The Master Transcription Factor mtfA Governs Aflatoxin Production, Morphological Development and Pathogenicity in the Fungus Aspergillus flavus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Strains and Growth Conditions
Strain Name | Related Genotype | Source |
---|---|---|
CA14 | pyrG−, niaD−, Δku70 | [29] |
CA14-pyrG-1 | niaD−, Δku70 | [29] |
CA14 pyrG-1-niaD+ | prototroph, Δku70 | This study |
TZZ1 | ΔmtfA::pyrG. niaD−, Δku70 | This study |
TZZ2 | ΔmtfA::pyrG, Δku70 | This study |
TZZ3 | ΔmtfA::pyrG. niaD−, mtfA::niaD+, Δku70 | This study |
TZZ4 | gpdA(p)::mtfA::trpC(t)::pyrG. niaD−, Δku70 | This study |
TZZ5 | gpdA(p)::mtfA::trpC(t)::pyrG, Δku70 | This study |
2.2. Generation of the Deletion, Complementation and Overexpression mtfA Strains
Primer Name | Sequence |
---|---|
mtfA-del-1 | CCCCCATGATTAATGATTGATGGATTTCTGGGCG |
mtfA-del-2 | GGGAGAGCTTGAGCTGTGGAAGGTGGAAGGAT |
mtfA-del-3 | ACCAAAGCACAAAGACAAGAAACTAAAA |
mtfA-del-4 | TACATATGGCATCCTCTCACGAACGTC |
mtfA-del-5 | ATCCTTCCACCTTCCACAGCTCAAGCTCTCCCGCCTCAAACAATGCTCTTCACCC |
mtfA-del-6 | TTTTAGTTTCTTGTCTTTGTGCTTTGGTGTCTGAGAGGAGGCACTGATGC |
C-NsiI-S | NNNNNNNATGCATGATTCATCCCCCATGATTAA |
C-Nsil-A | NNNNNNNATGCATTACATATGGCATCCTCTCAC |
mtfA-S | GATTCATCCCCCATGATTAA |
mtfA-A | TACATATGGCATCCTCTCAC |
O-AscI-S | AAAAAGGCGCGCCATGGATCTCGCCAGCCTTATCACTCC |
O-NotI-A | AAAAAAAGCGGCCGCTTATACCATGGCGGTGGCGACG |
gpdA-p | AAGTACTTTGCTACATCCATACTCC |
niaD-S | ACCGGTCGCCTCAAACAATGCTCTGGCAATGTGAGGCTCCTCCCCAATC |
niaD-A | GTCTGAGAGGAGGCACTGATGCGGCGATCTCTGGATCAATACGACCGAC |
qPCR-Afla_18S_F | TGATGACCCGCTCGGCACCTTACGAGAAATCAAAGT |
qPCR-Afla_18S_R | GGCCATGCACCACCATCCAAAAGATCAAGAAAGAGC |
qPCR-Afla_ver1_F | GCGGAGAAAGTGGTTGAACAGATC |
qPCR-Afla_ver1_R | CAGCGAACAAAGGTGTCAATAGCC |
qPCR-Afla_brlA_F | TATCCAGACATTCAAGACGCACAG |
qPCR-Afla_brlA_R | GATAATAGAGGGCAAGTTCTCCAAAG |
qPCR-Afla_aflR_F | GCAACCTGATGACGACTGATATGG |
qPCR-Afla_aflR_R | TGCCAGCACCTTGAGAACGATAAG |
qPCR-Afla_mtfA_F | AGTGTGGCCTCGTACTCTTCGCCGGTTGAATCCTC |
qPCR_Afla_mtfA_R | GTCGTGGTTCTGTTGGTAGGGTGCCGAGCTGGAAG |
2.3. Aflatoxin B1 Analysis
2.4. Morphological Analysis
2.5. Gene Expression Analysis
2.6. Pathogenicity Study
2.7. Hydrolytic Activity Analysis
2.7.1. Lipase Activity
2.7.2. Protease Activity
2.7.3. Amylase Activity
2.8. Statistical Analysis
3. Results
3.1. mtfA Affects AFB1 Biosynthesis as well as the Production of Other Unknown Secondary Metabolites in A. flavus
3.2. Morphological Development Is Regulated by mtfA in A. flavus
3.3. mtfA Is Necessary for Normal Virulence of A. flavus Peanut Infections
3.4. mtfA Positively Affects Lipase and Protease Activity While It Is Dispensable for Normal Amylase Activity
4. Discussion
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Bennett, J.W.; Klich, M. Mycotoxins. Clin. Microbiol. Rev. 2003, 16, 497–516. [Google Scholar] [CrossRef] [PubMed]
