Photothermal-Based Multiplex Nested Digital PCR System for Rapid Detection of Foodborne Pathogens
Abstract
1. Introduction
2. Materials and Methods
2.1. System Description and Working Principles
2.2. PCR Experiments Design
2.3. Primer Design and Data Processing Method
3. Results and Discussions
3.1. Temperature Profiles
3.2. Verifications of the Primer Design and Thermal Cyclings
3.3. Verifications of Quantitative Capability
3.4. Foodborne Pathogen Detection Tests of Real Foods
3.5. Future Work and Limitations
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Pinto, L.; Tapia-Rodríguez, M.R.; Baruzzi, F.; Ayala-Zavala, J.F. Plant Antimicrobials for Food Quality and Safety: Recent Views and Future Challenges. Foods 2023, 12, 2315. [Google Scholar] [CrossRef]
- Zhao, X.; Lin, C.-W.; Wang, J.; Oh, D.H. Advances in Rapid Detection Methods for Foodborne Pathogens. J. Microbiol. Biotechnol. 2014, 24, 297–312. [Google Scholar] [CrossRef] [PubMed]
- Ince, G.T.; Yüksekkaya, M.; Haberal, O.E. Micro-polymerase chain reaction for point-of-care detection and beyond: A review microfluidics and nanofluidics. Microfluid. Nanofluidics 2023, 27, 1–25. [Google Scholar] [CrossRef]
- Pecson, B.M.; Darby, E.; Haas, C.N.; Amha, Y.M.; Bartolo, M.; Danielson, R.; Dearborn, Y.; Di Giovanni, G.; Ferguson, C.; Fevig, S.; et al. Reproducibility and sensitivity of 36 methods to quantify the SARS-CoV-2 genetic signal in raw wastewater: Findings from an interlaboratory methods evaluation in the US. Environ. Sci.-Water Res. Technol. 2021, 7, 504–520. [Google Scholar] [CrossRef] [PubMed]
- Gatto, F.; Savini, C.; Sacco, M.G.; Vinciguerra, D.; Buttinger, G.; Corbisier, P.; Mazzara, M.; Emons, H. Single and multi-laboratory validation of a droplet digital PCR method. Food Control 2022, 140, 109117. [Google Scholar] [CrossRef] [PubMed]
- Yao, J.; Luo, Y.; Zhang, Z.; Li, J.; Li, C.; Li, C.; Guo, Z.; Wang, L.; Zhang, W.; Zhao, H.; et al. The development of real-time digital PCR technology using an improved data classification method. Biosens. Bioelectron. 2022, 199, 113873. [Google Scholar] [CrossRef] [PubMed]
- Shum, E.Y.; Lai, J.H.; Li, S.; Lee, H.G.; Soliman, J.; Raol, V.K.; Lee, C.K.; Fodor, S.P.; Fan, H.C. Next-Generation Digital Polymerase Chain Reaction: High-Dynamic- Range Single-Molecule DNA Counting via Ultrapartitioning. Anal. Chem. 2022, 94, 17868–17876. [Google Scholar] [CrossRef]
- Wei, C.; Yu, C.; Li, S.; Meng, J.; Li, T.; Cheng, J.; Pan, F.; Li, J. Easy-to-Operate Co-flow Step Emulsification Device for Droplet Digital Polymerase Chain Reaction. Anal. Chem. 2022, 94, 3939–3947. [Google Scholar] [CrossRef]
- Wei, C.; Yu, C.; Li, S.; Meng, J.; Li, T.; Cheng, J.; Li, J. A droplet-based multivolume microfluidic device for digital polymerase chain reaction. Sens. Actuators B-Chem. 2022, 371, 132473. [Google Scholar] [CrossRef]
- Majumdar, N.; Banerjee, S.; Pallas, M.; Wessel, T.; Hegerich, P. Poisson Plus Quantification for Digital PCR Systems. Sci. Rep. 2017, 7, 1–10. [Google Scholar] [CrossRef]
- Hu, H.; Cheng, J.; Wei, C.; Li, S.; Yu, C.; Meng, X.; Li, J. Pre-Degassed Microfluidic Chamber-Based Digital PCR Device for Meat Authentication Applications. Micromachines 2021, 12, 694. [Google Scholar] [CrossRef]
- Yu, C.; Dai, S.; Zhang, Z.; Li, S.; Cheng, J.; Hu, H.; Wu, J.; Li, J. An integrated digital polymerase chain reaction chip for multiplexed meat adulteration detection. Electrophoresis 2023, 44, 1342–1352. [Google Scholar] [CrossRef]
- Son, J.H.; Cho, B.; Hong, S.; Lee, S.H.; Hoxha, O.; Haack, A.J.; Lee, L.P. Ultrafast photonic PCR. Light-Sci. Appl. 2015, 4, e280. [Google Scholar] [CrossRef]
- Kang, B.-H.; Jang, K.-W.; Yu, E.-S.; Jeong, H.; Jeong, K.-H. Single-shot multi-channel plasmonic real-time polymerase chain reaction for multi-target point-of-care testing. Lab A Chip 2023, 23, 4701–4707. [Google Scholar] [CrossRef]
