A Novel PCR-Free Ultrasensitive GQD-Based Label-Free Electrochemical DNA Sensor for Sensitive and Rapid Detection of Francisella tularensis †
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Selection of Optimal GQDs Concentration for Bioassays and Preparation of SAM and GQDs Modified SPGE
2.3. Capture Probe ssDNA Immobilization and Characterization
2.4. DNA Detection Assay
2.5. Selectivity, Specificity, and Stability of a GQD-Based Electrochemical DNA Biosensor
3. Results and Discussion
3.1. Optimization of GQDs Concentration for Bioassays
3.2. Label-Free DNA Biosensor for F. tularensis Detection
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Sjöstedt, A.; Eriksson, U.; Berglund, L.; Tarnvik, A. Detection of Francisella tularensis in ulcers of patients with Tularemia by PCR. J. Clin. Microbiol. 1997, 35, 1045–1048. [Google Scholar] [CrossRef] [PubMed]
- CDC. Tularemia–United States, 2001–2010. MMWR Morb. Mortal. Wkly. Rep. 2013, 62, 963–966. [Google Scholar]
- Buse, H.Y.; Morris, B.J.; Rice, E.W. Early detection of viable Francisella tularensis in environmental matrices by culture-based PCR. BMC Microbiol. 2020, 20, 66. [Google Scholar] [CrossRef] [PubMed]
- Skladal, P.; Pohanka, M.; Kupska, E.; Safar, B. Biosensors for Detection of Francisella Tuleransis and Diagnosis of Tularemia; Military Academy: Hradec Kralove, Czech Republic, 2010. [Google Scholar]
- Ilkhani, H.; Farhad, S. A novel electrochemical DNA biosensor for Ebola virus detection. Anal. Biochem. 2018, 557, 151–155. [Google Scholar] [CrossRef]
- Xiang, Q.; Huang, J.; Huang, H.; Mao, W.; Ye, Z. A label-free electrochemical platform for the highly sensitive detection of Hepatitis B virus DNA using graphene quantum dots. RCS Adv. 2018, 8, 1820–1825. [Google Scholar] [CrossRef]
- Deshmukh, M.A.; Patil, H.K.; Bodkhe, G.A.; Yasuzawa, M.; Koinkar, P.; Ramanaviciene, A.; Shirsat, M.D.; Ramanavicius, A. EDTA-modified PANI/SWNTs nanocomposite for differential pulse voltammetry based determination of Cu(II) ions. Sens. Actuators B Chem. 2018, 260, 331–338. [Google Scholar] [CrossRef]
- Liu, J.; Xu, N.; Men, H.; Li, S.; Lu, Y.; Low, S.S.; Li, X.; Zhu, L.; Cheng, C.; Xu, G.; et al. Salivary cortisol determination on smartphone-based differential pulse voltammetry system. Sensors 2020, 20, 1422. [Google Scholar] [CrossRef]
- Taha, M.H.F.; Ashraf, H.; Caesarendra, W. A brief description of cyclic voltammetry transducer-based non-enzymatic glucose biosensor using synthesized graphene electrodes. Appl. Syst. Innov. 2020, 3, 32. [Google Scholar] [CrossRef]
- Wang, X.; Nan, F.; Zhao, J.; Yang, T.; Ge, T.; Jiao, K. A label-free ultrasensitive electrochemical DNA sensor based on thin-layer MoS2 nanosheets with high electrochemical activity. Biosensens. Bioelectron. 2015, 64, 386–391. [Google Scholar] [CrossRef]
- Zhang, K.J.X.Z.; Liu, S.F.; Hu, Y.W. Readily Reusable Electrochemical DNA Hybridization Biosensor Based on the Interaction of DNA with Single-Walled Carbon Nanotubes. Anal. Chem. 2009, 81, 6006–6012. [Google Scholar] [CrossRef]
- Yang, Y.; Li, C.; Yin, L.; Liu, M.; Wang, Z.; Shu, Y.; Li, G. Enhanced charge transfer by gold nanoparticle at DNA modified electrode and its application to label-free DNA detection. ACS Appl. Mater. Interfaces 2014, 6, 7579–7584. [Google Scholar] [CrossRef] [PubMed]
