Next Article in Journal
Dog Poisonings Associated with a Microcystis aeruginosa Bloom in the Netherlands
Previous Article in Journal
Safety of Botulinum Toxin A in Children and Adolescents with Cerebral Palsy in a Pragmatic Setting
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Sequence Divergence of the Enniatin Synthase Gene in Relation to Production of Beauvericin and Enniatins in Fusarium Species

by
Łukasz Stępień
1,* and
Agnieszka Waśkiewicz
2
1
Institute of Plant Genetics, Polish Academy of Sciences, Strzeszyńska 34, Poznań 60-479, Poland
2
Department of Chemistry, Poznan University of Life Sciences, Wojska Polskiego 75, Poznań 60-625, Poland
*
Author to whom correspondence should be addressed.
Toxins 2013, 5(3), 537-555; https://doi.org/10.3390/toxins5030537
Submission received: 2 January 2013 / Revised: 25 February 2013 / Accepted: 5 March 2013 / Published: 13 March 2013

Abstract

Beauvericin (BEA) and enniatins (ENNs) are cyclic peptide mycotoxins produced by a wide range of fungal species, including pathogenic Fusaria. Amounts of BEA and ENNs were quantified in individual rice cultures of 58 Fusarium strains belonging to 20 species, originating from different host plant species and different geographical localities. The species identification of all strains was done on the basis of the tef-1α gene sequence. The main aim of this study was to analyze the variability of the esyn1 gene encoding the enniatin synthase, the essential enzyme of this metabolic pathway, among the BEA- and ENNs-producing genotypes. The phylogenetic analysis based on the partial sequence of the esyn1 gene clearly discriminates species producing exclusively BEA from those synthesizing mainly enniatin analogues.

1. Introduction

The fact that Fusaria are one of the most versatile mycotoxin producers is caused both by the wide range of species and the abilities of simultaneous biosynthesis of multiple metabolites from different metabolic pathways. The coincidence of trichothecenes and zearalenone produced by F. graminearum and F. culmorum, as well as fumonisins, beauvericin and moniliformin by F. proliferatum are primary examples [1,2]. The versatility of the Fusaria is frequently reflected by contamination of food and feed products with multiple mycotoxins [3,4,5].
Beauvericin (BEA), as well as a number of enniatin analogues: A, A1, A2, B, B1, B2 and B4 (ENNs)—belong to the cyclic hexadepsipeptide mycotoxins synthesized by numerous pathogenic fungi that are considered as a group of the emerging Fusarium mycotoxins. The spectral characteristics of those metabolites were revealed [6], and their molecular structures and toxicities were summarized by Jestoi [7]. In beauvericin, the three amino acid residues are aromatic N-methyl-phenylalanines, whereas in the enniatins of type A and B, the amino acid residues are aliphatic N-methyl-valine or -isoleucine or mixtures of these two (Figure 1; [8]). BEA and ENNs can be produced efficiently by strains of numerous Fusarium species in vitro and in planta [9,10,11,12,13,14,15].
Figure 1. Chemical structures of (A) enniatins and (B) beauvericin.
Figure 1. Chemical structures of (A) enniatins and (B) beauvericin.
The extent of human, animal and plant exposure to these mycotoxins has not been well established. The primary toxic action of BEA and ENNs is related to their ionophoric properties that disturb the physiological ionic balance and pH by forming dimeric structures transporting monovalent ions across the cell membranes [16,17]. Beauvericin is toxic to several human cell lines and can induce apoptosis and DNA fragmentation [18,19,20]. Moreover, in experimental animals, BEA exerted a negative inotropic effect (decrease in cardiac contraction strength), as well as a negative chronotropic effect (decrease in frequency of cardiac spontaneous beating activity) [21]. Investigation of the Fusarium genus showed that various species produced BEA, including some strains of F. oxysporum isolated from maize, pineapple and melon [22,23], F. subglutinans isolated from maize ears [24], F. verticillioides from pineapple [25] and F. proliferatum from maize, garlic and asparagus [26].
Enniatins are of high interest, because of their wide range of biological activity [27,28]. This bioactivity has long been assumed to be associated with their ionophoric properties [29]. ENNs inhibit the enzyme, acyl-CoA:cholesterol acyl transferase (ACAT) [30]. In cancer-related studies, enniatins were found to induce apoptosis and disrupt extracellular-regulated protein kinase associated with cell proliferation [31,32]. They are also known as phytotoxins and are associated with plant diseases characterized by wilt and necrosis [33].
The enniatin synthase gene (esyn1) has been proven to be the crucial one in the metabolic pathway of enniatin synthesis [34,35]. Moreover, a genomic locus containing a beauvericin biosynthetic gene cluster in the entomopathogenic fungus, Beauveria bassiana, has been cloned. Consequently, significant sequence homologies to certain Fusarium enzymes were found [36]. Recently, the homologous cluster from F. proliferatum was sequenced, and the gene encoding ketoisovalerate reductase—an enzyme controlling the initial step of the pathway—was characterized [37].
Some Fusarium species (like F. poae) have been reported to produce enniatins and beauvericin simultaneously [38], which is well justified by the fact that both mycotoxins share a common metabolic pathway. The co-occurrence of ENNs and BEA in field samples infected by Fusarium spp. has been observed [19,39]. There is a strong possibility that BEA and ENNs producers can be differentiated on the basis of the esyn1 sequence [12]. Similar approaches based on genes from respective clusters (i.e., TRI, ZEA and FUM) have been successfully applied to detect and characterize the chemotypes and populations of the potential producers of trichothecenes, zearalenone and fumonisins [35,40,41,42,43,44]. Therefore, the main objective of the present study was to examine the relation between the sequence variability inside the esyn1 gene and the composition of the toxic cyclic peptides synthesized.
The specific aims of this work were: (i) to examine the amounts of enniatins and beauvericin produced by the strains of various Fusarium species, (ii) to compare the phylogenetic relationships among the species revealed by the tef-1α sequence analysis to those reconstructed on the basis of the enniatin synthase gene, and (iii) to analyze the sequence variants of the esyn1 gene coding regions among the strains studied in relation to the ratio between BEA and ENNs synthesized.

