ROCK2 Confers Acquired Gemcitabine Resistance in Pancreatic Cancer Cells by Upregulating Transcription Factor ZEB1
Abstract
1. Introduction
2. Methods
2.1. Cells Culture
2.2. Reagents
2.3. Western Blotting Analysis
2.4. RNA Extraction and qRT-PCR
2.5. Colony-Formation Assay
2.6. Brdu Incorporation Assay
2.7. Transfection ShRNA and Plasmid Constructs
2.8. Chromatin Immunoprecipitation
2.9. Cytotoxicity Assay
2.10. Luciferase Assay
2.11. Comet Assay
2.12. Xenograft Model
2.13. Immunohistochemistry
2.14. Statistical Analysis
3. Results
3.1. ROCK2 is Overexpressed in GR Cells, and Fasudil Plus Gemcitabine Synergistically Enhance the Sensitivity of GR Cells to Gemcitabine
3.2. Pharmacological Inhibition of ROCK2 Renders DNA Damage Induced by Gemcitabine
3.3. Inhibition of ROCK2 Partially Reverses EMT in GR Cells
3.4. ZEB1 is the Dominant Factor for ROCK2-Mediated Gemcitabine Resistance in GR Cells
3.5. ROCK2 Upregulates ZEB1 via the p38/sp1 Signaling Pathway but not Snail
3.6. ROCK2 Promotes p38 Nuclear Translocation and Activation of p38/sp1 Signaling Pathway
3.7. ROCK2 Enhances the Ability of sp1 Binding to the Promoter of ZEB1
3.8. ROCK2 Promotes Gemcitabine Resistance in Nude Mice Dependent on ZEB1
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2016. CA Cancer J. Clin. 2016, 66, 7–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryan, D.P.; Hong, T.S.; Bardeesy, N. Pancreatic adenocarcinoma. N. Engl. J. Med. 2014, 371, 1039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vincent, A.; Herman, J.; Schulick, R.; Hruban, R.H.; Goggins, M. Pancreatic cancer. Lancet 2011, 378, 607–620. [Google Scholar] [CrossRef] [Scilit]
- Long, J.; Zhang, Y.; Yu, X.; Yang, J.; LeBrun, D.G.; Chen, C.; Yao, Q.; Li, M. Overcoming drug resistance in pancreatic cancer. Expert Opin. Ther. Targets 2011, 15, 817–828. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oberstein, P.E.; Olive, K.P. Pancreatic cancer: Why is it so hard to treat? Ther. Adv. Gastroenterol. 2013, 6, 321–337. [Google Scholar] [CrossRef] [Scilit]
- Schneider, B.J.; Kalemkerian, G.P.; Gadgeel, S.M.; Valdivieso, M.; Hackstock, D.M.; Chen, W.; Heilbrun, L.K.; Ruckdeschel, J.C.; Wozniak, A.J. Phase II Trial of Dose-dense Pemetrexed, Gemcitabine, and Bevacizumab in Patients with Advanced, Non-Small-cell Lung Cancer. Clin. Lung Cancer 2017, 18, 299–302. [Google Scholar] [CrossRef] [Scilit]
- Conroy, T.; Hammel, P.; Hebbar, M.; Abdelghani, M.B.; Wei, A.C.; Raoul, J.; Choné, L.; Francois, E.; Artru, P.; Biagi, J.J.; et al. FOLFIRINOX or Gemcitabine as Adjuvant Therapy for Pancreatic Cancer. N. Engl. J. Med. 2018, 379, 2395–2406. [Google Scholar] [CrossRef] [Scilit]
- Hung, S.W.; Mody, H.R.; Govindarajan, R. Overcoming nucleoside analog chemoresistance of pancreatic cancer: A therapeutic challenge. Cancer Lett. 2012, 320, 138–149. [Google Scholar] [CrossRef] [Scilit]
