA Extraction and Quantitative PCR
4.6. Protein Extraction and Western Blotting
4.7. Cellular Fractionation
4.8. Immunofluorescence
4.9. Xenograft Mouse Model of Breast Cancer Metastasis
4.10. Histological Examination of Lung, Liver and Primary Tumor Tissues
4.11. Survival Analysis and Tumor Volume Measurement
4.12. Human Breast Cancer Samples
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Alby, L.; Auerbach, R. Differential adhesion of tumor cells to capillary endothelial cells in vitro. Proc. Natl. Acad. Sci. USA 1984, 81, 5739–5743. [Google Scholar] [CrossRef] [Scilit]
- Nicolson, G.L. Cancer metastasis: Tumor cell and host organ properties important in metastasis to specific secondary sites. Biochim. Biophys. Acta 1988, 948, 175–224. [Google Scholar] [CrossRef] [Scilit]
- Pauli, B.U.; Lee, C.L. Organ preference of metastasis. The role of organ-specifically modulated endothelial cells. Lab. Investig. J. Tech. Methods Pathol. 1988, 58, 379–387. [Google Scholar]
- Iozzo, R.V. Neoplastic modulation of extracellular matrix. Colon carcinoma cells release polypeptides that alter proteoglycan metabolism in colon fibroblasts. J. Biol. Chem. 1985, 260, 7464–7473. [Google Scholar]
- Liotta, L.A.; Saidel, M.G.; Kleinerman, J. The significance of hematogenous tumor cell clumps in the metastatic process. Cancer Res. 1976, 36, 889–894. [Google Scholar]
- Nakajima, M.; Irimura, T.; Di Ferrante, D.; Di Ferrante, N.; Nicolson, G.L. Heparan sulfate degradation: Relation to tumor invasive and metastatic properties of mouse B16 melanoma sublines. Science (New York, N. Y.) 1983, 220, 611–613. [Google Scholar] [CrossRef] [Scilit]
- Carystinos, G.D.; Bier, A.; Batist, G. The role of connexin-mediated cell-cell communication in breast cancer metastasis. J. Mammary Gland Biol. Neoplas. 2001, 6, 431–440. [Google Scholar] [CrossRef] [Scilit]
- De Maio, A.; Vega, V.L.; Contreras, J.E. Gap junctions, homeostasis, and injury. J. Cell. Physiol. 2002, 191, 269–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Czyz, J. The stage-specific function of gap junctions during tumourigenesis. Cell. Mol. Biol. Lett. 2008, 13, 92–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Saghir, J.A.; El-Habre, E.T.; El-Sabban, M.E.; Talhouk, R.S. Connexins: A junctional crossroad to breast cancer. Int. J. Dev. Biol. 2011, 55, 773–780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McLachlan, E.; Shao, Q.; Wang, H.L.; Langlois, S.; Laird, D.W. Connexins act as tumor suppressors in three-dimensional mammary cell organoids by regulating differentiation and angiogenesis. Cancer Res. 2006, 66, 9886–9894. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.Z.; Jiang, J.X. Gap junction and hemichannel-independent actions of connexins on cell and tissue functions—An update. FEBS Lett. 2014, 588, 1186–1192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Naus, C.C.; Laird, D.W. Implications and challenges of connexin connections to cancer. Nat. Rev. Cancer 2010, 10, 435–441. [Google Scholar] [CrossRef] [Scilit]
- Hanahan, D.; Weinberg, R.A. The hallmarks of cancer. Cell 2000, 100, 57–70. [Google Scholar] [CrossRef] [Scilit]
- Naus, C.C.; Bond, S.L.; Bechberger, J.F.; Rushlow, W. Identification of genes differentially expressed in C6 glioma cells transfected with connexin43. Brain Res. Brain Res. Rev. 2000, 32, 259–266. [Google Scholar] [CrossRef] [Scilit]