- Perrone, G.; Susca, A.; Cozzi, G.; Ehrlich, K.; Varga, J.; Frisvad, J.C.; Meijer, M.; Noonim, P.; Mahakarnchanakul, W.; Samson, R.A. Biodiversity of Aspergillus species in some important agricultural products. Stud. Mycol. 2007, 59, 53–66. [Google Scholar] [CrossRef] [PubMed]
- Dvorackova, I.; Kusak, V. Hepatocellular Carcinoma (a 28-year necropsy review). J. Pathol. Environ. Toxicol. Oncol. 1990, 10, 220–224. [Google Scholar]
- Payne, G.A.; Brown, M.P. Genetics and Physiology of Aflatoxin Biosynthesis. Annu. Rev. Phytopathol. 1998, 36, 329–362. [Google Scholar] [CrossRef] [PubMed]
- Probust, C.; Schulthess, F.; Cotty, P.J. Impact of Aspergillus section Flavi community structure on the development of lethal levels of aflatoxins in Kenyan maize (Zea mays). J. Appl. Microbiol. 2010, 108, 600–610. [Google Scholar] [CrossRef] [PubMed]
- Sweeny, M.J.; Dobson, A.D. Molecular Biology of Mycotoxin Biosynthesis. FEMS Microbiol. Lett. 1999, 175, 149–163. [Google Scholar] [CrossRef]
- Trail, F.; Mahanti, N.; Linz, J.E. Molecular Biology of Aflatoxin Biosynthesis. Microbiology 1995, 141 Pt 4, 755–765. [Google Scholar] [CrossRef] [PubMed]
- Amaike, S.; Keller, N.P. Distinct Roles for VeA and LaeA in Development and Pathogenesis in A. flavus. Eukaryot Cell 2009, 8, 1051–1060. [Google Scholar] [CrossRef] [PubMed]
- Cary, J.W.; Ehrlich, K.C.; Kale, S.P.; Calvo, A.M.; Bhatanagar, D.; Clevelend, T.E. Regulatory elements in aflatoxin biosynthesis. Mycotoxin Res. 2006, 22, 105–109. [Google Scholar] [CrossRef] [PubMed]
- Cary, J.W.; Harris-Coward, P.Y.; Ehrlich, K.C.; Mack, B.M.; Kale, S.P.; Larey, C.; Calvo, A.M. NsdC and NsdD Affect Aspergillus flavus Morphogenesis and Aflatoxin Production. Eukaryot Cell 2012, 11, 1104–1111. [Google Scholar] [CrossRef] [PubMed]
- Chang, P.K.; Scharfenstein, L.L.; Ping, L.; Ehrlich, K. Aspergillus flavus VelB acts distinctly from VeA in conidiation and may coordinate with FluG to modulate sclerotial production. Fungal Genet Biol 2013, 58, 71–79. [Google Scholar] [CrossRef] [PubMed]
- Duran, R.M.; Cary, J.W.; Calvo, A.M. Production of cyclopiazonic acid, aflatrem, and aflatoxinby Aspergillus flavus is regulated by veA, a gene necessary for sclerotial formation. Appl. Microbiol. Biotechnol. 2007, 73, 1158–1168. [Google Scholar] [CrossRef] [PubMed]
- Duran, R.M.; Cary, J.W.; Calvo, A.M. The role of veA on Aspergillus flavus infection of peanuts, corn and cotton. Open Mycol. J. 2009, 3, 27–36. [Google Scholar] [CrossRef]
- Brown, D.W.; Yu, J.H.; Kelkar, H.S.; Fernandes, M.; Nesbitt, T.C.; Keller, N.P.; Adams, T.H.; Leonard, T.L. Twenty-five coregulated transcripts define a sterigmatocystin gene cluster in Aspergillus nidulans. Proc. Natl. Acad. Sci. USA 1996, 93, 1418–1422. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, M.; Keller, N.P.; Adams, T.H. Sequence-specific binding by Aspergillus nidulans AflR, a C-6 zinc cluster protein regulating mycotoxin biosynthesis. Mol. Microbiol. 1998, 28, 1355–1365. [Google Scholar] [CrossRef] [PubMed]
