Orphan Toxin OrtT (YdcX) of Escherichia coli Reduces Growth during the Stringent Response
Abstract
:1. Introduction
2. Results
2.1. OrtT is a Proteic Toxin that Increases Persistence
2.2. OrtT Lyses Cells through Membrane Damage and Reduces ATP
2.3. OrtT is an Orphan Toxin
2.4. Physiological Relevance of Toxin OrtT
2.5. Regulation of ortT
Conditions | Strains | Fold Change of ortT Induction | Treatment Description |
---|---|---|---|
TMP treatment | BW25113 | 3.1 ± 1.5 | Exponentially-growing cells were treated with TMP (75 µg/mL) for 2 h. |
RelA production | BW25113/pCA24N BW25113/pCA24N-relA | 2.3 ± 0.6 | Exponentially-growing cells were treated with IPTG (1 mM) to induce RelA production for 2 h. |
MUP treatment | BW25113 | 4.61 ± 0.29 | Exponentially-growing cells were treated with MUP (100 µg/mL) for 2 h. |
SHX treatment | BW25113 | 89 ± 80 | Exponentially-growing cells were treated with SHX (1 mg/mL) for 2 h. |
Heat shock | BW25113 | 2.0 ± 0.2 | Exponentially-growing cells were shifted from 30 °C to 43 °C for 30 min. |
3. Discussion
4. Experimental Section
4.1. Bacterial Strains, Plasmids, and Growth Conditions
Strains | Genotype | Source |
---|---|---|
BW25113 | rrnB3 ΔlacZ4787 hsdR514 Δ(araBAD)567 Δ(rhaBAD)568 rph-1 | [59] |
BW25113 ∆ortT | BW25113 ΔortT Ω KmR | [59] |
BW25113 ∆ghoT ∆kan | BW25113 ΔghoT | [42] |
BW25113 ∆ortT ∆kan | BW25113 ΔortT | This study |
BW25113 ∆mqsR ∆mqsA ∆kan | BW25113 ∆mqsR ∆mqsA | [43] |
Plasmids | Genotype | Source |
pCA24N | CmR; lacIq | [60] |
pCA24N-ghoT | CmR; lacIq, PT5-lac::ghoT+ | [60] |
pCA24N-ortT | CmR; lacIq, PT5-lac::ortT+ | [60] |
pCA24N-relA | CmR; lacIq, PT5-lac::relA+ | [60] |
pCA24N-ortTACG | CmR; lacIq, PT5-lac::ortT+ with start codon ATG replaced with ACG | This study |
pCA24N-ortTF38R | CmR; lacIq, PT5-lac::ortT+ with TT changed to CG at nucleotide position 160-161 relative to the 6xHis-GhoT start codon | This study |
pCA24N-ghoTF38R | CmR; lacIq, pCA24N PT5-lac::ghoT+ with TT changed to CG at nucleotide position 160-161 relative to the 6xHis-GhoT start codon | [42] |
pCA24N-ortT-ydcY | CmR; lacIq, pCA24N PT5-lac::ortT+-ydcY+ | This study |
pCA24N-ortT-ghoS | CmR; lacIq, pCA24N PT5-lac::ortT+-ghoS+ | This study |
pCA24N-ortT-B | CmR; lacIq, pCA24N PT5-lac::ortT+ with the BamHI site in the N-terminus linker deleted. | This study |
pCP20 | ApR; CmR, FLP+, λ cI857+, λ pRRepts | [61] |
pBS(Kan) | KmR; cloning vector | [62] |
pBS(Kan)-mqsR | KmR; pBS(Kan) Plac::mqsR+ | [43] |
pBS(Kan)-mqsR-mqsA | KmR; pBS(Kan) Plac::mqsR+-mqsA+ | [43] |
Purpose/Name | Sequence (5' to 3') |
---|---|
Plasmid construction | |
ydcY-SalI-F | |
ydcY-HindIII-R | TTTTTTGTCGACAAGCTTAGACGCTCATTTTAATCAGAGGATGGTG |
ghoS-SalI-F | |
ghoS-HindIII-R | TTTTTTGTCGACAAGCTTCTTATCCTTCCTGGCTACTTGTAAAACTGAC |
UTR-F | TTTTTTGTCGACACAGTTCTACTGGAAACATTCATTTTTGC |
UTR-R | TTTTTTAAGCTTCAATTTGTGGCGCAATTTTACTTGTG |
Site-directed mutagenesis | |
ghoT-ACG-F | AAAGAGGAGAAATTAACTACGAGAGGATCTCACCAT |
ghoT-ACG-R | ATGGTGAGATCCTCTCGTAGTTAATTTCTCCTCTTT |
ortTF38R-F | TCCGTTTCTTAAGCGCCCGTCTGGTGGGGGCAAC |
ortTF38R-R | ATGTTGCCCCCACCAGACGGGCGCTTAAGAAACGGA |
ortT-ACG-Chrom-F | GACGCCCGTACACGTCTCTCTATCAACA |
ortT-ACG-Chrom-R | TGTTGATAGAGAGACGTGTACGGGCGTC |