2. Results and Discussion

2.1. Fusarium Species Identification

Fifty-eight Fusarium strains belonging to 20 species stored at the KF Collection, Institute of Plant Genetics, Polish Academy of Sciences, Poznań, Poland, were used in the study. They represented both soil saprophytes as well as plant pathogens originating from 15 host species (Table 1). Most of the crop species are agriculturally important, regardless of the climatic conditions. Thus, the cosmopolitism of Fusarium pathogens and their ability to colonize a wide range of hosts is consistent with the isolates used in this study.
Species identification was confirmed by the analysis based on the BLASTn comparison of the tef-1α gene sequences with the accessions deposited in the NCBI GenBank database. One strain of F. sporotrichioides (KF 3713) failed to amplify the marker fragment of the tef-1α gene. In this case, β-tubulin sequencing was the basis of the species identification (results not shown). All species were proven to have been identified correctly, showing the highest similarity level to the GenBank accessions belonging to the corresponding taxa, though strains of species, like F. fujikuroi, F. proliferatum and F. temperatum, appeared to be very closely related. Based on the obtained tef-1α sequences, a maximum parsimony dendrogram was calculated in order to show the level of the divergence among the genotypes. Additionally, the sequences of F. solani, Aspergillus niger and Beauveria bassiana were included in the analysis (Figure 2).
Table 1. Fusarium isolates used in the study, host plant species, year of isolation and geographical origin.
Table 1. Fusarium isolates used in the study, host plant species, year of isolation and geographical origin.
StrainSpeciesHostYear of isolationOrigin
KF 3713F. acuminatumPisum sativum2012Poland
KF 3557F. ananatumAnanas comosus2011Costa Rica
KF 3756F. ananatumAnanas comosus2011Costa Rica
KF 461F. anthophilumPlantago lanceolata USA
KF 1337F. avenaceumTriticum aestivum1987Poland
KF 3585F. avenaceumAllium cepa Italy
KF 3586F. avenaceumLycopersicon esculentum2011Poland
KF 3719F. avenaceumPisum sativum2012Poland
KF 3718F. avenaceumPisum sativum2012Poland
KF 3717F. avenaceumPisum sativum2012Poland
KF 2805F. avenaceumTriticum aestivum2009Poland
KF 3704F. avenaceumZea mays2011Poland
KF 3716F. avenaceumPisum sativum2012Poland
KF 3390F. avenaceumZea mays2009Poland
KF 3715F. avenaceumPisum sativum2012Poland
KF 3755F. concentricumAnanas comosus2011Costa Rica
KF 3536F. concentricumAnanas comosus2010Costa Rica
KF 3406F. concentricumAnanas comosus2009Costa Rica
KF 430F. dlaminiisoil RSA
KF 3751F. equisetiLycopersicon esculentum2012Poland
KF 3749F. equisetiLycopersicon esculentum2012Poland
KF 3430F. equisetiMusa sapientum2010Ecuador
KF 3563F. equisetiAsparagus officinalis2011Poland
KF 3631F. fujikuroiOryza sativa2011Thailand
KF 3583F. fujikuroiOryza sativa2011Italy
KF 3588F. lactisCapsicum annuum2011Poland
KF 3641F. lactisCapsicum annuum2011Poland
KF 3640F. lactisCapsicum annuum2011Poland
KF 337F. nygamaiCajanus indicus India
KF 434F. nygamaisoil Australia
KF 3561F. oxysporumAllium sativum2011Poland
KF 3567F. oxysporumAllium sativum2011Poland
KF 3565F. oxysporumAsparagus officinalis2011Poland
KF 1400F. poaeZea mays1990Poland
KF 2576F. poaeZea mays1999Poland
KF 3564F. polyphialidicumAnanas comosus2011Costa Rica
KF 3560F. proliferatumRheum rhabarbarum2011Poland
KF 3442F. proliferatumZea mays2006Poland
KF 3657F. proliferatumAnanas comosus2011Indonesia
KF 3566F. proliferatumOryza sativa2011Thailand
KF 3439F. proliferatumAnanas comosus2010Ecuador
KF 496F. proliferatumZea mays1983Italy
KF 3363F. proliferatumAllium sativum2009Poland
KF 3382F. proliferatumAnanas comosus2009Hawaii
KF 3584F. proliferatumOryza sativa2011Thailand
KF 3558F. proliferatumAsparagus officinalis2011Poland
KF 3654F. proliferatumZea mays2011Poland
KF 3754F. solaniLycopersicon esculentum2012Poland
KF 3700F. sporotrichioidesAsparagus officinalis2012Poland
KF 3728F. sporotrichioidesPisum sativum2012Poland
KF 3702F. subglutinansCambria sp.2012Poland
KF 534F. temperatumZea mays1985Poland
KF 506F. temperatumZea mays1985Poland
KF 1214,2F. temperatumZea mays1987Poland
KF 3321F. temperatumAnanas comosus2008Costa Rica
KF 3667F. temperatumZea mays Belgium
KF 3701F. tricinctumAsparagus officinalis2012Poland
KF 393F. verticillioidesZea mays USA
Figure 2. The most parsimonious tree for 57 Fusarium strains of 20 species used in the study, based on the translation elongation factor 1α (tef-1α) sequences. F. solani, B. bassiana (GenBank: JX495612.1) and A. niger (GenBank Acc. NT166526.1) sequences were included as the reference, as well as for outgrouping. The maximum parsimony approach and bootstrap test (1000 replicates) were applied.
Figure 2. The most parsimonious tree for 57 Fusarium strains of 20 species used in the study, based on the translation elongation factor 1α (tef-1α) sequences. F. solani, B. bassiana (GenBank: JX495612.1) and A. niger (GenBank Acc. NT166526.1) sequences were included as the reference, as well as for outgrouping. The maximum parsimony approach and bootstrap test (1000 replicates) were applied.

2.2. Method Validation and Recovery

Table 2 summarizes the linearity, limits of detection (LOD) and limits of quantification (LOQ) for enniatins and beauvericin. The linearity of the standard curves at three determinations of six concentration levels was reliable between 0.9976 and 0.9995. LOQ was calculated as three-fold LOD.
Table 2. Linearity (R2), limit of detection (LOD) and quantification (LOQ) (ng g−1) for mycotoxins.
Table 2. Linearity (R2), limit of detection (LOD) and quantification (LOQ) (ng g−1) for mycotoxins.
MycotoxinR2 aLOD b (ng g−1)LOQ c (ng g−1)
Enniatin A0.999110.030.0
Enniatin A10.997610.030.0
Enniatin B0.99938.024.0
Enniatin B10.99918.024.0
Beauvericin0.999515.045.0
a Regression coefficient; b Limit of detection (LOD); c Limit of quantification (LOQ).
Recovery rates and standard deviations were calculated at three concentration levels for black rice samples (Table 3). When analyzed mycotoxins were added to black rice within the range of concentrations from 5 to 60 ng g−1, the recovery rates were 92.8%–95.1%, 85.7%–90.2%, 94.3%–97.1%, 89.8%–91.4% and 98.3%–101.4% for ENNs: A, A1, B, B1 and BEA, respectively.
Table 3. Recovery of enniatins and beauvericin added to rice samples.
Table 3. Recovery of enniatins and beauvericin added to rice samples.
MycotoxinQuantity added (ng g−1)Mean recovery (%)Relative standard deviation (%)
Enniatin A592.85.5
2095.14.8
6094.75.9
Enniatin A1588.66.7
2090.25.9
6085.77.3
Enniatin B595.26.8
2097.15.5
6094.36.3
Enniatin B1589.84.3
2091.45.0
6091.26.8
Beauvericin599.65.6
20101.44.9
6098.35.4