- Jiang, G.; Jiang, T.; Zhou, H.; Yao, J.; Kong, X. Preparation of N-doped carbon quantum dots for highly sensitive detection of dopamine by an electrochemical method. RSC Adv. 2015, 5, 9064–9068. [Google Scholar] [CrossRef]
- Arzum Erdem, K.K.; Meric, B.; Akarca, U.S.; Ozsoz, M. DNA Electrochemical Biosensor for the Detection of Short DNA Sequences Related to the Hepatitis B Virus. Electroanalysis 1999, 3, 586–588. [Google Scholar] [CrossRef]
- Ulianas, A.; Heng, L.Y.; Ahmad, M.; Lau, H.Y.; Ishak, Z.; Ling, T.L. A regenerable screen-printed DNA biosensor based on acrylic microsphere–gold nanoparticle composite for genetically modified soybean determination. Sens. Actuator B Chem. 2014, 190, 694–701. [Google Scholar] [CrossRef]
- Xu, S.; Zhang, Y.; Dong, K.; Wen, J.; Zheng, C.; Zhao, S. Electrochemical DNA Biosensor Based on Graphene OxideChitosan Hybrid Nanocomposites for Detection of Escherichia coli O157:H7. Int. J. Electrochem. Sci. 2017, 12, 3443–3458. [Google Scholar] [CrossRef] [PubMed]
- Uludag, Y.; Hammond, R.; Cooper, M.A. A signal amplification assay for HSV type 1 viral DNA detection using nanoparticles and direct acoustic profiling. J. Nanobiotechnol. 2010, 8, 3. [Google Scholar] [CrossRef]
- Kumar, N.; Hu, Y.; Singh, S.; Mizaikoff, B. Emerging biosensor platforms for the assessment of water-borne pathogens. Analyst 2018, 143, 359–373. [Google Scholar] [CrossRef]
- Vivekananda, J.; Kiel, J.L. Anti-Francisella tularensis DNA aptamers detect tularemia antigen from different subspecies by aptamer-linked immobilized sorbent assay. Lab. Investig. 2006, 86, 610–618. [Google Scholar] [CrossRef]
- Savas, S.; Altintas, Z. Graphene Quantum Dots as Nanozymes for Electrochemical Sensing of Yersinia enterocolitica in Milk and Human Serum. Materials 2019, 12, 2189. [Google Scholar] [CrossRef]
- Yag, A.; Su, Y.; Zhang, Z.; Wang, H.; Qi, C.; Ru, S.; Wag, J. Preparation of graphene quantum dots by visible-fenton reaction and ultrasensitive label-free immunosensor for detecting Lipovitellin of pralichthys olisacess. Biosensors 2022, 12, 246. [Google Scholar]
- Baracu, A.M.; Gugoasa, L.A.D. Recent Advances in Microfabrication, Design and Applications of Amperometric Sensors and Biosensors. J. Electrochem. Soc. 2021, 168, 037503. [Google Scholar] [CrossRef]
- Li, X.; Wang, L.; Du, D.; Ni, L.; Pan, J.; Niu, X. Metal–nitrogen–carbon-based nanozymes: Advances and perspectives. TrAC Trends Anal. Chem. 2019, 120, 1–13. [Google Scholar] [CrossRef]
- Mahmudunnabi, R.G.; Farhana, F.Z.; Kashaninejad, N.; Firoz, S.H.; Shim, Y.B.; Shiddiky, M.J.A. Nanozyme-based electrochemical biosensors for disease biomarker detection. Analyst 2020, 14–15, 4398–4420. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Wang, X.; Wang, Q.; Lou, Z.; Li, S.; Zhu, Y.; Qin, L.; Wei, H. Nanomaterials with enzyme-like characteristics (nanozymes): Next-generation artificial enzymes (II). Chem. Soc. Rev. 2019, 48, 1004–1076. [Google Scholar]
- Zhang, Y.; Li, S.; Liu, H.; Long, W.; Zhang, X.D. Enzyme-Like Properties of Gold Clusters for Biomedical Application. Front. Chem. 2020, 8, 219. [Google Scholar] [CrossRef]
- Facure, M.H.M.; Andre, R.S.; Cardoso, R.M.; Mercante, L.A.; Correa, D.S. Electrochemical and optical dual-mode detection of phenolic compounds using MnO2/GQD nanozyme. Electrochim. Acta 2023, 441, 141777. [Google Scholar] [CrossRef]