- Nakano, Y.; Tanno, S.K.; Nishikawa, T.; Nakamura, K.; Minoguchi, M.; Izawa, T.; Mizukami, Y.; Okumura, T.; Kohgo, Y. Gemcitabine chemoresistance and molecular markers associated with gemcitabine transport and metabolism in human pancreatic cancer cells. Br. J. Cancer 2007, 96, 457–463. [Google Scholar] [CrossRef] [Scilit]
- Wei, L.; Surma, M.; Shi, S.; Lambert-Cheatham, N.; Shi, J. Novel Insights into the Roles of Rho Kinase in Cancer. Arch. Immunol. Ther. Exp. 2016, 64, 259–278. [Google Scholar] [CrossRef] [Scilit]
- Takeda, H.; Okada, M.; Suzuki, S.; Kuramoto, K.; Sakaki, H.; Watarai, H.; Sanomachi, T.; Seino, S.; Yoshioka, T.; Kitanaka, C. Rho-Associated Protein Kinase (ROCK) Inhibitors Inhibit Survivin Expression and Sensitize Pancreatic Cancer Stem Cells to Gemcitabine. Anticancer Res. 2016, 36, 6311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vennin, C.; Chin, V.T.; Warren, S.C.; Lucas, M.C.; Herrmann, D.; Magenau, A.; Melenec, P.; Walters, S.N.; Del, M.-N.G.; Conway, J.R. Transient tissue priming via ROCK inhibition uncouples pancreatic cancer progression, sensitivity to chemotherapy, and metastasis. Sci. Transl. Med. 2017, 9, eaai8504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Liu, X.; Zhou, W.; Yang, M.; Ding, Y.; Wang, Q.; Hu, R. Fasudil increases temozolomide sensitivity and suppresses temozolomide-resistant glioma growth via inhibiting ROCK2/ABCG2. Cell Death Dis. 2018, 9, 190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dongre, A.; Weinberg, R.A. New insights into the mechanisms of epithelial-mesenchymal transition and implications for cancer. Nat. Rev. Mol. Cell Biol. 2019, 20, 69–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, P.; Li, B.; Liu, F.; Zhang, M.; Wang, Q.; Liu, Y.; Yao, Y.; Li, D. The epithelial to mesenchymal transition (EMT) and cancer stem cells: Implication for treatment resistance in pancreatic cancer. Mol. Cancer 2017, 16, 52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cenap, G.R.; Hilke, Z.; Effenberger, K.E.; Vashist, Y.K.; Tatyana, K.; Izbicki, J.R.; Emre, Y.; Maximilian, B. Notch signaling activated by replication stress-induced expression of midkine drives epithelial-mesenchymal transition and chemoresistance in pancreatic cancer. Cancer Res. 2011, 71, 5009–5019. [Google Scholar]
- Zhang, X.; Carstens, J.L.; Jiha, K.; Matthew, S.; Judith, K.; Hikaru, S.; Chia-Chin, W.; Lebleu, V.S.; Raghu, K. Epithelial-to-mesenchymal transition is dispensable for metastasis but induces chemoresistance in pancreatic cancer. Nature 2015, 527, 525–530. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Li, Y.; Kong, D.; Banerjee, S.; Ahmad, A.; Azmi, A.S.; Ali, S.; Abbruzzese, J.L.; Gallick, G.E.; Sarkar, F.H. Acquisition of epithelial-mesenchymal transition phenotype of gemcitabine-resistant pancreatic cancer cells is linked with activation of the notch signaling pathway. Cancer Res. 2009, 69, 2400–2407. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Jiang, X.; Yu, Y.; Huang, W.; Xing, H.; Agar, N.Y.; Yang, H.W.; Yang, B.; Carroll, R.S.; Johnson, M.D. KAP regulates ROCK2 and Cdk2 in an RNA-activated glioblastoma invasion pathway. Oncogene 2015, 34, 1432–1441. [Google Scholar] [CrossRef] [Scilit]