2.3. In Vitro Mycotoxin Biosynthesis

Amounts of enniatins and beauvericin produced by the strains of 20 Fusarium species were measured using the HPLC method. The results are summarized in Table 4.
Table 4. Mean concentration levels with standard deviations of beauvericin and enniatins (A, A1, B, B1) (in μg g−1) produced in vitro by Fusarium strains of 20 species.
Table 4. Mean concentration levels with standard deviations of beauvericin and enniatins (A, A1, B, B1) (in μg g−1) produced in vitro by Fusarium strains of 20 species.
StrainSpeciesBEA (μg g−1)ENN A (μg g−1)ENN A1 (μg g−1)ENN B (μg g−1)ENN B1 (μg g−1)
KF 3713F. acuminatum5.31 ± 0.7719.62 ± 2.8126.92 ± 1.9790.89 ± 7.5431.49 ± 5.90
KF 3557F. ananatum27.68 ± 1.886.94 ± 0.42ND8.81 ± 0.7327.60 ± 2.25
KF 3756F. ananatum39.57 ± 2.6311.18 ± 1.29NDND27.07 ± 1.92
KF 461F. anthophilum141.97 ± 10.677.11 ± 0.53ND6.17 ± 0.6312.14 ± 0.85
KF 1337F. avenaceumND34.55 ± 4.1871.90 ± 10.43895.46 ± 55.48452.46 ± 30.33
KF 3718F. avenaceumNDNDND7.97 ± 0.5415.99 ± 0.95
KF 3717F. avenaceumND6.09 ± 0.885.65 ± 2.336.71 ± 0.7211.46 ± 0.93
KF 2805F. avenaceumNDND25.56 ± 4.1940.09 ± 2.2141.49 ± 5.32
KF 3704F. avenaceumNDNDND10.80 ± 0.87117.77 ± 9.86
KF 3716F. avenaceumND12.67 ± 2.06ND5.99 ± 0.5118.15 ± 2.00
KF 3390F. avenaceumND29.12 ± 3.2132.40 ± 2.08255.08 ± 18.76138.15 ± 10.14
KF 3715F. avenaceumND8.99 ± 1.42ND194.90 ± 20.2227.21 ± 2.17
KF 3755F. concentricum312.20 ± 28.0911.40 ± 1.888.69 ± 0.7517.33 ± 1.0918.17 ± 1.44
KF 3536F. concentricum1928.83 ± 60.77ND41.36 ± 5.3339.44 ± 1.8828.58 ± 2.09
KF 3406F. concentricum0.42 ± 0.02NDNDND6.98 ± 0.54
KF 430F. dlaminiiND6.92 ± 5.416.28 ± 0.71ND7.61 ± 1.13
KF 3751F. equisetiNDND6.94 ± 1.19ND7.66 ± 4.62
KF 3749F. equisetiND39.27 ± 2.1438.18 ± 2.01ND29.22 ± 3.22
KF 3430F. equisetiND31.17 ± 2.8132.15 ± 1.4232.98 ± 2.6341.22 ± 2.31
KF 3563F. equisetiND43.47 ± 3.7636.81 ± 2.8829.18 ± 2.1430.39 ± 1.54
KF 3631F. fujikuroi428.09 ± 23.61NDNDNDND
KF 3583F. fujikuroi5.60 ± 0.27NDNDNDND
KF 3588F. lactisNDND10.57 ± 1.029.59 ± 1.0732.43 ± 4.55
KF 3641F. lactisND30.97 ± 1.9726.94 ± 4.61NDND
KF 3640F. lactisNDND30.53 ± 3.3227.63 ± 1.88ND
KF 337F. nygamai22.86 ± 2.6610.45 ± 1.58ND9.50 ± 0.84ND
KF 434F. nygamai18.33 ± 1.098.15 ± 1.035.21 ± 0.328.69 ± 1.05ND
KF 3561F. oxysporum46.12 ± 5.87NDNDNDND
KF 3567F. oxysporum80.03 ± 10.23ND6.42 ± 0.668.25 ± 1.117.28 ± 0.32
KF 3565F. oxysporum20.06 ± 2.66NDNDNDND
KF 1400F. poae394.67 ± 25.87NDNDNDND
KF 2576F. poae37.53 ± 4.8734.31 ± 2.5726.89 ± 2.1828.71 ± 3.45ND
KF 3564F. polyphialidicumNDNDNDNDND
KF 3560F. proliferatum149.67 ± 10.33NDNDNDND
KF 3442F. proliferatum52.01 ± 3.68NDNDNDND
KF 3657F. proliferatum74.08 ± 5.14NDNDNDND
KF 3566F. proliferatum90.85 ± 10.21NDNDNDND
KF 3439F. proliferatum8.61 ± 0.99NDNDNDND
KF 496F. proliferatumNDND5.48 ± 0.779.61 ± 1.0612.89 ± 2.11
KF 3363F. proliferatum45.13 ± 5.56NDNDNDND
KF 3382F. proliferatum3.39 ± 0.35NDNDNDND
KF 3584F. proliferatum291.87 ± 32.65ND6.39 ± 0.3212.92 ± 2.1719.64 ± 1.18
KF 3558F. proliferatum78.07 ± 9.47ND5.82 ± 0.657.91 ± 0.9210.27 ± 1.32
KF 3654F. proliferatum76.39 ± 10.15NDND8.26 ± 0.316.84 ± 0.87
KF 3754F. solaniNDNDNDNDND
KF 3700F. sporotrichioides8.33 ± 1.11NDNDNDND
KF 3728F. sporotrichioides5.13 ± 0.3712.67 ± 3.76ND5.99 ± 0.7618.15 ± 3.06
KF 3702F. subglutinans13.05 ± 2.0920.33 ± 2.88ND10.74 ± 2.0829.50 ± 4.17
KF 534F. temperatum18.22 ± 3.4417.65 ± 1.05NDNDND
KF 506F. temperatum17.47 ± 2.21NDND15.17 ± 2.229.88 ± 1.22
KF 1214,2F. temperatum4.47 ± 0.59NDND6.83 ± 1.218.10 ± 0.93
KF 3321F. temperatum290.97 ± 18.6227.79 ± 3.4634.39 ± 2.8039.20 ± 5.0729.21 ± 2.80
KF 3667F. temperatum11.40 ± 0.98NDNDNDND
KF 3701F. tricinctum1.09 ± 0.29ND30.49 ± 4.1568.55 ± 5.4221.74 ± 2.56
KF 393F. verticillioides2.34 ± 0.53NDND8.75 ± 1.8512.43 ± 3.41
ND—not detected.
Not surprisingly, the most efficient ENNs producers were found among F. avenaceum strains, and BEA was synthesized mostly by F. concentricum, F. oxysporum, F. proliferatum, F. fujikuroi and F. poae strains. There were only a few species producing exclusively BEA (F. fujikuroi, F. proliferatum, F. oxysporum) and ENNs (F. avenaceum, F. equiseti, F. lactis). The majority of the strains synthesized a mixture of BEA and ENNs (Table 4). Only F. polyphialidicum and F. solani did not make these mycotoxins. One of the most interesting strains was F. temperatum KF 3321, which produced remarkable amounts of BEA and ENNs, although BEA was about eight-fold lower than in the F. concentricum isolate, KF 3536.