- Stefanov, C.; Negut, C.C.; Gugoasa, L.A.D. Gold nanoparticle-graphene quantum dots nanozyme for the wide range and sensitive electrochemical determination of quercetin in plasma droplets. Microchim. Acta 2020, 187, 611. [Google Scholar]
- Li, G.; Chen, M.; Wang, B.; Wang, C.; Wu, G.; Lian, J.; Zhou, Z. Dual-signal sandwich-type aptasensor based on H-rGO-Mn3O4 nanozymes for ultrasensitive Golgi protein 73 determination. Anal. Chim. Acta 2022, 1221, 340102. [Google Scholar] [CrossRef]
- Li, Z.; Zhang, J.; Dai, G.; Luo, F.; Chu, Z.; Geng, X.; He, P.; Zhang, F.; Wang, Q. A Ratiometric Electrochemical Biosensor for Glycated Albumin Detection Based on Enhanced Nanozyme Catalysis of Cuprous Oxide-Modified Reduced Graphene Oxide Nanocomposites. J. Mater. Chem. B 2021, 9, 9324–9332. [Google Scholar] [CrossRef]
- Dinu, L.A.; Kurbanoglu, S. Enhancing electrochemical sensing through the use of functionalized graphene composites as nanozymes. Nanoscale 2023, 15, 16514–16538. [Google Scholar] [CrossRef]
- Savas, S.; Ersoy, A.; Gulmez, Y.; Kilic, S.; Levent, B.; Altintas, Z. Nanoparticle Enhanced Antibody and DNA Biosensors for Sensitive Detection of Salmonella. Materials 2018, 11, 1541. [Google Scholar] [CrossRef] [PubMed]
- Savas, S. Rapid detection of Klebsiella pneumonia from the clinical and environmental samples by Biosensor Technology and Determination of Appropriate Typing Method. Ank. Univ. Vet. Fak. Derg. 2019, 66, 397–405. [Google Scholar]
- Kulman, J.D.; Satake, M.; Harris, J.E. A Versatile System for Site-Specific Enzymatic Biotinylation and Regulated Expression of Proteins in Cultured Mammalian Cells. Protein Expr. Purif. 2007, 52, 320–328. [Google Scholar] [CrossRef]
- Lippert, L.G.; Hallock, J.T.; Dadosh, T.; Diroil, B.T.; Murray, C.B.; Golman, Y.E. Neutravidin functionalization of CdSe/CdS quantum nanorods and quantification of biotin binding sites using biotin 4 fluorescein quenching. Bioconjug. Chem. 2016, 27, 562–568. [Google Scholar] [CrossRef]
- Kala, D.; Sharma, T.K.; Gupta, S.; Saini, R.V.; Saini, A.K.; Alsanie, W.F.; Thakur, V.K.; Kaushal, A. Development of paper-based DNA sensor for detection of O. Tsutsugamushi using sustainable GQDs@AuNPs nanocomposite. Chemosphere 2022, 300, 134428. [Google Scholar] [CrossRef]
- Zhang, Y.; Wu, C.; Zhou, X.; Wu, X.; Yang, Y.; Wu, H.; Guo, S.; Zhang, J. Garphene quantum dots/gold electrode and its application in living cell H2O2 detection. Nanoscale 2013, 5, 1816–1819. [Google Scholar] [CrossRef]
- Yang, Y.; Liu, Q.; Liu, Y.; Chui, J.; Liu, H.; Wang, P.; Li, Y.; Chen, L.; Zhao, Z.; Dong, Y. A novel label-free electrochemical immunosensor based on functionalized nitrogen-doped graphene quantum dots for carcinoembryonic antigen detection. Biosens. Bioelectron. 2017, 90, 31–38. [Google Scholar] [CrossRef]
- Mansor, N.N.N.; Leong, T.T.; Safitri, E.; Futra, D.; Ahmad, N.S.; Nasuruddin, D.N.; Itnin, A.; Zaini, I.Z.; Arifin, K.T.; Heng, L.Y.; et al. An Amperometric Biosensor for the Determination of Bacterial Sepsis Biomarker, Secretory Phospholipase Group 2-IIA Using a Tri-Enzyme System. Sensors 2018, 18, 686. [Google Scholar] [CrossRef]
- Hassan, A.H.A.; Escosura-Muñiz, A.; Merkoçi, A. Highly sensitive and rapid determination of Escherichia coli O157:H7 in minced beef and water using electrocatalytic gold nanoparticle tags. Biosens. Bioelectron. 2015, 67, 511–515. [Google Scholar] [CrossRef]