- Zucchini, C.; Manara, M.C.; Pinca, R.S.; De Sanctis, P.; Guerzoni, C.; Sciandra, M.; Lollini, P.-L.; Cenacchi, G.; Picci, P.; Valvassori, L. CD99 suppresses osteosarcoma cell migration through inhibition of ROCK2 activity. Oncogene 2014, 33, 1912. [Google Scholar] [CrossRef] [Scilit]
- Qiu, Y.; Yuan, R.; Zhang, S.; Chen, L.; Huang, D.; Hao, H.; Shao, J. Rock2 stabilizes β-catenin to promote tumor invasion and metastasis in colorectal cancer. Biochem. Biophys. Res. Commun. 2015, 467, 629–637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Y.; Zhou, Y.; Yang, M.; Wang, K.; Liu, Y.; Zhang, M.; Yang, Y.; Jin, C.; Wang, R.; Hu, R. Digoxin sensitizes gemcitabine-resistant pancreatic cancer cells to gemcitabine via inhibiting Nrf2 signaling pathway. Redox Biol. 2019, 22, 101131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ting-Chao, C. The mass-action law based algorithm for cost-effective approach for cancer drug discovery and development. Am. J. Cancer Res. 2011, 1, 925–954. [Google Scholar]
- Zhang, X.; Wu, N. Fasudil inhibits proliferation and migration of Hep-2 laryngeal carcinoma cells. Drug Des. Dev. Ther. 2018, 12, 373–381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martin, W.; Aylin, C.; Maciej, P.R.; Sebastian, T.; Malte, V.B.; Andreas, D.; Uwe, P.; Mirko, T.; Gerhard, E.; Sebastian, B. RNAi profiling of primary human AML cells identifies ROCK1 as a therapeutic target and nominates fasudil as an antileukemic drug. Blood 2015, 125, 3760. [Google Scholar]
- Jiang, Y.; Dai, H.; Li, Y.; Yin, J.; Guo, S.; Lin, S.-L.; McGrail, D.J. PARP inhibitors synergize with gemcitabine by potentiating DNA damage in non-small-cell lung cancer. Int. J. Cancer 2019, 144, 1092–1103. [Google Scholar] [CrossRef] [Scilit]
- Lobb, R.J.; Van, A.R.; Wiegmans, A.; Ham, S.; Larsen, J.E.; Möller, A. Exosomes derived from mesenchymal non-small cell lung cancer cells promote chemoresistance. Int. J. Cancer 2017, 141, 614–620. [Google Scholar] [CrossRef] [Scilit]
- Samy, L.; Jian, X.; Rik, D. Molecular mechanisms of epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol. 2014, 15, 178–196. [Google Scholar]
- Patel, R.A.; Forinash, K.D.; Roberta, P.; Ying, S.; Nan, S.; Martin, M.P.; Ernst, S.N.; Lawrence, N.J.; Sebti, S.D.M. RKI-1447 is a potent inhibitor of the Rho-associated ROCK kinases with anti-invasive and antitumor activities in breast cancer. Cancer Res. 2012, 72, 5025–5034. [Google Scholar] [CrossRef] [Scilit]