2.4. Enniatin Synthase (esyn1) Gene Divergence

PCR products representing two different regions of the enniatin synthase gene, obtained for the majority of the analyzed strains using Esyn1/Esyn2 and beas_1/beas_2 primers, respectively, were sequenced and analyzed. Both regions are located more than 6.5 kbp apart (based on the F. proliferatum cluster sequence GenBank ID: JF8266561.1). Regardless of the ENNs/BEA biosynthesis abilities, it was not possible to obtain the marker fragments for some of the strains studied. Namely, F. ananatum, F. anthophilum, F. dlaminii, F. nygamai, F. subglutinans and F. verticillioides genotypes did not amplify the specific marker fragment using Esyn_1/Esyn_2 and ES_Bea_F/ES_Bea_R primers (Figure 3). Nevertheless, all of the strains amplified the other gene fragment using beas_1/beas_2 primers, and the PCR products were sequenced and analyzed (Figure 4). Moreover, for the F. nygamai KF 337 strain, another region of the coding sequence (different from the two covered by the study) was amplified and sequenced. It showed about 80% of nucleotides identical when comparing to B. bassiana, F. oxysporum and F. scirpi and as much as 89% of identical bases in comparison to F. proliferatum sequence (data not shown). For some strain/marker combinations, such as the case of F. lactis (KF 3640), F. polyphialidicum (KF 3564) and F. concentricum (KF 3406) strains, the efficiencies of fluorescent labeling had been significantly lower, which resulted in shorter reads than the remaining sequences aligned. Therefore, these sequences were excluded from the analysis. Finally, no amplification was observed for strains of F. equiseti, F. solani and F. sporotrichioides.
Figure 3. The most parsimonious tree created for a partial enniatin synthase (esyn1) gene sequence obtained with Esyn1/Esyn2 or ES_Bea_F/ES_Bea_R primers from 31 strains of eleven Fusarium species. GenBank sequences of esyn1 from F. scirpi GenBank ID: Z18755.3, F. oxysporum GenBank ID: GU294760.1, F. proliferatum GenBank ID: JF8266561.1 and B. bassiana GenBank ID: EU886196.1 were included in the analysis. The maximum parsimony approach and bootstrap test were applied (1,000 replicates). “B”, “E”—major—and “b”, “e”—minor—BEA and ENN producers, respectively; N—non-producer.
Figure 3. The most parsimonious tree created for a partial enniatin synthase (esyn1) gene sequence obtained with Esyn1/Esyn2 or ES_Bea_F/ES_Bea_R primers from 31 strains of eleven Fusarium species. GenBank sequences of esyn1 from F. scirpi GenBank ID: Z18755.3, F. oxysporum GenBank ID: GU294760.1, F. proliferatum GenBank ID: JF8266561.1 and B. bassiana GenBank ID: EU886196.1 were included in the analysis. The maximum parsimony approach and bootstrap test were applied (1,000 replicates). “B”, “E”—major—and “b”, “e”—minor—BEA and ENN producers, respectively; N—non-producer.
Figure 4. The most parsimonious tree created for a partial enniatin synthase (esyn1) gene sequences obtained with beas_1/beas_2 primers from 40 strains of 16 Fusarium species. GenBank esyn1 sequences of F. scirpi GenBank ID: Z18755.3, F. oxysporum GenBank ID: GU294760.1, F. proliferatum GenBank ID: JF8266561.1 and B. bassiana GenBank ID: EU886196.1 were included in the analysis. The maximum parsimony approach and bootstrap test were applied (1000 replicates). “B”, “E”—major—and “b”, “e”—minor—BEA and ENN producers, respectively.
Figure 4. The most parsimonious tree created for a partial enniatin synthase (esyn1) gene sequences obtained with beas_1/beas_2 primers from 40 strains of 16 Fusarium species. GenBank esyn1 sequences of F. scirpi GenBank ID: Z18755.3, F. oxysporum GenBank ID: GU294760.1, F. proliferatum GenBank ID: JF8266561.1 and B. bassiana GenBank ID: EU886196.1 were included in the analysis. The maximum parsimony approach and bootstrap test were applied (1000 replicates). “B”, “E”—major—and “b”, “e”—minor—BEA and ENN producers, respectively.
Independent dendrograms were calculated for the enniatin synthase (esyn1) fragments obtained with the Esyn/ES_Bea pairs, as well as using the beas_1/2 primers in various genotypes of enniatin- and beauvericin-producers (Figure 3, Figure 4).
Fusarium species, being one of the major pathogens of crop plants worldwide, are considered as producers of some of the most dangerous and harmful mycotoxins present in food and feed. Apart from trichothecenes, fumonisins and zearalenone, cyclic oligopeptides (i.e., beauvericin and enniatins) emerge as a group of toxins commonly present in food products [7], occasionally accumulating in high amounts [12].
In the present study, fifty-eight collection strains of 20 Fusarium species, representing mainly plant pathogens, but also plant and soil saprophytes, were included. The wide range of hosts and geographical origins proved again the cosmopolitism of the genus. The analysis of the tef-1α gene sequences allowed for the discrimination of the species boundaries (Figure 2). This particular gene has been widely and successfully used in phylogenetic studies of Fusarium species [45,46,47,48,49,50]; however, the use of the tef-1α gene in the studies of a single species genotype variation was limited and often amended by the analysis of different loci [51,52,53]. In the present study, it was possible to differentiate the closely related species, especially belonging to the G. fujikuroi species complex and the group of F. avenaceum/F. acuminatum/F. tricinctum species. However, as the resolution of the tef-1α-based analyses is often limited to the species level, the mycotoxin biosynthetic genes have become versatile and promising tools for analyses aimed at revealing the intraspecific polymorphism [42,43,44,54,55].
Therefore, it is justifiable for the enniatin synthase gene (esyn1) to have raised significant interest in recent phylogenetic studies of F. avenaceum and F. poae [12,56]. Both species have been reported to produce ENNs [7,38]. Recently, BEA-producing species have also been identified by cloning and characterization of the respective biosynthetic genes in B. bassiana [36] and F. proliferatum. Unfortunately, only a few reports are available on the structure of the gene cluster in other BEA producers [37].

2.5. Toxin Biosynthesis in Relation to the esyn1 Gene Divergence

In the present study, two different regions of the enniatin synthase gene were amplified and analyzed (Figure 3, Figure 4). Both regions are located more than 6.5 kbp apart (based on the F. proliferatum cluster sequence GenBank ID: JF8266561.1). The analysis revealed a higher level of polymorphism of Fusarium strains than that recorded by the tef-1α sequence analysis. However, it was not possible to compare precisely the divergence levels presented by the analyses of both regions. This inconvenience was caused by the significantly lower selectivity of the beas_1/beas_2 primers, which amplified marker fragments from strains of 16 species, while the Esyn1/2 primers were designed and validated only for enniatin-producing F. avenaceum and F. tricinctum genotypes. Subsequently, the ES_Bea1/2 primers were designed to amplify the corresponding esyn1 fragment from BEA producers. Eventually, it was possible to obtain the sequences of the strains belonging to 11 species (Figure 3). Since the esyn1-based phylogenetic analysis shows clearly “BEA” and “ENN” clades of species and, on the other hand, the majority of the strains produced a mixture of BEA and ENNs, a hypothesis could be drawn that the end-product of the cluster’s activity can possibly undergo some modifications by non-cluster mechanisms.