BamHI-F | GAGGATCTCACCATCACCATCACCATACGGCCCTGAGGGCCTCTCTCTATCAACAC |
BamHI-R | GTGTTGATAGAGAGAGGCCCTCAGGGCCGTATGGTGATGGTGATGGTGAGATCCTC |
Verification of Kan insertion/removal | |
ortT-up-F | ATGGATAAGGGCAAGTTGCTGTTTGATG |
ortT-down-R | CCAATTTGTGGCGCAATTTTACTTGTG |
qRT-PCR | |
gyrA-F | GTCATGCCAACCAAAATTCCTAAC |
gyrA-R | TCATCATCAATATACGCCAGACAAC |
ortT-F | AATCGCATTTCTTATCACCTGG |
ortT-R | GAAACTCATCGGCCATGTTG |
4.2. Construction of pCA24N-ortT-ydcY, pCA24N-ortT-ghoS, and pCA24N-ortT-UTR
4.3. Genomic Library Construction
4.4. Site-Directed Mutagenesis
4.5. Toxicity Assay
4.6. Lysis Assay
4.7. TEM
4.8. ATP Assay
4.9. Persister Assay
4.10. Metabolism and Relevant Growth Assay
4.11. qRT-PCR
4.12. Additional Methods
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Hawser, S.; Lociuro, S.; Islam, K. Dihydrofolate reductase inhibitors as antibacterial agents. Biochem. Pharmacol. 2006, 71, 941–948. [Google Scholar] [CrossRef] [PubMed]
- Bermingham, A.; Derrick, J.P. The folic acid biosynthesis pathway in bacteria: Evaluation of potential for antibacterial drug discovery. Bioessays 2002, 24, 637–648. [Google Scholar] [CrossRef] [PubMed]
- Burman, L.G. The antimicrobial activities of trimethoprim and sulfonamides. Scand. J. Infect. Dis. 1986, 18, 3–13. [Google Scholar] [CrossRef] [PubMed]
- Schweitzer, B.I.; Dicker, A.P.; Bertino, J.R. Dihydrofolate reductase as a therapeutic target. FASEB J. 1990, 4, 2441–2452. [Google Scholar] [PubMed]
- Kwon, Y.K.; Higgins, M.B.; Rabinowitz, J.D. Antifolate-induced depletion of intracellular glycine and purines inhibits thymineless death in E. coli. ACS Chem. Biol. 2010, 5, 787–795. [Google Scholar] [CrossRef] [PubMed]
- Giladi, M.; Altman-Price, N.; Levin, I.; Levy, L.; Mevarech, M. FolM, a new chromosomally encoded dihydrofolate reductase in Escherichia coli. J. Bacteriol. 2003, 185, 7015–7018. [Google Scholar] [CrossRef] [PubMed]
- Dalebroux, Z.D.; Swanson, M.S. ppGpp: Magic beyond RNA polymerase. Nat. Rev. Microbiol. 2012, 10, 203–212. [Google Scholar] [CrossRef] [PubMed]
- Aizenman, E.; Engelberg-Kulka, H.; Glaser, G. An Escherichia coli chromosomal “addiction module” regulated by 3',5'-bispyrophosphate: A model for programmed bacterial cell death. Proc. Natl. Acad. Sci. USA 1996, 93, 6059–6063. [Google Scholar] [CrossRef] [PubMed]
- Korch, S.B.; Henderson, T.A.; Hill, T.M. Characterization of the hipA7 allele of Escherichia coli and evidence that high persistence is governed by (p)ppGpp synthesis. Mol. Microbiol. 2003, 50, 1199–1213. [Google Scholar] [CrossRef] [PubMed]
- Goeders, N.; van Melderen, L. Toxin-antitoxin systems as multilevel interaction systems. Toxins (Basel) 2014, 6, 304–324. [Google Scholar] [CrossRef]
- Van Melderen, L.; de Bast, M.S. Bacterial toxin-antitoxin systems: More than selfish entities? PLoS Genet. 2009, 5. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, Y.; Park, J.H.; Inouye, M. Toxin-antitoxin systems in bacteria and archaea. Annu. Rev. Genet. 2011, 45, 61–79. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Quiroga, C.; Chen, Q.; McAnulty, M.J.; Benedik, M.J.; Wood, T.K.; Wang, X. RalR (a DNase) and RalA (a small RNA) form a type I toxin-antitoxin system in Escherichia coli. Nucleic Acids Res. 2014. [Google Scholar] [CrossRef]