- Peng, M.; Hu, Y.; Song, W.; Duan, S.; Xu, Q.; Ding, Y.; Geng, J.; Zhou, J. MIER3 suppresses colorectal cancer progression by down-regulating Sp1, inhibiting epithelial-mesenchymal transition. Sci. Rep. 2017, 7, 11000. [Google Scholar] [CrossRef] [Scilit]
- Jungert, K.; Buck, A.; von Wichert, G.; Adler, G.; König, A.; Buchholz, M.; Gress, T.M.; Ellenrieder, V. Sp1 is required for transforming growth factor-beta-induced mesenchymal transition and migration in pancreatic cancer cells. Cancer Res. 2007, 67, 1563–1570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chu, S. Transcriptional regulation by post-transcriptional modification—Role of phosphorylation in Sp1 transcriptional activity. Gene 2012, 508, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Liao, W.C.; Tu, Y.K.; Wu, M.S.; Lin, J.T.; Wang, H.P.; Chien, K.L. Blood glucose concentration and risk of pancreatic cancer: Systematic review and dose-response meta-analysis. BMJ 2015, 350, g7371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belli, C.; Cereda, S.; Reni, M. Role of taxanes in pancreatic cancer. World J. Gastroenterol. 2012, 18, 4457–4465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Algül, H.; Treiber, M.; Lesina, M.; Schmid, R.M. Mechanisms of disease: Chronic inflammation and cancer in the pancreas—A potential role for pancreatic stellate cells? Nat. Clin. Pract. Gastroenterol. Hepatol. 2007, 4, 454. [Google Scholar] [CrossRef] [Scilit]
- Shibue, T.; Weinberg, R.A. EMT, CSCs, and drug resistance: The mechanistic link and clinical implications. Nat. Rev. Clin. Oncol. 2017, 14, 611–629. [Google Scholar] [CrossRef] [Scilit]
- Du, B.; Shim, J.S. Targeting Epithelial-Mesenchymal Transition (EMT) to Overcome Drug Resistance in Cancer. Molecules 2016, 21, 965. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Mt Wang, Q.; Wong, Y.; Leung, S.; Wang, X. Anti-apoptotic role of TWIST and its association with Akt pathway in mediating taxol resistance in nasopharyngeal carcinoma cells. Int. J. Cancer 2010, 120, 1891–1898. [Google Scholar] [CrossRef] [Scilit]
- Ruan, D.; He, J.; Li, C.F.; Lee, H.J.; Liu, J.; Lin, H.K.; Chan, C.H. Skp2 deficiency restricts the progression and stem cell features of castration-resistant prostate cancer by destabilizing Twist. Oncogene 2017, 36, 4299. [Google Scholar] [CrossRef] [Scilit]
- Dave, N.; Guaita-Esteruelas, S.; Gutarra, S.; Frias, À.; Beltran, M.; Peiró, S.; de Herreros, A.G. Functional cooperation between Snail1 and twist in the regulation of ZEB1 expression during epithelial to mesenchymal transition. J. Biol. Chem. 2011, 286, 12024–12032. [Google Scholar] [CrossRef] [Scilit]