- el-Sabban, M.E.; Pauli, B.U. Adhesion-mediated gap junctional communication between lung-metastatatic cancer cells and endothelium. Invasion Metastasis 1994, 14, 164–176. [Google Scholar] [PubMed]
- Jamieson, S.; Going, J.J.; D’Arcy, R.; George, W.D. Expression of gap junction proteins connexin 26 and connexin 43 in normal human breast and in breast tumours. J. Pathol. 1998, 184, 37–43. [Google Scholar] [CrossRef] [Scilit]
- Zibara, K.; Awada, Z.; Dib, L.; El-Saghir, J.; Al-Ghadban, S.; Ibrik, A.; El-Zein, N.; El-Sabban, M. Anti-angiogenesis therapy and gap junction inhibition reduce MDA-MB-231 breast cancer cell invasion and metastasis in vitro and in vivo. Sci. Rep. 2015, 5, 12598. [Google Scholar] [CrossRef] [Scilit]
- Kanczuga-Koda, L.; Sulkowski, S.; Lenczewski, A.; Koda, M.; Wincewicz, A.; Baltaziak, M.; Sulkowska, M. Increased expression of connexins 26 and 43 in lymph node metastases of breast cancer. J. Clin. Pathol. 2006, 59, 429–433. [Google Scholar] [CrossRef] [Scilit]
- Kalra, J.; Shao, Q.; Qin, H.; Thomas, T.; Alaoui-Jamali, M.A.; Laird, D.W. Cx26 inhibits breast MDA-MB-435 cell tumorigenic properties by a gap junctional intercellular communication-independent mechanism. Carcinogenesis 2006, 27, 2528–2537. [Google Scholar] [CrossRef] [Scilit]
- Momiyama, M.; Omori, Y.; Ishizaki, Y.; Nishikawa, Y.; Tokairin, T.; Ogawa, J.; Enomoto, K. Connexin26-mediated gap junctional communication reverses the malignant phenotype of MCF-7 breast cancer cells. Cancer Sci. 2003, 94, 501–507. [Google Scholar] [CrossRef] [Scilit]
- Talhouk, R.S.; Fares, M.B.; Rahme, G.J.; Hariri, H.H.; Rayess, T.; Dbouk, H.A.; Bazzoun, D.; Al-Labban, D.; El-Sabban, M.E. Context dependent reversion of tumor phenotype by connexin-43 expression in MDA-MB231 cells and MCF-7 cells: Role of beta-catenin/connexin43 association. Exp. Cell Res. 2013, 319, 3065–3080. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, H.; Shao, Q.; Curtis, H.; Galipeau, J.; Belliveau, D.J.; Wang, T.; Alaoui-Jamali, M.A.; Laird, D.W. Retroviral delivery of connexin genes to human breast tumor cells inhibits in vivo tumor growth by a mechanism that is independent of significant gap junctional intercellular communication. J. Biol. Chem. 2002, 277, 29132–29138. [Google Scholar] [CrossRef] [Scilit]
- Ferrati, S.; Gadok, A.K.; Brunaugh, A.D.; Zhao, C.; Heersema, L.A.; Smyth, H.D.C.; Stachowiak, J.C. Connexin membrane materials as potent inhibitors of breast cancer cell migration. J. R. Soc. Interface 2017, 14. [Google Scholar] [CrossRef] [Scilit]
- Shao, Q.; Wang, H.; McLachlan, E.; Veitch, G.I.; Laird, D.W. Down-regulation of Cx43 by retroviral delivery of small interfering RNA promotes an aggressive breast cancer cell phenotype. Cancer Res. 2005, 65, 2705–2711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Plante, I.; Stewart, M.K.; Barr, K.; Allan, A.L.; Laird, D.W. Cx43 suppresses mammary tumor metastasis to the lung in a Cx43 mutant mouse model of human disease. Oncogene 2011, 30, 1681–1692. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stewart, M.K.; Bechberger, J.F.; Welch, I.; Naus, C.C.; Laird, D.W. Cx26 knockout predisposes the mammary gland to primary mammary tumors in a DMBA-induced mouse model of breast cancer. Oncotarget 2015, 6, 37185–37199. [Google Scholar] [CrossRef] [Scilit]