- Fozo, E.M.; Makarova, K.S.; Shabalina, S.A.; Yutin, N.; Koonin, E.V.; Storz, G. Abundance of type I toxin-antitoxin systems in bacteria: Searches for new candidates and discovery of novel families. Nucleic Acids Res. 2010, 38, 3743–3759. [Google Scholar] [CrossRef] [PubMed]
- Fineran, P.C.; Blower, T.R.; Foulds, I.J.; Humphreys, D.P.; Lilley, K.S.; Salmond, G.P.C. The phage abortive infection system, ToxIN, functions as a protein-RNA toxin-antitoxin pair. Proc. Natl. Acad. Sci. USA 2009, 106, 894–899. [Google Scholar] [CrossRef] [PubMed]
- Santos-Sierra, S.; Pardo-Abarrio, C.; Giraldo, R.; Diaz-Orejas, R. Genetic identification of two functional regions in the antitoxin of the parD killer system of plasmid R1. Fems Microbiol. Lett. 2002, 206, 115–119. [Google Scholar] [CrossRef] [PubMed]
- Masuda, H.; Tan, Q.; Awano, N.; Wu, K.P.; Inouye, M. YeeU enhances the bundling of cytoskeletal polymers of MreB and FtsZ, antagonizing the CbtA (YeeV) toxicity in Escherichia coli. Mol. Microbiol. 2012, 84, 979–989. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Lord, D.M.; Cheng, H.Y.; Osbourne, D.O.; Hong, S.H.; Sanchez-Torres, V.; Quiroga, C.; Zheng, K.; Herrmann, T.; Peti, W.; et al. A new type V toxin-antitoxin system where mRNA for toxin GhoT is cleaved by antitoxin GhoS. Nat. Chem. Biol. 2012, 8, 855–861. [Google Scholar] [CrossRef]
- Ogura, T.; Hiraga, S. Mini-F plasmid genes that couple host-cell division to plasmid proliferation. Proc. Natl. Acad. Sci. USA 1983, 80, 4784–4788. [Google Scholar] [CrossRef] [PubMed]
- Maisonneuve, E.; Shakespeare, L.J.; Jorgensen, M.G.; Gerdes, K. Bacterial persistence by RNA endonucleases. Proc. Natl. Acad. Sci. USA 2011, 108, 13206–13211. [Google Scholar] [CrossRef] [PubMed]
- Keren, I.; Shah, D.; Spoering, A.; Kaldalu, N.; Lewis, K. Specialized persister cells and the mechanism of multidrug tolerance in Escherichia coli. J. Bacteriol. 2004, 186, 8172–8180. [Google Scholar] [CrossRef] [PubMed]
- Pecota, D.C.; Wood, T.K. Exclusion of T4 phage by the hok/sok killer locus from plasmid R1. J. Bacteriol. 1996, 178, 2044–2050. [Google Scholar] [PubMed]
- Hazan, R.; Engelberg-Kulka, H. Escherichia coli mazEF-mediated cell death as a defense mechanism that inhibits the spread of phage P1. Mol. Genet. Genomics 2004, 272, 227–234. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Kim, Y.; Hong, S.H.; Ma, Q.; Brown, B.L.; Pu, M.M.; Tarone, A.M.; Benedik, M.J.; Peti, W.; Page, R.; et al. Antitoxin MqsA helps mediate the bacterial general stress response. Nat. Chem. Biol. 2011, 7, 359–366. [Google Scholar] [CrossRef]
- Hu, Y.; Benedik, M.J.; Wood, T.K. Antitoxin DinJ influences the general stress response through transcript stabilizer CspE. Environ. Microbiol. 2012, 14, 669–679. [Google Scholar] [CrossRef] [PubMed]
- Wood, T.K.; Knabel, S.J.; Kwan, B.W. Bacterial persister cell formation and dormancy. Appl. Environ. Microb. 2013, 79, 7116–7121. [Google Scholar] [CrossRef]
- Kim, Y.; Wood, T.K. Toxins Hha and CspD and small RNA regulator Hfq are involved in persister cell formation through MqsR in Escherichia coli. Biochem. Biophys. Res. Commun. 2010, 391, 209–213. [Google Scholar] [CrossRef] [PubMed]