- Zhang, P.; Goodrich, C.; Fu, C.; Dong, C. Melanoma upregulates ICAM-1 expression on endothelial cells through engagement of tumor CD44 with endothelial E-selectin and activation of a PKCα-p38-SP-1 pathway. FASEB J. 2014, 28, 4591–4609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iqbal, J.; McRae, S.; Banaudha, K.; Mai, T.; Waris, G. Mechanism of hepatitis C virus (HCV)-induced osteopontin and its role in epithelial to mesenchymal transition of hepatocytes. J. Biol. Chem. 2013, 288, 36994–37009. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, P.; Wei, Y.; Wang, L.; Debeb, B.G.; Yuan, Y.; Zhang, J.; Yuan, J.; Wang, M.; Chen, D.; Sun, Y.; et al. ATM-mediated stabilization of ZEB1 promotes DNA damage response and radioresistance through CHK1. Nat. Cell Biol. 2014, 16, 864–875. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Zhang, Z.; Zhang, Q.; Zhang, Q.; Sun, P.; Xiang, R.; Ren, G.; Yang, S. ZEB1 confers chemotherapeutic resistance to breast cancer by activating ATM. Cell Death Dis. 2018, 9, 57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, R.M.; Zhan, M.; Xu, S.W.; Long, M.M.; Yang, L.H.; Chen, W.; Huang, S.; Liu, Q.; Zhou, J.; Zhu, J. miR-3656 expression enhances the chemosensitivity of pancreatic cancer to gemcitabine through modulation of the RHOF/EMT axis. Cell Death Dis. 2017, 8, e3129. [Google Scholar] [CrossRef] [Scilit]
- Meidhof, S.; Brabletz, S.; Lehmann, W.; Preca, B.T.; Mock, K.; Ruh, M.; Schüler, J.; Berthold, M.; Weber, A.; Burk, U. ZEB1-associated drug resistance in cancer cells is reversed by the class I HDAC inhibitor mocetinostat. EMBO Mol. Med. 2015, 7, 831–847. [Google Scholar] [CrossRef] [Scilit]








| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| ROCK1 | GGGCGAAATGGTGTAGAAGA | AATCGGGTACAACTGGTGCT |
| ROCK2 | TGGATGAAACAGGCATGGTA | CATTCTCGCCCATAGAAACC |
| GAPDH | TGGTATCGTGGAAGGACTCA | CAGTAGAGGCAGGGATGATG |
| E-cadherin | ACCATTAACAGGAACACAGG | CAGTCACTTTCAGTGTGGTG |
| Vimentin | CGCCAACTACATCGACAAGGTGC | CTGGTCCACCTGCCGGCGCAG |
| ZEB1 | GGCATACACCTACTCAACTACGG | TGGGCGGTGTAGAATCAGAGTC |
| ZEB2 | AATGCACAGAGTGTGGCAAGGC | CTGCTGATGTGCGAACTGTAGG |
| Slug | TTCGGACCCACACATTACCT | GCAGTGAGGGCAAGAAAAAG |
| snail | TGCGCGAATCGGCGACCC | CCTAGAGAACCGCTTCCCGCAG |
| Twist | GGAGTCCGCAGTCTTACGAG | TCTGGAGGACCTGGTAGAGG |
| Fibronectin | CAGGATCACTTACGGAGAAACAG | GCCAGTGACAGCATACACAGTG |
| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| F1 | CATGGCCTGTGGATACCTTAG | CTGGATTGAAAGAGAGGCTAGAA |
| F2 | CTTATTCGAAGGAGGTGGGAAG | GCAGGACCTTAAGGCAAGAA |
| F3 | AATCCTGCCATAGAAGTGACAAA | GGGACCAACTTTATGGAATAAATAAGC |
| F4 | TGAGGATGAATGCAGATATATAGAC | ATGTCTTCAAACCTTTCAACTG |
| F5 | CTGGTCAGAAATCAGGGTAGCTG | GGCAGTCCTCGCTTTCCTTG |
| F6 | ACTTGTCCACAGTTTGGCCC | TCCAGCTCTATCACACATTTTACCT |
| F7 | GGTGAACAGAGTTCATTGTTTAGG | TGGAGTACGTAGCCAATAGTAGA |
| F8 | GAGATAAGAAGCAACCGTCACA | ACTGGTAGCCCAAATCTTCTAAC |
| Group | Concentration (μM) | SW1990/GEM IC50 of Gemcitabine (μM) | RF a | Panc-1/GEM IC50 of Gemcitabine (μM) | RF a |