- Laird, D.W.; Fistouris, P.; Batist, G.; Alpert, L.; Huynh, H.T.; Carystinos, G.D.; Alaoui-Jamali, M.A. Deficiency of connexin43 gap junctions is an independent marker for breast tumors. Cancer Res. 1999, 59, 4104–4110. [Google Scholar]
- Tang, B.; Peng, Z.H.; Yu, P.W.; Yu, G.; Qian, F.; Zeng, D.Z.; Zhao, Y.L.; Shi, Y.; Hao, Y.X.; Luo, H.X. Aberrant expression of Cx43 is associated with the peritoneal metastasis of gastric cancer and Cx43-mediated gap junction enhances gastric cancer cell diapedesis from peritoneal mesothelium. PLoS ONE 2013, 8, e74527. [Google Scholar] [CrossRef] [Scilit]
- Alaga, K.C.; Crawford, M.; Dagnino, L.; Laird, D.W. Aberrant Cx43 Expression and Mislocalization in Metastatic Human Melanomas. J. Cancer 2017, 8, 1123–1128. [Google Scholar] [CrossRef] [Scilit]
- Ryszawy, D.; Sarna, M.; Rak, M.; Szpak, K.; Kedracka-Krok, S.; Michalik, M.; Siedlar, M.; Zuba-Surma, E.; Burda, K.; Korohoda, W.; et al. Functional links between Snail-1 and Cx43 account for the recruitment of Cx43-positive cells into the invasive front of prostate cancer. Carcinogenesis 2014, 35, 1920–1930. [Google Scholar] [CrossRef] [Scilit]
- Gava, F.; Rigal, L.; Mondesert, O.; Pesce, E.; Ducommun, B.; Lobjois, V. Gap junctions contribute to anchorage-independent clustering of breast cancer cells. BMC Cancer 2018, 18, 221. [Google Scholar] [CrossRef] [Scilit]
- Naoi, Y.; Miyoshi, Y.; Taguchi, T.; Kim, S.J.; Arai, T.; Tamaki, Y.; Noguchi, S. Connexin26 expression is associated with lymphatic vessel invasion and poor prognosis in human breast cancer. Breast Cancer Res. Treat. 2007, 106, 11–17. [Google Scholar] [CrossRef] [Scilit]
- Zhang, A.; Hitomi, M.; Bar-Shain, N.; Dalimov, Z.; Ellis, L.; Velpula, K.K.; Fraizer, G.C.; Gourdie, R.G.; Lathia, J.D. Connexin 43 expression is associated with increased malignancy in prostate cancer cell lines and functions to promote migration. Oncotarget 2015, 6, 11640–11651. [Google Scholar] [CrossRef] [Scilit]
- Ito, A.; Katoh, F.; Kataoka, T.R.; Okada, M.; Tsubota, N.; Asada, H.; Yoshikawa, K.; Maeda, S.; Kitamura, Y.; Yamasaki, H.; et al. A role for heterologous gap junctions between melanoma and endothelial cells in metastasis. J. Clin. Investing. 2000, 105, 1189–1197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ito, A.; Koma, Y.; Uchino, K.; Okada, T.; Ohbayashi, C.; Tsubota, N.; Okada, M. Increased expression of connexin 26 in the invasive component of lung squamous cell carcinoma: Significant correlation with poor prognosis. Cancer Lett. 2006, 234, 239–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Foulkes, W.D.; Smith, I.E.; Reis, F.J. Triple-negative breast cancer. N. Engl. J. Med. 2010, 363, 1938–1948. [Google Scholar] [CrossRef] [Scilit]
- Teleki, I.; Szasz, A.M.; Maros, M.E.; Gyorffy, B.; Kulka, J.; Meggyeshazi, N.; Kiszner, G.; Balla, P.; Samu, A.; Krenacs, T. Correlations of differentially expressed gap junction connexins Cx26, Cx30, Cx32, Cx43 and Cx46 with breast cancer progression and prognosis. PLoS ONE 2014, 9, e112541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chavez, K.J.; Garimella, S.V.; Lipkowitz, S. Triple negative breast cancer cell lines: One tool in the search for better treatment of triple negative breast cancer. Breast Dis. 2010, 32, 35–48. [Google Scholar] [CrossRef] [Scilit]