- Jahani, P.M.; Jafari, M.; Gupta, V.K.; Agarwal, S. Graphene quantum dots/ionic liquid-Modified Carbon Paste Electrode-Based Sensor for Simultaneous voltammetric determination of norepinephrine and acetylcholine. Int. J. Electrochem. Sci. 2020, 15, 947–958. [Google Scholar] [CrossRef]
- Thulasinathan, B.; Sujatha, D.; Murugan, S.; Panda, S.K.; Veerapandian, M.; Manickam, P. DNA-functionalized carbon quantum dots for electrochemical detection of pyocyanin: A quorum sensing molecule in Pseudomonas aeruginosa. Biosens. Bioelectron. 2023, 227, 115156. [Google Scholar] [CrossRef] [PubMed]
- Baluta, S.; Meloni, F.; Halicka, K.; Szyszka, A.; Zucca, A.; Pilo, M.I.; Cabaj, J. Differential pulse voltammetry and chronoamperometry as analytical tools for epinephrine detection using. RSC Adv. 2022, 12, 25342. [Google Scholar] [CrossRef] [PubMed]
- Dedachi, K.I.; Natsume, T.; Nakatsu, T.; Tanaka, S.; Ishikawa, Y.; Kurita, N. Charge transfer through single- and double-strand DNAs: Simulations based on molecular dynamics and molecular orbital methods. Chem. Phys. Lett. 2007, 436, 244. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kratochvılova, I.; Kral, K.; Buncek, M.; Vıskova, A.; Nespurek, S.; Kochalska, A.; Schneider, B. Conductivity of natural and modified DNA measured by scanning tunneling microscopy. The effect of sequence, charge and stacking. Biophys. Chem. 2008, 138, 3. [Google Scholar] [CrossRef]
- Daraghma, S.M.A.; Talebi, S.; Periasamy, V. Understanding the electronic properties of single- and double-stranded DNA. Eur. Phys. J. E 2020, 43, 40. [Google Scholar] [CrossRef]
- Venkatramani, R.; Keinan, S.; Balaeff, A.; Coord, D.N.B. Nucleic Acid Charge Transfer: Black, White and Gray. Chem. Rev. 2011, 255, 635. [Google Scholar] [CrossRef]
- Artes, J.M.; Lopez-Martınez, M.; Dıez-Perez, I.; Sanz, F.; Gorostiza, P. Nanoscale charge transfer in redox proteins and DNA: Towards biomolecular electronics. Electrochim. Acta 2014, 140, 83. [Google Scholar] [CrossRef]
- Jaya, B.; Brajesh, B.; Gatto, G.; Broncova, B.; Kumar, A. Electrochemical sensor and their applications: A review. Chemosensors 2022, 10, 363. [Google Scholar] [CrossRef]
- Sehit, E.; Drzazgowska, J.; Buchenau, D.; Yesildag, C.; Lensen, M.; Altintas, Z. Ultrasensitive nonenzymatic electrochemical glucose sensor based on gold nanoparticles and molecularly imprinted polymers. Biosens. Bioelectron. 2020, 165, 112432. [Google Scholar] [CrossRef]
- Hassen, W.M.; Chaix, C.; Abdelghani, A.; Bessueille, F.; Leonard, D.; Jaffrezic-Renault, N. An impedimetric DNA sensor based on functionalized magnetic nanoparticles for HIV and HBV detection. Sens. Actuators B 2008, 134, 755–760. [Google Scholar] [CrossRef]
- Lu, Q.; Wei, W.; Zhou, Z.; Zhou, Z.; Zhang, Y.; Liu, S. Electrochemiluminescence resonance energy transfer between graphene quantum dots and gold nanoparticles for DNA damage detection. Analyst 2014, 139, 2404–2410. [Google Scholar] [CrossRef] [PubMed]