|---|---|---|---|---|---|
| Fasudil | 0 | 621.35 ± 20.75 | 1 | 293.50 ± 37.25 | 1 |
| 0.5 | 517.84 ± 34.75 | 1.20 | 199.09 ± 36.99 | 1.47 | |
| 2.0 | 147.59 ± 27.74 | 4.21 | 97.44 ± 19.59 | 3.01 | |
| 8.0 | 28.69 ± 4.96 | 21.66 | 24.23 ± 2.75 | 12.11 |
| Fasudil (μM) | Gemcitabine(μM) | SW1990/GEM | Panc-1/GEM | ||
|---|---|---|---|---|---|
| Effect | CI a | Effect | CI a | ||
| 0.5 | 15 | 0.1252 | 0.25983 | 0.1279 | 0.53052 |
| 30 | 0.1763 | 0.31237 | 0.2039 | 0.53637 | |
| 60 | 0.2588 | 0.34413 | 0.3065 | 0.55136 | |
| 120 | 0.3172 | 0.48717 | 0.4082 | 0.64082 | |
| 240 | 0.3915 | 0.6595 | 0.5242 | 0.7241 | |
| 2 | 15 | 0.1355 | 0.26857 | 0.1451 | 0.44657 |
| 30 | 0.2249 | 0.23109 | 0.2315 | 0.44054 | |
| 60 | 0.3481 | 0.21289 | 0.411 | 0.31596 | |
| 120 | 0.4275 | 0.2801 | 0.5872 | 0.26514 | |
| 240 | 0.5832 | 0.26274 | 0.6665 | 0.35032 | |
| 8 | 15 | 0.3229 | 0.09433 | 0.3876 | 0.08922 |
| 30 | 0.5721 | 0.04195 | 0.5809 | 0.06844 | |
| 60 | 0.6364 | 0.05499 | 0.6856 | 0.07875 | |
| 120 | 0.7912 | 0.04142 | 0.7626 | 0.09821 | |
| 240 | 0.9802 | 0.00377 | 0.9128 | 0.04652 | |
| Group | SW1990/GEM | Panc-1/GEM | |||
|---|---|---|---|---|---|
| IC50 | RF a | IC50 | RF a | ||
| 5-FU | Control | 191.02 ± 16.93 | 1 | 181.76 ± 25.45 | 1 |
| Fasudil 8 μM | 64.56 ± 6.00 | 2.96 | 74.76 ± 9.48 | 2.43 | |
| Paclitaxel | Control | 348.44 ± 39.75 | 1 | 196.27 ± 10.29 | 1 |
| Fasudil 8 μM | 119.30 ± 12.14 | 2.92 | 125.04 ± 20.43 | 1.57 | |
| Cisplatin | Control | 195.36 ± 11.64 | 1 | 171.54 ± 16.80 | 1 |
| Fasudil 8 μM | 87.52 ± 2.36 | 2.23 | 69.15 ± 5.64 | 2.48 | |
| Gemcitabine | Control | 621.35 ± 20.75 | 1 | 294.50 ± 37.25 | 1 |
| Fasudil 8 μM | 2869 ± 4.96 | 21.66 | 24.23 ± 2.75 | 12.15 | |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Y.; Zhou, Y.; Wang, K.; Li, T.; Zhang, M.; Yang, Y.; Wang, R.; Hu, R. ROCK2 Confers Acquired Gemcitabine Resistance in Pancreatic Cancer Cells by Upregulating Transcription Factor ZEB1. Cancers 2019, 11, 1881. https://doi.org/10.3390/cancers11121881
Zhou Y, Zhou Y, Wang K, Li T, Zhang M, Yang Y, Wang R, Hu R. ROCK2 Confers Acquired Gemcitabine Resistance in Pancreatic Cancer Cells by Upregulating Transcription Factor ZEB1. Cancers. 2019; 11(12):1881. https://doi.org/10.3390/cancers11121881
Chicago/Turabian StyleZhou, Yang, Yunjiang Zhou, Keke Wang, Tao Li, Minda Zhang, Yunjia Yang, Rui Wang, and Rong Hu. 2019. "ROCK2 Confers Acquired Gemcitabine Resistance in Pancreatic Cancer Cells by Upregulating Transcription Factor ZEB1" Cancers 11, no. 12: 1881. https://doi.org/10.3390/cancers11121881
APA StyleZhou, Y., Zhou, Y., Wang, K., Li, T., Zhang, M., Yang, Y., Wang, R., & Hu, R. (2019). ROCK2 Confers Acquired Gemcitabine Resistance in Pancreatic Cancer Cells by Upregulating Transcription Factor ZEB1. Cancers, 11(12), 1881. https://doi.org/10.3390/cancers11121881