- Thiery, J.P.; Acloque, H.; Huang, R.Y.; Nieto, M.A. Epithelial-mesenchymal transitions in development and disease. Cell 2009, 139, 871–890. [Google Scholar] [CrossRef] [Scilit]
- Kotini, M.; Barriga, E.H.; Leslie, J.; Gentzel, M.; Rauschenberger, V.; Schambony, A.; Mayor, R. Gap junction protein Connexin-43 is a direct transcriptional regulator of N-cadherin in vivo. Nat. Commun. 2018, 9, 3846. [Google Scholar] [CrossRef] [Scilit]
- Ai, Z.; Fischer, A.; Spray, D.C.; Brown, A.M.; Fishman, G.I. Wnt-1 regulation of connexin43 in cardiac myocytes. J. Clin. Investing. 2000, 105, 161–171. [Google Scholar] [CrossRef] [Scilit]
- Spagnol, G.; Trease, A.J.; Zheng, L.; Gutierrez, M.; Basu, I.; Sarmiento, C.; Moore, G.; Cervantes, M.; Sorgen, P.L. Connexin43 Carboxyl-Terminal Domain Directly Interacts with beta-Catenin. Int. J. Mol. Sci. 2018, 19, 1562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, Y.G.; Luo, Y.; He, D.L.; Li, X.; Zhang, L.L.; Peng, T.; Li, M.C.; Lin, Y.H. Role of Wnt/beta-catenin signaling pathway in epithelial-mesenchymal transition of human prostate cancer induced by hypoxia-inducible factor-1alpha. Int. J. Urol. Off. J. Jpn. Urol. Assoc. 2007, 14, 1034–1039. [Google Scholar] [CrossRef] [Scilit]
- Sanchez-Tillo, E.; de Barrios, O.; Siles, L.; Cuatrecasas, M.; Castells, A.; Postigo, A. beta-catenin/TCF4 complex induces the epithelial-to-mesenchymal transition (EMT)-activator ZEB1 to regulate tumor invasiveness. Proc. Natl. Acad. Sci. USA 2011, 108, 19204–19209. [Google Scholar] [CrossRef] [Scilit]
- Yook, J.I.; Li, X.Y.; Ota, I.; Hu, C.; Kim, H.S.; Kim, N.H.; Cha, S.Y.; Ryu, J.K.; Choi, Y.J.; Kim, J.; et al. A Wnt-Axin2-GSK3beta cascade regulates Snail1 activity in breast cancer cells. Nat. Cell Biol. 2006, 8, 1398–1406. [Google Scholar] [CrossRef] [Scilit]
- Brabletz, T.; Jung, A.; Hermann, K.; Gunther, K.; Hohenberger, W.; Kirchner, T. Nuclear overexpression of the oncoprotein beta-catenin in colorectal cancer is localized predominantly at the invasion front. Pathol. Res. Pract. 1998, 194, 701–704. [Google Scholar] [CrossRef] [Scilit]
- Bos, P.D.; Zhang, X.H.; Nadal, C.; Shu, W.; Gomis, R.R.; Nguyen, D.X.; Minn, A.J.; van de Vijver, M.J.; Gerald, W.L.; Foekens, J.A.; et al. Genes that mediate breast cancer metastasis to the brain. Nature 2009, 459, 1005–1009. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Boire, A.; Jin, X.; Valiente, M.; Er, E.E.; Lopez-Soto, A.; Jacob, L.; Patwa, R.; Shah, H.; Xu, K.; et al. Carcinoma-astrocyte gap junctions promote brain metastasis by cGAMP transfer. Nature 2016, 533, 493–498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gavrilovic, I.T.; Posner, J.B. Brain metastases: Epidemiology and pathophysiology. J. Neuro-Oncol. 