3. Experimental Section

3.1. Fusarium Strains

Fifty-eight Fusarium strains were used in the study (Table 1). All strains are stored at the KF Fusarium collection (Institute of Plant Genetics, Polish Academy of Sciences, Poznań, Poland). For DNA extraction, seven-day-old cultures grown on potato dextrose agar medium plates were prepared. Harvested mycelia were stored at −20 °C. For toxin biosynthesis analyses, rice cultures of individual strains were used [43].

3.2. Mycotoxin Analyses

3.2.1. Apparatus

The chromatographic system used to determine mycotoxin levels consisted of a Waters 2695 high-performance liquid chromatography (HPLC) (Waters, Milford, PA, USA) and a Waters 2996 Photodiode Array Detector with a 150 × 3.9 mm Nova Pak C-18, 4 μm column. Empower™ 1 software was used for data processing (Waters, Milford, PA, USA).

3.2.2. Chemicals

Enniatins A, A1, B, B1 and beauvericin standards were purchased with a standard grade certificate from Sigma-Aldrich (Steinheim, Germany). The standard solutions of ENNs (ng μL−1) and BEA (ng μL−1) were prepared in methanol. Organic solvents (HPLC grade) and all the other chemicals were also purchased from Sigma-Aldrich (Steinheim, Germany). Water for the HPLC mobile phase was purified using a Milli-Q system (Millipore, Bedford, MA, USA).

3.2.3. Extraction and Purification

Culture samples (15 g) of each strain were mixed with 75 mL of extraction mixture—acetonitrile:methanol:water (16:3:1, v/v/v)—then homogenized (homogenizer H500, Pol-Ekoaparatura, Poland) and filtered (Whatman No. 4 filter paper). The extract was centrifuged at 4500g for 5 min, and next, the supernatant was evaporated with a Buchi Rotavapor R-210 (Flawil, Switzerland) and then re-dissolved in 2 mL methanol. The final solution was filtered through a 0.45 μm Waters HV membrane filter before injection into the LC-PAD system for analysis.

3.2.4. HPLC Analysis and Identification

Enniatins and beauvericin, after separation on a 150 × 3.9 mm Nova Pak C-18, 4 μm column, eluted with acetonitrile:water (70:30, v/v) at a flow rate of 1.0 mL min−1, were detected with a Waters 2996 Photodiode Array Detector set at 205 nm. Mycotoxin identification was performed by comparing retention times and UV spectra of purified extracted samples to pure standards. Quantification of mycotoxins was carried out on the basis of a comparison of peak areas with the calibration curve of the standards. All analysis were confirmed with a LC-MS.

3.2.5. Method Validation and Recovery Experiment

For linearity, six-point (5, 10, 20, 40, 60, 80 ng g−1) calibration curves were separately prepared for each mycotoxin (ENNs: A, A1, B, B1 and BEA), and they were obtained using the linear least squares regression procedure of peak area versus concentration.
The recovery experiment was performed on mycotoxin-free rice samples, spiked with three different levels of each mycotoxin separately at a concentration of 5, 20, 60 ng g−1. Then, samples were subjected to the procedure, as described in Section 3.2.3. On the basis of these experiments, recovery rates and standard deviations were calculated.

3.3. DNA Extraction, PCR Primers, Cycling Profiles and DNA Sequencing

Genomic DNAs of all isolates were extracted using a hexadecyltrimethylammonium bromide (CTAB) method, described previously [57]. Primer sequences are given in Table 5. A highly variable fragment of the translation elongation factor 1α (tef-1α) was amplified and sequenced using a Ef728M and Tef1R primer pair, validated successfully on Fusarium material during previous studies [42,43,44]. The enniatin synthase gene, esyn1, was partially amplified using the Esyn_1/Esyn_2 primers designed on the basis of GenBank ID: Z18755.3 sequence from F. scirpi [12]. However, it was possible to obtain the marker fragment from only a few BEA-producing strains belonging to F. nygamai and F. proliferatum (data not shown). Based on the sequence alignment of enniatin and cyclic peptide synthase genes from F. scirpi, F. oxysporum (GenBank ID: GU294760.1), Beauveria bassiana (GenBank ID: EU886196.1) and several in-house-read sequences, a primer pair was designed to amplify the gene fragment corresponding to the one amplified with Esyn1/Esyn2 primers, both from enniatin and beauvericin-producing species: ES_BeaFand ES_BeaR. Additionally, a pair of degenerated primers were used to amplify the different part of the gene from the studied strains of various Fusarium species: beas_1 and beas_2 (Table 5).
Table 5. PCR primers used in the study.
Table 5. PCR primers used in the study.
Primer5'–3' sequenceAmplicon size (bp)Reference
Ef728MCATCGAGAAGTTCGAGAAGG~600[42,43,44]
Tef1RGCCATCCTTGGAGATACCAGC
Esyn_1GCCGTTGGCGAGCTGGTCAT995[12]
Esyn_2GCAAAGCACGCGTCAACGCA
ES_BeaFTCTACAGAACWGGHGAYCTTGC~750This study
ES_BeaRCCYCGCATGCGSACRGCGWARGG
beas_1TKGARCAGCGBCAYGAGACM495[44]
beas_2GGWCGRGGGAARTCRGTDGG
The PCRs were done in 25 μL volumes using PTC-200 and C-1000 thermal cyclers (Bio-Rad, Hercules, CA, USA). Each reaction tube contained 1 unit of Platinum HotStart Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA), 2.5 μL of 10× PCR buffer, 12.5 pmol of forward/reverse primers, 2.5 mM of each dNTP and about 10–20 ng of fungal DNA. PCR parameters were as described: 15 min at 95 °C, 35 cycles of (30–60 s at 94 °C, 30–60 s at 58–64 °C, 1–2 min at 72 °C) and 10 min at 72 °C. Amplicons were electrophoresed in 1.5% agarose gels (Invitrogen, Carlsbad, CA, USA) with ethidium bromide.
For sequence analysis PCR-amplified DNA fragments were purified with exonuclease I (Epicentre, Madison, WI, USA) and shrimp alkaline phosphatase (Promega, Madison, WI, USA) using the following program: 30 min at 37 °C and 15 min at 80 °C. Both strands were labeled using a BigDyeTerminator 3.1 kit (Applied Biosystems, Foster City, CA, USA), according to Błaszczyk et al. [58], and precipitated with ethanol. Sequence reading was performed using Applied Biosystems equipment.