- Dorr, T.; Vulic, M.; Lewis, K. Ciprofloxacin causes persister formation by inducing the TisB toxin in Escherichia coli. PLoS Biol. 2010, 8. [Google Scholar] [CrossRef] [PubMed]
- Shah, D.; Zhang, Z.G.; Khodursky, A.; Kaldalu, N.; Kurg, K.; Lewis, K. Persisters: A distinct physiological state of E. coli. BMC Microbiol. 2006, 6. [Google Scholar] [CrossRef] [PubMed]
- Kasari, V.; Mets, T.; Tenson, T.; Kaldalu, N. Transcriptional cross-activation between toxin-antitoxin systems of Escherichia coli. BMC Microbiol. 2013, 13. [Google Scholar] [CrossRef]
- Yang, M.; Gao, C.H.; Wang, Y.; Zhang, H.; He, Z.G. Characterization of the interaction and cross-regulation of three Mycobacterium tuberculosis RelBE modules. PLoS One 2010, 5. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Lord, D.M.; Hong, S.H.; Peti, W.; Benedik, M.J.; Page, R.; Wood, T.K. Type II toxin/antitoxin MqsR/MqsA controls type V toxin/antitoxin GhoT/GhoS. Environ. Microbiol. 2013, 15, 1734–1744. [Google Scholar] [CrossRef] [PubMed]
- De Bast, M.S.; Mine, N.; van Melderen, L. Chromosomal toxin-antitoxin systems may act as antiaddiction modules. J. Bacteriol. 2008, 190, 4603–4609. [Google Scholar] [CrossRef] [PubMed]
- Nariya, H.; Inouye, M. MazF, an mRNA interferase, mediates programmed cell death during multicellular Myxococcus development. Cell 2008, 132, 55–66. [Google Scholar] [CrossRef] [PubMed]
- Low, L.Y.; Yang, C.; Perego, M.; Osterman, A.; Liddington, R.C. Structure and lytic activity of a Bacillus anthracis prophage endolysin. J. Biol. Chem. 2005, 280, 35433–35439. [Google Scholar] [CrossRef] [PubMed]
- Ploeg, J.R.v.d. Characterization of Streptococcus gordonii prophage PH15: Complete genome sequence and functional analysis of phage-encoded integrase and endolysin. Microbiology 2008, 154, 2970–2978. [Google Scholar] [CrossRef] [PubMed]
- Zielenkiewicz, U.; Ceglowski, P. The toxin-antitoxin system of the Streptococcal plasmid pSM19035. J. Bacteriol. 2005, 187, 6094–6105. [Google Scholar] [CrossRef] [PubMed]
- Kwan, B.W.; Valenta, J.A.; Benedik, M.J.; Wood, T.K. Arrested protein synthesis increases persister-like cell formation. Antimicrob. Agents Chemother. 2013, 57, 1468–1473. [Google Scholar] [CrossRef] [PubMed]
- Kwan, B.W.; Osbourne, D.O.; Hu, Y.; Benedik, M.J.; Wood, T.K. Phosphodiesterase DosP increases persistence by reducing cAMP which reduces the signal indole. Biotechnol. Bioeng. 2014. [Google Scholar] [CrossRef]
- Apweiler, R.; Martin, M.J.; O’Donovan, C.; Magrane, M.; Alam-Faruque, Y.; Antunes, R.; Barrell, D.; Bely, B.; Bingley, M.; Binns, D.; et al. The Universal Protein Resource (UniProt) in 2010. Nucleic Acids Res. 2010, 38, D142–D148. [Google Scholar] [CrossRef] [PubMed]
- Kelley, L.A.; Sternberg, M.J.E. Protein structure prediction on the Web: A case study using the Phyre server. Nat. Protoc. 2009, 4, 363–371. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.Y.; Soo, V.W.; Islam, S.; McAnulty, M.J.; Benedik, M.J.; Wood, T.K. Toxin GhoT of the GhoT/GhoS TA system damages the cell membrane to reduce ATP and to reduce growth under stress. Environ. Microbiol. 2013, 16. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.; Wang, X.; Zhang, X.S.; Grigoriu, S.; Page, R.; Peti, W.; Wood, T.K. Escherichia coli toxin/antitoxin pair MqsR/MqsA regulate toxin CspD. Environ. Microbiol. 2010, 12, 1105–1121. [Google Scholar] [CrossRef] [PubMed]