2005, 75, 5–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Conklin, C.; Huntsman, D.; Yorida, E.; Makretsov, N.; Turbin, D.; Bechberger, J.F.; Sin, W.C.; Naus, C.C. Tissue microarray analysis of connexin expression and its prognostic significance in human breast cancer. Cancer Lett. 2007, 255, 284–294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Busby, M.; Hallett, M.T.; Plante, I. The Complex Subtype-Dependent Role of Connexin 43 (GJA1) in Breast Cancer. Int. J. Mol. Sci. 2018, 19, 693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arora, S.; Heyza, J.R.; Chalfin, E.C.; Ruch, R.J.; Patrick, S.M. Gap Junction Intercellular Communication Positively Regulates Cisplatin Toxicity by Inducing DNA Damage through Bystander Signaling. Cancers 2018, 10, 368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chasampalioti, M.; Green, A.R.; Ellis, I.O.; Rakha, E.A.; Jackson, A.M.; Spendlove, I.; Ramage, J.M. Connexin 43 is an independent predictor of patient outcome in breast cancer patients. Breast Cancer Res. Treat. 2018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Ghadban, S.; Kaissi, S.; Homaidan, F.R.; Naim, H.Y.; El-Sabban, M.E. Cross-talk between intestinal epithelial cells and immune cells in inflammatory bowel disease. Sci. Rep. 2016, 6, 29783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shaito, A.; Saliba, J.; Husari, A.; El-Harakeh, M.; Chhouri, H.; Hashem, Y.; Shihadeh, A.; El-Sabban, M. Electronic Cigarette Smoke Impairs Normal Mesenchymal Stem Cell Differentiation. Sci. Rep. 2017, 7, 14281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tomayko, M.M.; Reynolds, C.P. Determination of subcutaneous tumor size in athymic (nude) mice. Cancer Chemother. Pharmacol. 1989, 24, 148–154. [Google Scholar] [CrossRef] [Scilit]








| Gene | Primer Sequence | Annealing temperature (°C) |
|---|---|---|
| hCx43 | F: CTTCACTACTTTTAAGCAAAAGAG R: TCCCTCCAGCAGTTGAG | 52 |
| hE-Cadherin | F: CAGAAAGTTTTCCACCAAAG R: AAATGTGAGCAATTCTGCTT | 58 |
| hZO-1 | F: CAGCCGGTCACGATCTCCT R: GTGATGGACGACACCAGCG | 58 |
| hGAPDH | F: TGGTGCTCAGTGTAGCCCAG R: GGACCTGACCTGCCGTCTAG | 58 |
| h18S | F: CAGCCACCCGAGATTGAGCA R: TAGTAGCGACGGGCGGTGTG | 58 |
| mGAPDH | F: CATGGCCTTCCGTGTTCCTA R: CCTGCTTCACCACCTTCTTGAT | 58 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kazan, J.M.; El-Saghir, J.; Saliba, J.; Shaito, A.; Jalaleddine, N.; El-Hajjar, L.; Al-Ghadban, S.; Yehia, L.; Zibara, K.; El-Sabban, M. Cx43 Expression Correlates with Breast Cancer Metastasis in MDA-MB-231 Cells In Vitro, In a Mouse Xenograft Model and in Human Breast Cancer Tissues. Cancers 2019, 11, 460. https://doi.org/10.3390/cancers11040460
Kazan JM, El-Saghir J, Saliba J, Shaito A, Jalaleddine N, El-Hajjar L, Al-Ghadban S, Yehia L, Zibara K, El-Sabban M. Cx43 Expression Correlates with Breast Cancer Metastasis in MDA-MB-231 Cells In Vitro, In a Mouse Xenograft Model and in Human Breast Cancer Tissues. Cancers. 2019; 11(4):460. https://doi.org/10.3390/cancers11040460
Chicago/Turabian StyleKazan, Jalal M., Jamal El-Saghir, Jessica Saliba, Abdullah Shaito, Nour Jalaleddine, Layal El-Hajjar, Sara Al-Ghadban, Lamis Yehia, Kazem Zibara, and Marwan El-Sabban. 2019. "Cx43 Expression Correlates with Breast Cancer Metastasis in MDA-MB-231 Cells In Vitro, In a Mouse Xenograft Model and in Human Breast Cancer Tissues" Cancers 11, no. 4: 460. https://doi.org/10.3390/cancers11040460
APA StyleKazan, J. M., El-Saghir, J., Saliba, J., Shaito, A., Jalaleddine, N., El-Hajjar, L., Al-Ghadban, S., Yehia, L., Zibara, K., & El-Sabban, M. (2019). Cx43 Expression Correlates with Breast Cancer Metastasis in MDA-MB-231 Cells In Vitro, In a Mouse Xenograft Model and in Human Breast Cancer Tissues. Cancers, 11(4), 460. https://doi.org/10.3390/cancers11040460