3.4. Sequence Analysis and Phylogeny Reconstruction

The sequences of the PCR products were initially aligned with the ClustalW algorithm. Phylogenetic relationships were reconstructed with a MEGA4 software package [59] using the maximum parsimony approach (closest neighbor interchange heuristics). No gap-containing positions were considered in phylogeny analysis. All reconstructions were tested by bootstrapping with 1000 replicates.

4. Conclusions

The phylogenetic relationships revealed on the basis of the constitutively expressed tef-1α gene were generally confirmed by the analysis of the esyn1 gene being involved in the secondary metabolism of Fusarium species, with only minor exceptions. Based on both esyn1 sequence alignments, the strains of F. poae were clustered into a group of F. temperatum, F. fujikuroi, and F. proliferatum strains, which formed a strongly supported clade. Both regions analyzed have shown a similar pattern (Figure 3, Figure 4). This could imply a different evolutionary fate of this cluster (or at least the part containing the esyn1 gene) for F. poae than for other species. Similarly, F. temperatum positioning differs slightly from the one based on the tef-1α sequences. Additional analyses based on different parts of the cluster and, perhaps, also, different genomic regions seem to be necessary to explain this question fully.
Apart from being less stringent, the region amplified using the beas_1/2 primers was also able to reveal a higher level of sequence divergence among the strains analyzed (Figure 4). It could mean that the distal part of the gene is less conserved than the region adjacent to the gene’s beginning. This statement, however, needs to be verified.
Finally, it was possible to compare the homological sequences from BEA/ENNs producers, as well as from non-producer (F. polyphialidicum). This finding, along with the separate clustering of F. avenaceum strains, producing mainly ENNs, can implicate the potential use of the BEA/ENN biosynthetic cluster in evolutionary studies of Fusaria and other fungal genera.

Acknowledgments

Part of the research was supported by Polish National Science Centre Project NN310 732440.

Conflict of Interest

The authors declare no conflict of interest.