- Payne, G.A.; Nystrom, G.J.; Bhatnagar, D.; Cleveland, T.E.; Woloshuk, C.P. Cloning of the afl-2 gene involved in aflatoxin biosynthesis from Aspergillus flavus. Appl. Environ. Microbiol. 1993, 59, 156–162. [Google Scholar] [PubMed]
- Woloshuk, C.P.; Yousibova, G.L.; Rollins, J.A.; Bhatnagar, D.; Payne, G.A. Molecular Characterization of the afl-1 Locus in Aspergillus flavus. Appl. Enviorn. Microbiol. 1995, 61, 3019–3023. [Google Scholar]
- Yabe, K.; Nakajima, H. Enzyme Reactions and Genes in Aflatoxin Biosynthesis. Appl. Microbiol. Biotechnol. 2004, 64, 745–755. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.H.; Butchko, R.A.; Fernandes, M.; Keller, N.P.; Leonard, T.J.; Adams, T.H. Conservation of structure and function of the aflatoxin regulatory gene aflR from Aspergillus nidulans and A. flavus. Curr. Genet. 1996, 29, 549–555. [Google Scholar] [CrossRef] [PubMed]
- Ramamoorthy, V.; Dhingra, S.; Kincaid, A.; Shantappa, S.; Feng, X.; Calvo, A.M. The putative C2H2 transcription factor MtfA is a novel regulator of secondary metabolism and morphogenesis in Aspergillus nidulans. PLoS ONE 2013, 8, e74122. [Google Scholar]
- Lind, A.; Wisecaver, J.H.; Smith, T.D.; Feng, X.; Calvo, A.M.; Rokas, A. Examining the evolution of the regulatory circuit controlling secondary metabolism and development in the fungal genus Aspergillus. PLoS Genet. 2015, 11, e1005096. [Google Scholar] [CrossRef] [PubMed]
- Smith, T.D.; Calvo, A.M. The mtfA transcription factor gene controls morphogenesis, gliotoxin production, and virulence in the opportunistic human pathogen Aspergillus fumigatus. Eukaryot Cell 2014, 13, 766–775. [Google Scholar] [CrossRef] [PubMed]
- Comera, C.; André, K.; Laffitte, J.; Collet, X.; Galtier, P.; Maridonneau-Parini, I. Gliotoxin from Aspergillus fumigatus affects phagocytosis and the organization of the actin cytoskeleton by distinct signaling pathways in human neutrophils. Microbes Infect. 2007, 9, 47–54. [Google Scholar] [CrossRef] [PubMed]
- Kwon-Chung, K.J.; Sugui, J.A. What do we know about the role of gliotoxin in the pathobiology of Aspergillus fumigatus? Med. Mycol. 2009, 47, S97–S103. [Google Scholar] [CrossRef] [PubMed]
- Piva, T.J. Gliotoxin induces apoptosis in mouse l929 fibroblast cells. Biochem. Mol Biol. Int. 1994, 33, 411–419. [Google Scholar] [PubMed]
- Stanzani, M.; Orciuolo, E.; Lewis, R.; Kontoyiannis, D.P.; Martins, S.L.; St John, L.S.; Komanduri, K.V. Aspergillus fumigatus suppresses the human cellular immune response via gliotoxin-mediated apoptosis of monocytes. Blood 2005, 105, 2258–2265. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, L.S.; Abe, S.; Tsunawaki, S. Fungal gliotoxin targets the onset of superoxide-generating NADPH oxidase of human neutrophils. Biochem. Biophys. Res. Commun. 2000, 268, 716–723. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.S.; Linz, J.E. Recombinational inactivation of the gene encoding nitrate reductase in Aspergillus parasiticus. Appl. Environ. Microbiol. 1993, 59, 2998–3002. [Google Scholar] [PubMed]