- Wan, L.; Li, M.; Law, M.-K.; Mak, P.-I.; Martins, R.P.; Jia, Y. Sub-5-Minute Ultrafast PCR using Digital Microfluidics. Biosens. Bioelectron. 2023, 242, 115711. [Google Scholar] [CrossRef]
- Hindson, C.M.; Chevillet, J.R.; Briggs, H.A.; Gallichotte, E.N.; Ruf, I.K.; Hindson, B.J.; Vessella, R.L.; Tewari, M. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat. Methods 2013, 10, 1003–1005. [Google Scholar] [CrossRef] [PubMed]
- Ling, W.; Zhou, W.; Cui, J.; Shen, Z.; Wei, Q.; Chu, X. Experimental study on the heating/cooling and temperature uniformity performance of the microchannel temperature control device for nucleic acid PCR amplification reaction of COVID-19. Appl. Therm. Eng. 2023, 226, 120342. [Google Scholar] [CrossRef]
- Nasser, G.A.; Abdel-Mawgood, A.L.; Abouelsoud, A.A.; Mohamed, H.; Umezu, S.; El-Bab, A.M.R.F. New cost effective design of PCR heating cycler system using Peltier plate without the conventional heating block. J. Mech. Sci. Technol. 2021, 35, 3259–3268. [Google Scholar] [CrossRef]
- Adam, J.; Singh, M.; Abduvakhidov, A.; Del Sorbo, M.R.; Feoli, C.; Hussain, F.; Kaur, J.; Mirabella, A.; Rossi, M.; Sasso, A.; et al. The Effectiveness of Cyrene as a Solvent in Exfoliating 2D TMDs Nanosheets. Int. J. Mol. Sci. 2023, 24, 10450. [Google Scholar] [CrossRef] [PubMed]
- Rusciano, G.; Capaccio, A.; Sasso, A.; Singh, M.; Valadan, M.; Dell’Aversana, C.; Altucci, L.; Altucci, C. Single-Cell Photothermal Analysis Induced by MoS2 Nanoparticles by Raman Spectroscopy. Front. Bioeng. Biotechnol. 2023, 10, 844011. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Zhao, J.; Fang, Y.; Guo, Z.; Wang, M.; He, N. An ultrafast and portable nucleic acid detection system based on photothermal PCR and real-time fluorescence detection. Nano Today 2023, 53, 102029. [Google Scholar] [CrossRef]





| Pathogens | Forward Primer Sequence | Reverse Primer Sequence | Channel |
|---|---|---|---|
| E. coli | AGGTGACACTAGAATA TTCGATGAGTTATCTGCAAGGTGA | GTACGACTCACTATAGGGA TAAAGATGTTTTTCACACTTATTGG | HEX |
| L. monocytogenes | AGGTGACACTAGAATA GGGAAATCTGAGGTGAT | GTACGACTCACTATAGGGA GTTTGTTGTATAGGCAATGGG | FAM |
| S. aureus | AGGTGACACTAGAATA GCGATTGATGGTGATACGG | GTACGACTCACTATAGGGA GCCAAGCTTGACGAACTA | ROX |
| Salmonella | AGGTGACACTAGAATA AAATCGTGCAGTGGCTTA | GTACGACTCACTATAGGGA AAGGCGCGGTCTTTACCATC | CY5 |
| Pathogens | Raw Milk (~0.5 h) | Milk after 48 h |
|---|---|---|
| E. coli | dPCR: 4 copies/μL pathogen culture: 11 CFU/25 mL | dPCR: 4862 copies/μL pathogen culture: 121 CFU/25 mL |
| L. monocytogenes | dPCR: 12 copies/μL pathogen culture: 36 CFU/25 mL | dPCR: 10,862 copies/μL pathogen culture: 1426 CFU/25 mL |
| S. aureus | dPCR: 3 copies/μL pathogen culture: 20 CFU/25 mL | dPCR: 5042 copies/μL pathogen culture: 179 CFU/25 mL |
| Salmonella | dPCR: 2 copies/μL pathogen culture: 17 CFU/25 mL | dPCR: 4923 copies/μL pathogen culture: 192 CFU/25 mL |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Liang, X.; Ma, J.; Cheng, J.; Wang, H.; Wang, X.; Wu, J.J.; An, H. Photothermal-Based Multiplex Nested Digital PCR System for Rapid Detection of Foodborne Pathogens. Micromachines 2024, 15, 435. https://doi.org/10.3390/mi15040435
Li J, Liang X, Ma J, Cheng J, Wang H, Wang X, Wu JJ, An H. Photothermal-Based Multiplex Nested Digital PCR System for Rapid Detection of Foodborne Pathogens. Micromachines. 2024; 15(4):435. https://doi.org/10.3390/mi15040435
Chicago/Turabian StyleLi, Junwei, Xinyi Liang, Jinsong Ma, Jianye Cheng, Hui Wang, Xuzhao Wang, Jie Jayne Wu, and Hailong An. 2024. "Photothermal-Based Multiplex Nested Digital PCR System for Rapid Detection of Foodborne Pathogens" Micromachines 15, no. 4: 435. https://doi.org/10.3390/mi15040435
APA StyleLi, J., Liang, X., Ma, J., Cheng, J., Wang, H., Wang, X., Wu, J. J., & An, H. (2024). Photothermal-Based Multiplex Nested Digital PCR System for Rapid Detection of Foodborne Pathogens. Micromachines, 15(4), 435. https://doi.org/10.3390/mi15040435