- Yuhana Ariffin, E.; Heng, L.Y.; Tan, L.L.; Abd Karim, N.H.; Hasbullah, S.A. A highly sensitive impedimetric DNA biosensor based on hollow silica microspheres for label-free determination of E. coli. Sensors 2020, 20, 1279. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.R.; Bacchu, M.S.; Setu, M.A.A.; Akter, S.; Hasan, M.N.; Chowdhury, F.T.; Rahman, M.M.; Ahommed, M.S.; Khan, M.Z.H. Development of an advanced DNA biosensor for pathogen Vibrio cholerae detection in real sample. Biosens. Bioelectron. 2021, 188, 113338. [Google Scholar] [CrossRef] [PubMed]
- Lorenz, T.C. Polymerase chain reaction: Basic protocol plus troubleshooting and optimization strategies. J. Vis. Exp. 2012, 63, 3998. [Google Scholar]
- Deng, M.; Lie, J.; Xiao, B.; Ren, Z.; Li, Z.; Yu, H.; Li, J.; Wang, J.; Chen, Z.; Wang, X. Ultrasensitive Label free DNA detection based on solution-gated graphene transistors functionalized with carbon quantum dots. Anal. Chem. 2022, 94, 3320–3327. [Google Scholar] [CrossRef]
- Chen, L.C.; Wang, E.; Tai, C.S.; Chin, Y.C.; Li, C.W.; Lin, Y.R.; Huang, C.W.; Chen, J.C.; Chen, W.L. Improving the reproducibility, accuracy, and stability of an electrochemical biosensor platform for point-of-care use. Biosens. Bioelectron. 2020, 155, 112111. [Google Scholar] [CrossRef]










| DNA Primer | Sequence |
|---|---|
| Capture Probe (ssDNA) Complementary target (ssGDNA) | 5′-TTCTCAGCATACTTAGTAATTGG 5′TCTAAGTGCCATGATACAAGCTTCCCAATTACTAAGTAT |
| DNA Primer | Sequence |
|---|---|
| Salmonella spp. target Y. pestis target | 5′-TTCTCAGCATACTTAGTAATTGG 5′TCTAAGTGCCATGATACAAGCTTCCCAATTACTAAGTAT |
| Nanomaterials | Detection Methods | Target | Limit of Detection | References |
|---|---|---|---|---|
| GQDs | Electrochemical biosensor | HBV-DNA | 1 nM | [6] |
| Neutravidin modified | Electrochemical biosensor | HBV-DNA | 2350 nM | [51] |
| AuNPs | Electrochemical biosensor | ssDNA-AuNPs | 13 nM | [52] |
| Enzyme-amplified | Electrochemical biosensor | Ebola Virus | 4.7 nM | [5] |
| Carbon nanomaterials | Electrochemical biosensor | HBV-DNA | 15 nM | [8] |
| GQDs | Electrochemical biosensor | F. tularensis | 0.1 nM | This study |
| DNA Primer | Sequence |
|---|---|
| Complementary target (ssGDNA); Three-base mismatched complementary target; Two-base mismatched complementary target; One-base mismatched complementary target. | 5′TCTAAGTGCCATGATACAAGCTTCCCAATTACTAAGTAT 5′TCTAAGTGCCATcATACAAGCTTgCCAATTACTtAGTAT 5′TCTAAGTGCCAacATACAAGCTTCCCAATTACTAAGTAT 5′TCTcGGTGCCATGATACAAGCTTCCCAATTACTAAGTAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Savas, S.; Sarıçam, M. A Novel PCR-Free Ultrasensitive GQD-Based Label-Free Electrochemical DNA Sensor for Sensitive and Rapid Detection of Francisella tularensis . Micromachines 2024, 15, 1308. https://doi.org/10.3390/mi15111308
Savas S, Sarıçam M. A Novel PCR-Free Ultrasensitive GQD-Based Label-Free Electrochemical DNA Sensor for Sensitive and Rapid Detection of Francisella tularensis . Micromachines. 2024; 15(11):1308. https://doi.org/10.3390/mi15111308
Chicago/Turabian StyleSavas, Sumeyra, and Melike Sarıçam. 2024. "A Novel PCR-Free Ultrasensitive GQD-Based Label-Free Electrochemical DNA Sensor for Sensitive and Rapid Detection of Francisella tularensis " Micromachines 15, no. 11: 1308. https://doi.org/10.3390/mi15111308
APA StyleSavas, S., & Sarıçam, M. (2024). A Novel PCR-Free Ultrasensitive GQD-Based Label-Free Electrochemical DNA Sensor for Sensitive and Rapid Detection of Francisella tularensis . Micromachines, 15(11), 1308. https://doi.org/10.3390/mi15111308