- Cary, J.W.; Han, Z.; Yin, Y.; Lohmar, J.M.; Shantappa, S.; Harris-Coward, P.Y.; Mack, B.; Ehrlich, K.C.; Wei, Q.; Arroyo-Manzanares, N.; et al. Transcriptome analysis of Aspergillus flavus reveals veA-dependent regulation of secondary metabolite gene clusters, including the novel aflavarin cluster. Eukaryot Cell 2015, 10, 983–997. [Google Scholar]
- Szewczyk, E.; Nayak, T.; Oakley, E.C.; Edgerton, H.; Xiong, Y.; Naimeh, T.-T.; Osmani, S.A.; Oakley, B.R. Fusion PCR and gene targeting in Aspergillus nidulans. Nat. Protoc. 2006, 1, 3111–3121. [Google Scholar] [CrossRef] [PubMed]
- Steinbach, W.J.; Cramer, R.A.; Perfect, B.Z.; Henn, C.; Nielsen, K.; Heitman, J.; Perfect, J.R. Calcineurin inhibition or mutation enhances cell wall inhibitors against Aspergillus fumigatus. Antimicrob. Agents Chemother. 2007, 51, 2979–2981. [Google Scholar] [CrossRef] [PubMed]
- Cary, J.W.; Ehrlich, K.C.; Bland, J.M.; Montalbano, B.G. The aflatoxin biosynthesis cluster gene, aflX, encodes an oxidoreductase involved in conversion of vesicolorin A to demethylsterigmatocystin. Appl. Environ. Microbiol. 2005, 72, 1096–1101. [Google Scholar] [CrossRef] [PubMed]
- Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2001. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 24, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Dolezal, A.L.; Obrian, G.R.; Nielsen, D.M.; Woloshuk, C.P.; Boston, R.S.; Payne, G.A. Localization, morphology and transcriptional profile of Aspergillus flavus during seed colonization. Mol. Plant Pathol. 2013, 14, 898–909. [Google Scholar] [CrossRef] [PubMed]
- Mellon, J.E.; Cotty, P.J.; Dowd, M.K. Aspergillus flavus hydrolases: Their roles in pathogenesis and substrate utilization. Appl. Microbiol. Biotechnol. 2007, 77, 497–504. [Google Scholar] [CrossRef] [PubMed]
- Amaike, S.; Affeldt, K.J.; Yin, W-B.; Franke, S.; Choithani, A.; Keller, N.P. The bZIP Protein MeaB Mediates Virulence Attributes in Aspergillus flavus. PLoS ONE 2013, 8, e74030. [Google Scholar] [CrossRef] [PubMed]
- Duran, R.M.; Gregerson, S.; Smith, T.D.; Behtariya, P.J.; Cary, J.W.; Harris-Coward, P.Y.; Mattison, C.P.; Grimm, C.; Calvo, A.M. The Role of Aspergillus flavus veA in the production of extracellular proteins during the growth on starch substrates. Appl. Microbiol. Biotechnol. 2014, 98, 5081–5094. [Google Scholar] [CrossRef] [PubMed]
- Adams, T.H.; Boylan, M.T.; Timberlake, W.E. brlA is necessary and sufficient to direct conidiophore development in Aspergillus nidulans. Cell 1988, 54, 353–362. [Google Scholar] [CrossRef]
- Han, S.; Adams, T.H. Complex control of the developmental regulatory locus brlA in Aspergillus nidulans. Mol. Genet. Genom. 2001, 266, 260–270. [Google Scholar]