- Hamilton, B.; Manzella, A.; Schmidt, K.; DiMarco, V.; Butler, J.S. Analysis of non-typeable Haemophilous influenzae VapC1 mutations reveals structural features required for toxicity and flexibility in the active site. PLoS One 2014, 9. [Google Scholar] [CrossRef] [PubMed]
- Nichols, R.J.; Sen, S.; Choo, Y.J.; Beltrao, P.; Zietek, M.; Chaba, R.; Lee, S.; Kazmierczak, K.M.; Lee, K.J.; Wong, A.; et al. Phenotypic landscape of a bacterial cell. Cell 2011, 144, 143–156. [Google Scholar] [CrossRef] [PubMed]
- Hitchings, G.H.; Burchall, J.J. Inhibition of folate biosynthesis and function as a basis for chemotherapy. Adv. Enzymol. Relat. Areas Mol. Biol. 1965, 27, 417–468. [Google Scholar] [PubMed]
- Hoffbrand, A.V.; Jackson, B.F. Correction of the DNA synthesis defect in vitamin B12 deficiency by tetrahydrofolate: Evidence in favour of the methyl-folate trap hypothesis as the cause of megaloblastic anaemia in vitamin B12 deficiency. Br. J. Haematol. 1993, 83, 643–647. [Google Scholar] [CrossRef] [PubMed]
- Brogden, R.N.; Carmine, A.A.; Heel, R.C.; Speight, T.M.; Avery, G.S. Trimethoprim-a review of its antibacterial activity, pharmacokinetics and therapeutic use in urinary-tract Infections. Drugs 1982, 23, 405–430. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.R.; Yamazaki, H. Trimethoprim-induced accumulation of guanosine tetraphosphate (ppGpp) in Escherichia coli. Biochem. Biophys. Res. Commun. 1972, 48, 169–174. [Google Scholar] [CrossRef] [PubMed]
- Schreiber, G.; Metzger, S.; Aizenman, E.; Roza, S.; Cashel, M.; Glaser, G. Overexpression of the relA gene in Escherichia coli. J. Biol. Chem. 1991, 266, 3760–3767. [Google Scholar] [PubMed]
- Cassels, R.; Oliva, B.; Knowles, D. Occurrence of the regulatory nucleotides ppGpp and pppGpp following induction of the stringent response in Staphylococci. J. Bacteriol. 1995, 177, 5161–5165. [Google Scholar] [PubMed]
- Durfee, T.; Hansen, A.M.; Zhi, H.; Blattner, F.R.; Jin, D.J. Transcription profiling of the stringent response in Escherichia coli. J. Bacteriol. 2008, 190, 1084–1096. [Google Scholar] [CrossRef] [PubMed]
- Costanzo, A.; Ades, S.E. Growth phase-dependent regulation of the extracytoplasmic stress factor, sigma(E) by guanosine 3',5'-bispyrophosphate (ppGpp). J. Bacteriol. 2006, 188, 4627–4634. [Google Scholar] [CrossRef] [PubMed]
- Penas, A.D.; Connolly, L.; Gross, C.A. Sigma(E) is an essential sigma factor in Escherichia coli. J. Bacteriol. 1997, 179, 6862–6864. [Google Scholar] [PubMed]
- Ades, S.E.; Grigorova, I.L.; Gross, C.A. Regulation of the alternative sigma factor sigma(E) during initiation, adaptation, and shutoff of the extracytoplasmic heat shock response in Escherichia coli. J. Bacteriol. 2003, 185, 2512–2519. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, Y.; Park, J.H.; Inouye, M. MqsR, a crucial regulator for quorum sensing and biofilm formation, is a GCU-specific mRNA interferase in Escherichia coli. J. Biol. Chem. 2009, 284, 28746–28753. [Google Scholar] [CrossRef] [PubMed]
- Inoue, T.; Shingaki, R.; Hirose, S.; Waki, K.; Mori, H.; Fukui, K. Genome-wide screening of genes required for swarming motility in Escherichia coli K-12. J. Bacteriol. 2007, 189, 950–957. [Google Scholar] [CrossRef] [PubMed]