References

  1. Kvas, M.; Marasas, W.F.O.; Wingfield, B.D.; Wingfield, M.J.; Steenkamp, E.T. Diversity and evolution of Fusarium species in the Gibberella fujikuroi complex. Fungal Divers. 2009, 34, 1–21. [Google Scholar]
  2. Stępień, Ł.; Chełkowski, J. Fusarium head blight of wheat: Pathogenic species and their mycotoxins. World Mycotox. J. 2010, 3, 107–119. [Google Scholar] [CrossRef]
  3. Chełkowski, J.; Gromadzka, K.; Stępień, Ł.; Lenc, L.; Kostecki, M.; Berthiller, F. Fusarium species, zearalenone and deoxynivalenol content in preharvest scabby wheat heads from Poland. World Mycotox. J. 2012, 5, 133–41. [Google Scholar]
  4. Njobeh, P.B.; Dutton, M.F.; Åberg, A.T.; Haggblom, P. Estimation of multi-mycotoxin contamination in South African compound feeds. Toxins 2012, 4, 836–848. [Google Scholar]
  5. Streit, E.; Schatzmayr, G.; Tassis, P.; Tzika, E.; Marin, D.; Taranu, I.; Tabuc, C.; Nicolau, A.; Aprodu, I.; Puel, O.; et al. Current situation of mycotoxin contamination and co-occurrence in animal feed—Focus on Europe. Toxins 2012, 4, 788–809. [Google Scholar] [CrossRef]
  6. Miller, J.D. Epidemiology of Fusarium ear diseases of cereals. In Mycotoxins in Grain; Miller, J.D., Trenholm, H.L., Eds.; Eagan Press: St. Paul, MN, USA, 1994; pp. 19–36. [Google Scholar]
  7. Jestoi, M. Emerging Fusarium mycotoxins: Fusaproliferin, beauvericin, enniatins, and moniliformin—A review. Crit. Rev. Food Sci. Nutr. 2008, 48, 21–49. [Google Scholar] [CrossRef]
  8. Blais, L.A.; Apsimon, J.W.; Blackwell, B.A.; Greenhalgh, R.; Miller, J.D. Isolation and characterization of enniatins from Fusarium avenaceum Daom-196490. Can. J. Chem. 1992, 70, 1281–1287. [Google Scholar] [CrossRef]
  9. Jestoi, M.; Paavanen-Huhtala, S.; Parikka, P.; Yli-Mattila, T. In vitro and in vivo mycotoxin production of Fusarium species isolated from Finnish grains. Arch. Phytopathol. Plant Prot. 2007, 41, 545–558. [Google Scholar]
  10. Scauflaire, J.; Gourgue, M.; Callebaut, A.; Munant, F. Fusarium temperatum, a mycotoxin-producing pathogen of maize. Eur. J. Plant Pathol. 2012, 133, 911–22. [Google Scholar] [CrossRef]
  11. Somma, S.; Alvarez, C.; Ricci, V.; Ferracane, L.; Ritieni, A.; Logrieco, A.; Moretti, A. Trichothecene and beauvericin mycotoxin production and genetic variability in Fusarium poae isolated from wheat kernels from northern Italy. Food Add. Contam. 2010, 27, 729–737. [Google Scholar] [CrossRef]
  12. Stępień, Ł.; Jestoi, M.; Chełkowski, J. Cyclic hexadepsipeptides in wheat field samples and esyn1 gene divergence among enniatin producing Fusarium avenaceum strains. World Mycotox. J. 2013. submitted for publication. [Google Scholar]
  13. Uhlig, S.; Torp, M.; Heier, B.T. Beauvericin and enniatins A, A1, B and B1 in Norwegian grain: A survey. Food Chem. 2006, 94, 193–201. [Google Scholar]
  14. Vogelgsang, S.; Sulyok, M.; Hecker, A.; Jenny, E.; Krska, R.; Schuhmacher, R.; Forrer, H.R. Toxigenicity and pathogenicity of Fusarium poae and Fusarium avenaceum on wheat. Eur. J. Plant Pathol. 2008, 122, 265–276. [Google Scholar] [CrossRef]
  15. Waśkiewicz, A.; Goliński, P.; Karolewski, Z.; Irzykowska, L.; Bocianowski, J.; Kostecki, M.; Weber, Z. Formation of fumonisins and other secondary metabolites by Fusarium oxysporum and F. proliferatum: A comparative study. Food Add. Contam. 2010, 27, 608–615. [Google Scholar]
  16. Jestoi, M.; Rokka, M.; Jarvenpaa, E.; Peltonen, K. Determination of Fusarium mycotoxins beauvericin and enniatins (A, A1, B, B1) in eggs of laying hens using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Food Chem. 2009, 115, 1120–1127. [Google Scholar] [CrossRef]
  17. Kamyar, M.; Rawnduzi, P.; Studenik, C.R.; Kouri, K.; Lemmens-Gruber, R. Investigation of the electrophysiological properties of enniatins. Arch. Biochem. Biophys. 2004, 429, 215–223. [Google Scholar]
  18. Fornelli, F.; Minervini, F.; Logrieco, A. Cytotoxicity of fungal metabolites to lepidopteran (Spodoptera frugiperda) cell line (SF-9). J. Invertebr. Pathol. 2004, 85, 74–79. [Google Scholar] [CrossRef]
  19. Logrieco, A.; Rizzo, A.; Ferracane, R.; Ritieni, A. Occurrence of beauvericin and enniatins in wheat affected by Fusarium avenaceum head blight. Appl. Environ. Microbiol. 2002, 68, 82–85. [Google Scholar]
  20. Macchia, L.; Caiaffa, M.F.; Fornelli, F.; Cal, L.; Nenna, S.; Moretti, A.; Logrieco, A.; Tursi, A. Apoptosis induced by the Fusarium mycotoxin beauvericin in mammalian cells. J. Appl. Genet. 2002, 43, 363–371. [Google Scholar]
  21. Lemmens-Gruber, R.; Rachoy, B.; Steininger, E.; Kouri, K.; Saleh, P.; Krska, R.; Josephs, R.; Lemmens, M. The effect of the Fusarium metabolite beauvericin on electromechanical and physiological properties in isolated smooth and heart muscle preparations of guinea pigs. Mycopathologia 2000, 149, 5–12. [Google Scholar] [CrossRef]
  22. Logrieco, A.; Bottalico, A.; Mulé, G.; Moretti, A.; Perrone, G. Epidemiology of toxigenic fungi and their associated mycotoxins for some Mediterranean crops. Eur. J. Plant Pathol. 2003, 109, 645–667. [Google Scholar] [CrossRef]
  23. Moretti, A.; Belisario, A.; Tafuri, A.; Ritieni, A.; Corazza, L.; Logrieco, A. Production of beauvericin by different races of Fusarium oxysporum f. sp. melonis, the Fusarium wilt agent of muskmelon. Eur. J. Plant Pathol. 2002, 108, 661–666. [Google Scholar]
  24. Logrieco, A.; Moretti, A.; Ritieni, A.; Chełkowski, J.; Altomare, C.; Bottalico, A.; Randazzo, G. Natural occurrence of beauvericin in preharvest Fusarium subglutinans infected corn ears in Poland. J. Agric. Food Chem. 1993, 41, 2149–2152. [Google Scholar] [CrossRef]
  25. Waśkiewicz, A.; Stępień, Ł. Mycotoxins biosynthesized by plant-derived Fusarium isolates. Arch. Indust. Hyg. Toxicol. 2012, 63, 479–488. [Google Scholar]
  26. Moretti, A.; Logrieco, A.; Bottalico, A.; Ritieni, A.; Randazzo, G.; Corda, P. Beauvericin production by Fusarium subglutinans from different geographical areas. Mycol. Res. 1995, 99, 282–286. [Google Scholar] [CrossRef]
  27. Meca, G.; Zinedine, A.; Blesa, J.; Font, G.; Manes, J. Further data on the presence of Fusarium emerging mycotoxins enniatins, fusaproliferin and beauvericin in cereals available on the Spanish market. Food Chem. Toxicol. 2010, 48, 1412–1416. [Google Scholar] [CrossRef]
  28. Sy-Cordero, A.; Pearce, C.J.; Oberlies, N.H. Revisiting the enniatins: A review of their isolation, biosynthesis, structure determination and biological activities. J. Antibiot. 2012, 65, 541–549. [Google Scholar] [CrossRef]
  29. Uhlig, S.; Ivanova, L.; Petersen, D.; Kristensen, R. Structural studies on minor enniatins from Fusarium sp. VI 03441: Novel N-methyl-threonine containing enniatins. Toxicon 2009, 53, 734–742. [Google Scholar]
  30. Tomoda, H.; Huang, X.H.; Nishida, H.; Nagao, R.; Okuda, S.; Tanaka, H.; Omura, S.; Arai, H.; Inoue, K. Inhibition of acyl-CoA: Cholesterol acyltransferase activity by cyclodepsipeptide antibiotics. J. Antibiot. 1992, 45, 1626–1632. [Google Scholar] [CrossRef]
  31. Gammelsrud, A.; Solhaug, A.; Dendele, B.; Sandberg, W.J.; Ivanova, L.; Bolling, A.K.; Lagadic-Gossmann, D.; Refsnes, R.; Becher, R.; Eriksen, G.; et al. Enniatin B-induced cell death and inflammatory responses in RAW 267.4 murine macrophages. Toxicol. Appl. Pharmacol. 2012, 261, 74–87. [Google Scholar] [CrossRef]