- Vardon, P.; McLaughlin, C.; Nardinelli, C. Potential Economic Costs of Mycotoxins in the UnitedStates. In Mycotoxins: Risks in Plant, Animal, and Human Systems; Council for Agricultural Science and Technnology (CAST): Ames, IA, USA, 2003. [Google Scholar]
- Calvo, A.M.; Wilson, R.A.; Bok, J.W.; Keller, N.P. Relationship between secondary metabolism and fungal development. Microbiol. Mol Biol. Rev. 2002, 66, 447–459. [Google Scholar] [CrossRef] [PubMed]
- Geiser, D.M.; Timberlake, W.E.; Arnold, M.L. Loss of Meiosis in Aspergillus. Mol. Biol. Evol. 1996, 13, 809–817. [Google Scholar] [CrossRef] [PubMed]
- Ramirez-Prado, J.H.; Moore, G.G.; Horn, B.W.; Carbone, I. Characterization and Population Analysis of the Mating—Type Genes in Aspergillus flavus and Aspergillus parasiticus. Fungal Genet. Biol. 2008, 45, 1292–1299. [Google Scholar] [CrossRef] [PubMed]
- Wada, R.; Maruyama, J.; Yamaguchi, H.; Yamamoto, N.; Wagu, Y.; Paoletti, M.; Archer, D.B.; Dyer, P.S.; Kitamoto, K. Presence and functionality of mating type genes in the supposedly asexual filamentous fungus Aspergillus oryzae. Appl. Environ. Microbiol. 2012, 78, 2819–2829. [Google Scholar] [CrossRef] [PubMed]
- Horn, B.W.; Moore, G.G.; Carbone, I. Sexual reproduction in Aspergillus flavus. Mycologia 2009, 101, 423–429. [Google Scholar] [CrossRef] [PubMed]
- Horn, B.W.; Sorensen, R.B.; Lamb, M.C.; Sobolev, V.S.; Olarte, R.A.; Worthington, C.J.; Carbone, I. Sexual reproduction in Aspergillus flavus sclerotia naturally produced in corn. Phytopathology 2014, 104, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Cotty, P.J.; Cleveland, T.E.; Brown, R.L.; Mellon, J.E. Variation in polygalacturonase production among Aspergillus flavus isolates. Appl. Environ. Microbiol. 1990, 56, 3885–3887. [Google Scholar] [PubMed]
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons by Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhuang, Z.; Lohmar, J.M.; Satterlee, T.; Cary, J.W.; Calvo, A.M. The Master Transcription Factor mtfA Governs Aflatoxin Production, Morphological Development and Pathogenicity in the Fungus Aspergillus flavus. Toxins 2016, 8, 29. https://doi.org/10.3390/toxins8010029
Zhuang Z, Lohmar JM, Satterlee T, Cary JW, Calvo AM. The Master Transcription Factor mtfA Governs Aflatoxin Production, Morphological Development and Pathogenicity in the Fungus Aspergillus flavus. Toxins. 2016; 8(1):29. https://doi.org/10.3390/toxins8010029
Chicago/Turabian StyleZhuang, Zhenhong, Jessica M. Lohmar, Timothy Satterlee, Jeffrey W. Cary, and Ana M. Calvo. 2016. "The Master Transcription Factor mtfA Governs Aflatoxin Production, Morphological Development and Pathogenicity in the Fungus Aspergillus flavus" Toxins 8, no. 1: 29. https://doi.org/10.3390/toxins8010029
APA StyleZhuang, Z., Lohmar, J. M., Satterlee, T., Cary, J. W., & Calvo, A. M. (2016). The Master Transcription Factor mtfA Governs Aflatoxin Production, Morphological Development and Pathogenicity in the Fungus Aspergillus flavus. Toxins, 8(1), 29. https://doi.org/10.3390/toxins8010029