- Sambrook, J.F.E.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
- Baba, T.; Ara, T.; Hasegawa, M.; Takai, Y.; Okumura, Y.; Baba, M.; Datsenko, K.A.; Tomita, M.; Wanner, B.L.; Mori, H. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: The Keio collection. Mol. Syst. Biol. 2006, 2. [Google Scholar] [CrossRef]
- Kitagawa, M.; Ara, T.; Arifuzzaman, M.; Ioka-Nakamichi, T.; Inamoto, E.; Toyonaga, H.; Mori, H. Complete set of ORF clones of Escherichia coli ASKA library (A complete Set of E. coli K-12 ORF archive): Unique resources for biological research. DNA Res. 2005, 12, 291–299. [Google Scholar] [CrossRef] [PubMed]
- Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [PubMed]
- Canada, K.A.; Iwashita, S.; Shim, H.; Wood, T.K. Directed evolution of toluene ortho-monooxygenase for enhanced 1-naphthol synthesis and chlorinated ethene degradation. J. Bacteriol. 2002, 184, 344–349. [Google Scholar] [CrossRef] [PubMed]
- Donegan, K.; Matyac, C.; Seidler, R.; Porteous, A. Evaluation of methods for sampling, recovery, and enumeration of bacteria applied to the phylloplane. Appl. Environ. Microb. 1991, 57, 51–56. [Google Scholar]
- Zhou, L.; Lei, X.H.; Bochner, B.R.; Wanner, B.L. Phenotype microarray analysis of Escherichia coli K-12 mutants with deletions of all two-component systems. J. Bacteriol. 2003, 185, 4956–4972. [Google Scholar] [CrossRef] [PubMed]
- Soo, V.W.; Wood, T.K. Antitoxin MqsA represses curli formation through the master biofilm regulator CsgD. Sci. Rep. 2013, 3. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29. [Google Scholar] [CrossRef] [PubMed]
- Makarova, K.S.; Wolf, Y.I.; Koonin, E.V. Comprehensive comparative-genomic analysis of type 2 toxin-antitoxin systems and related mobile stress response systems in prokaryotes. Biol. Direct 2009, 4. [Google Scholar] [CrossRef]
- Sevin, E.W.; Barloy-Hubler, F. RASTA-Bacteria: A web-based tool for identifying toxin-antitoxin loci in prokaryotes. Genome Biol. 2007, 8. [Google Scholar] [CrossRef] [PubMed]
- Pandey, D.P.; Gerdes, K. Toxin-antitoxin loci are highly abundant in free-living but lost from host-associated prokaryotes. Nucleic Acids Res. 2005, 33, 966–976. [Google Scholar] [CrossRef] [PubMed]
- Schagger, H. Tricine-SDS-PAGE. Nat. Protoc. 2006, 1, 16–22. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Islam, S.; Benedik, M.J.; Wood, T.K. Orphan Toxin OrtT (YdcX) of Escherichia coli Reduces Growth during the Stringent Response. Toxins 2015, 7, 299-321. https://doi.org/10.3390/toxins7020299
Islam S, Benedik MJ, Wood TK. Orphan Toxin OrtT (YdcX) of Escherichia coli Reduces Growth during the Stringent Response. Toxins. 2015; 7(2):299-321. https://doi.org/10.3390/toxins7020299
Chicago/Turabian StyleIslam, Sabina, Michael J. Benedik, and Thomas K. Wood. 2015. "Orphan Toxin OrtT (YdcX) of Escherichia coli Reduces Growth during the Stringent Response" Toxins 7, no. 2: 299-321. https://doi.org/10.3390/toxins7020299
APA StyleIslam, S., Benedik, M. J., & Wood, T. K. (2015). Orphan Toxin OrtT (YdcX) of Escherichia coli Reduces Growth during the Stringent Response. Toxins, 7(2), 299-321. https://doi.org/10.3390/toxins7020299