  32. Watjen, W.; Debbab, A.; Hohlfeld, A.; Chovolou, Y.; Kampkötter, A.; Edrada, R.A.; Ebel, R.; Hakiki, A.; Mosaddak, M.; Totzke, F.; et al. Enniatins A1, B and B1 from an endophytic strain of Fusarium tricinctum induce apoptotic cell death in H4IIE hepatoma cells accompanied by inhibition of ERK phosphorylation. Mol. Nutr. Food Res. 2009, 53, 431–440. [Google Scholar] [CrossRef]
  33. Herrmann, M.; Zocher, R.; Haese, A. Enniatin production by Fusarium strains and its effect on potato tuber tissue. Appl. Environ. Microbiol. 1996, 62, 393–398. [Google Scholar]
  34. Kulik, T.; Pszczółkowska, A.; Fordoński, G.; Olszewski, J. PCR approach based on the esyn1 gene for the detection of potential enniatin-producing Fusarium species. Int. J. Food Microbiol. 2007, 116, 319–324. [Google Scholar] [CrossRef]
  35. Nicholson, P.; Simpson, D.R.; Wilson, A.H.; Chandler, E.; Thomsett, M. Detection and differentiation of trichothecene and enniatin-producing Fusarium species on small-grain cereals. Eur. J. Plant Pathol. 2004, 110, 503–514. [Google Scholar] [CrossRef]
  36. Xu, Y.; Orozco, R.; Wijeratne, E.M.; Gunatilaka, A.A.; Stock, S.P.; Molnár, I. Biosynthesis of the cyclooligomer depsipeptide beauvericin, a virulence factor of the entomopathogenic fungus Beauveria bassiana. Chem. Biol. 2008, 15, 898–907. [Google Scholar] [CrossRef]
  37. Zhang, T.; Jia, X.; Zhuo, Y.; Liu, M.; Gao, H.; Liu, J.; Zhang, L. Cloning and characterization of a novel 2-ketoisovalerate reductase from the beauvericin producer Fusarium proliferatum LF061. BMC Biotechnol. 2012, 12, 55. [Google Scholar]
  38. Chełkowski, J.; Ritieni, A.; Wiśniewska, H.; Mulè, G.; Logrieco, A. Occurrence of toxic hexadepsipeptides in preharvest maize ear rot infected by Fusarium poae in Poland. J. Phytopathol. 2007, 155, 8–12. [Google Scholar] [CrossRef]
  39. Jestoi, M.; Rokka, M.; Yli-Mattila, T.; Parikka, P.; Rizzo, A.; Poltonen, K. Presence and concentrations of the Fusarium-related mycotoxins beauvericin, enniatins and moniliformin in finnish grain samples. Food Add. Contam. 2004, 21, 794–802. [Google Scholar] [CrossRef]
  40. Chandler, E.A.; Simpson, D.R.; Thomsett, M.A.; Nicholson, P. Development of PCR assays to Tri7 and Tri13 trichothecene biosynthetic genes, and characterization of chemotypes of Fusarium graminearum, Fusarium culmorum and Fusarium cerealis. Physiol. Mol. Plant Pathol. 2003, 62, 355–367. [Google Scholar] [CrossRef]
  41. Niessen, L.; Vogel, R.F. Group specific PCR-detection of potential trichothecene-producing Fusarium species in pure cultures and cereal samples. Syst. Appl. Microbiol. 1998, 21, 618–631. [Google Scholar] [CrossRef]
  42. Stępień, Ł.; Koczyk, G.; Waśkiewicz, A. FUM cluster divergence in fumonisins-producing Fusarium species. Fungal Biol. 2011, 115, 112–123. [Google Scholar] [CrossRef]
  43. Stępień, Ł.; Koczyk, G.; Waśkiewicz, A. Genetic and phenotypic variation of Fusarium proliferatum isolates from different host species. J. Appl. Genet. 2011, 52, 487–96. [Google Scholar] [CrossRef]
  44. Stępień, Ł.; Gromadzka, K.; Chełkowski, J. Polymorphism of mycotoxin biosynthetic genes among Fusarium equiseti isolates from Italy and Poland. J. Appl. Genet. 2012, 53, 227–36. [Google Scholar] [CrossRef]
  45. Geiser, D.M.; der mar Jimenez-Gasco, M.; Kang, S.; Makalowska, I.; Veeraraghavan, N.; Ward, T.J.; Zhang, N.; Kuldau, G.A.; O’Donnell, K. FUSARIUM-ID v.1.0: A DNA sequence database for identifying Fusarium. Eur. J. Plant Pathol. 2004, 110, 473–479. [Google Scholar]
  46. Jurado, M.; Marin, P.; Callejas, C.; Moretti, A.; Vazquez, C.; Gonzalez-Jaen, M.T. Genetic variability and fumonisin production by Fusarium proliferatum. Food Microbiol. 2010, 27, 50–57. [Google Scholar] [CrossRef]
  47. Kristensen, R.; Torp, M.; Kosiak, B.; Holst-Jensen, A. Phylogeny and toxigenic potential is correlated in Fusarium species as revealed by partial translation elongation factor 1 alpha gene sequences. Mycol. Res. 2005, 109, 173–186. [Google Scholar] [CrossRef]
  48. O’Donnell, K.; Cigelnik, E.; Nirenberg, H.I. Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 1998, 90, 465–493. [Google Scholar] [CrossRef]
  49. O’Donnell, K.; Ward, T.J.; Geiser, D.M.; Kistler, H.C.; Aoki, T. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet. Biol. 2004, 41, 600–623. [Google Scholar] [CrossRef]
  50. Punja, Z.K.; Wan, A.; Rahman, M.; Goswami, R.S.; Barasubiye, T.; Seifert, K.A.; Lévesque, C.A. Growth, population dynamics, and diversity of Fusarium equiseti in ginseng fields. Eur. J. Plant Pathol. 2008, 121, 173–184. [Google Scholar] [CrossRef]
  51. Kulik, T.; Pszczółkowska, A.; Łojko, M. Multilocus phylogenetics show high intraspecific variability within Fusarium avenaceum. Int. J. Mol. Sci. 2011, 12, 5626–40. [Google Scholar] [CrossRef]
  52. De Oliveira, R.L.; Reis, G.M.; da Silva, V.N.; Braghini, R.; Teixeira, M.M.; Corrêa, B. Molecular characterization and fumonisin production by Fusarium verticillioides isolated from corn grains of different geographic origins in Brazil. Int. J. Food Microbiol. 2011, 145, 9–21. [Google Scholar] [CrossRef]
  53. Watanabe, M.; Yonezawa, T.; Lee, K.-I.; Kumagai, S.; Sugita-Konishi, Y.; Goto, K.; Hara-Kudo, Y. Molecular phylogeny of the higher and lower taxonomy of the Fusarium genus and differences in the evolutionary histories of multiple genes. BMC Evol. Biol. 2011, 11, 322. [Google Scholar]
  54. Von Bargen, S.; Martinez, O.; Schadock, I.; Eisold, A.M.; Gossmann, M.; Buttner, C. Genetic variability of phytopathogenic Fusarium proliferatum associated with crown rot in Asparagus officinalis. J. Phytopathol. 2009, 157, 446–456. [Google Scholar] [CrossRef]
  55. Waśkiewicz, A.; Stępień, Ł.; Wilman, K.; Kachlicki, P. Diversity of pea-associated F. proliferatum and F. verticillioides populations revealed by FUM1 sequence analysis and fumonisin biosynthesis. Toxins 2013, 5, 488–503. [Google Scholar]
  56. Kulik, T.; Pszczółkowska, A. Multilocus sequence analysis of Fusarium poae. J. Plant Pathol. 2011, 93, 119–126. [Google Scholar]
  57. Stępień, Ł.; Chełkowski, J.; Wenzel, G.; Mohler, V. Combined use of linked markers for genotyping the Pm1 locus in common wheat. Cell. Mol. Biol. Lett. 2004, 9, 819–827. [Google Scholar]
  58. Błaszczyk, L.; Goyeau, H.; Huang, X.; Röder, M.; Stępień, Ł.; Chełkowski, J. Identification of leaf rust resistance genes and mapping gene Lr37 on microsatellite map of wheat. Cell Mol. Biol. Lett. 2004, 9, 805–817. [Google Scholar]
  59. Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007, 24, 1596–1599. [Google Scholar] [CrossRef]

Share and Cite

MDPI and ACS Style

Stępień, Ł.; Waśkiewicz, A. Sequence Divergence of the Enniatin Synthase Gene in Relation to Production of Beauvericin and Enniatins in Fusarium Species. Toxins 2013, 5, 537-555. https://doi.org/10.3390/toxins5030537

AMA Style

Stępień Ł, Waśkiewicz A. Sequence Divergence of the Enniatin Synthase Gene in Relation to Production of Beauvericin and Enniatins in Fusarium Species. Toxins. 2013; 5(3):537-555. https://doi.org/10.3390/toxins5030537

Chicago/Turabian Style

Stępień, Łukasz, and Agnieszka Waśkiewicz. 2013. "Sequence Divergence of the Enniatin Synthase Gene in Relation to Production of Beauvericin and Enniatins in Fusarium Species" Toxins 5, no. 3: 537-555. https://doi.org/10.3390/toxins5030537

APA Style

Stępień, Ł., & Waśkiewicz, A. (2013). Sequence Divergence of the Enniatin Synthase Gene in Relation to Production of Beauvericin and Enniatins in Fusarium Species. Toxins, 5(3), 537-555. https://doi.org/10.3390/toxins5030537

Article Metrics

Back to TopTop