Application of Pulsed Electric Field During Malting: Impact on Fusarium Species Growth and Mycotoxin Production
Abstract
:1. Introduction
2. Results and Discussion
2.1. Input Material
2.2. PEF Treatment of Barley and Subsequent Malting
3. Conclusions
- The PEF treatment significantly reduced most of the Fusarium species investigated in this study (i.e., F. culmorum, F. graminearum, F. sporotrichioides, and F. poae), where the extent of the reduction depended on the particular PEF parameters and conditions. Recorded up-/down-regulation of genes associated with fungal growth confirmed these results at the transcriptomics level.
- The reduction in Fusarium species was mostly associated with a reduction in the levels of relevant mycotoxins, specifically for F. sporotrichioides and F. poae and type A trichothecenes, T-2, and HT-2 toxins. The levels of DON derivatives and ZEA produced by F. culmorum and F. graminearum were more condition-dependent; specifically for ZEA, a statistically significant increase was observed under the technologically relevant PEF conditions.
- Despite the fact that verification of the presented results would be needed in up-scaled conditions of real malting houses, this study indicates the great potential for PEF in the fight with the ubiquitous problem of mycotoxin contamination of malt. The results of this study represent important pilot data, revealing opportunities for further follow-up research.
4. Materials and Methods
4.1. Input Material Production and Characterisation
4.2. PEF Treatment Conditions and Subsequent Malting
4.3. Analysis of Fusarium Species
4.4. Transcriptomics
4.5. Analysis of Mycotoxins
4.6. Analysis of Malt Enzymatic Activity
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Alshannaq, A.; Yu, J.-H. Occurrence, Toxicity, and Analysis of Major Mycotoxins in Food. Int. J. Environ. Res. Public Health 2017, 14, 632. [Google Scholar] [CrossRef] [PubMed]
- Foroud, N.A.; Baines, D.; Gagkaeva, T.Y.; Thakor, N.; Badea, A.; Steiner, B.; Bürstmayr, M.; Bürstmayr, H. Trichothecenes in Cereal Grains—An Update. Toxins 2019, 11, 634. [Google Scholar] [CrossRef] [PubMed]
- Battilani, P.; Palumbo, R.; Giorni, P.; Dall’Asta, C.; Dellafiora, L.; Gkrillas, A.; Toscano, P.; Crisci, A.; Brera, C.; de Santis, B.; et al. Mycotoxin mixtures in food and feed: Holistic, innovative, flexible risk assessment modelling approach: MYCHIF. EFSA Support. Publ. 2020, 17, 1757E. [Google Scholar] [CrossRef]
- Munkvold, G.P. Fusarium Species and Their Associated Mycotoxins. Methods Mol. Biol. 2017, 1542, 51–106. [Google Scholar] [CrossRef]
- Hu, L.; Gastl, M.; Linkmeyer, A.; Hess, M.; Rychlik, M. Fate of enniatins and beauvericin during the malting and brewing process determined by stable isotope dilution assays. LWT Food Sci. Technol. 2014, 56, 469–477. [Google Scholar] [CrossRef]
- Habler, K.; Hofer, K.; Geißinger, C.; Schüler, J.; Hückelhoven, R.; Hess, M.; Rychlik, M. Fate of Fusarium Toxins during the Malting Process. J. Agric. Food Chem. 2016, 64, 1377–1384. [Google Scholar] [CrossRef]
- Prusova, N.; Dzuman, Z.; Jelinek, L.; Karabin, M.; Hajslova, J.; Rychlik, M.; Stranska, M. Free and conjugated Alternaria and Fusarium mycotoxins during Pilsner malt production and double-mash brewing. Food Chem. 2022, 369, 130926. [Google Scholar] [CrossRef]
- Vegi, A.; Schwarz, P.; Wolf-Hall, C.E. Quantification of Tri5 gene, expression, and deoxynivalenol production during the malting of barley. Int. J. Food Microbiol. 2011, 150, 150–156. [Google Scholar] [CrossRef]
- Habler, K.; Geissinger, C.; Hofer, K.; Schüler, J.; Moghari, S.; Hess, M.; Rychlik, M. Fate of Fusarium toxins during brewing. J. Agric. Food Chem. 2017, 65, 190–198. [Google Scholar] [CrossRef]
- Homa, K.; Barney, W.P.; Davis, W.P.; Guerrero, D.; Berger, M.J.; Lopez, J.L.; Wyenandt, C.A.; Simon, J.E. Cold Plasma Treatment Strategies for the Control of Fusarium oxysporum f. sp. basilici in Sweet Basil. HortScience 2021, 56, 42–51. [Google Scholar] [CrossRef]
- Filho, F.O.; Silva, E.O.; Lopes, M.M.A.; Ribeiro, P.R.V.; Oster, A.H.; Guedes, J.A.C.; Zampieri, D.S.; Bordallo, P.D.N.; Zocolo, G.J. Effect of pulsed light on postharvest disease control-related metabolomic variation in melon (Cucumis melo) artificially inoculated with Fusarium pallidoroseum. PLoS ONE 2020, 15, e0220097. [Google Scholar] [CrossRef] [PubMed]
- Zuluaga-Calderón, B.; González, H.H.L.; Alzamora, S.M.; Coronel, M.B. Multi-step ozone treatments of malting barley: Effect on the incidence of Fusarium graminearum and grain germination parameters. Innov. Food Sci. Emerg. Technol. 2023, 83, 103219. [Google Scholar] [CrossRef]
- Evrendilek, G.A.; Karatas, B.; Uzuner, S.; Tanasov, I. Design and effectiveness of pulsed electric fields towards seed disinfection. J. Sci. Food Agric. 2019, 99, 3475–3480. [Google Scholar] [CrossRef]
- Zhong, C.; Guan, X.; Fan, Z.; Song, W.; Chen, R.; Wang, Y.; He, S. Pulsed electric field disinfection treatment of Fusarium oxysporum in nutrient solution. Water Supply 2019, 19, 2116–2122. [Google Scholar] [CrossRef]
- Chen, R.; Zhang, D.; Zhu, N.; Liu, C.; Novac, B.; Zhong, C. Continuous Disinfection of Fusarium oxysporum in Nutrient Solution by Pulsed Electric Field. In Proceedings of the 2020 IEEE International Conference on High Voltage Engineering and Application (ICHVE), Beijing, China, 6–10 September 2020; pp. 1–4. [Google Scholar] [CrossRef]
- Palicova, J.; Chrpova, J.; Tobolkova, A.; Ovesna, J.; Stranska, M. Effect of pulsed electric field on viability of Fusarium micromycetes. Cereal Res. Commun. 2024. [CrossRef]
- Stranska, M.; Prusova, N.; Behner, A.; Dzuman, Z.; Lazarek, M.; Tobolkova, A.; Chrpova, J.; Hajslova, J. Influence of pulsed electric field treatment on the fate of Fusarium and Alternaria mycotoxins present in malting barley. Food Control 2023, 145, 109440. [Google Scholar] [CrossRef]
- Karabin, M.; Jelinek, L.; Prusova, N.; Ovesna, J.; Stranska, M. Pulsed electric field treatment applied to barley before malting reduces Fusarium pathogens without compromising the quality of the final malt. LWT-Food Sci. Technol. 2024, 206, 116575. [Google Scholar] [CrossRef]
- Karlsson, I.; Mellqvist, E.; Persson, P. Temporal and spatial dynamics of Fusarium spp. and mycotoxins in Swedish cereals during 16 years. Mycotoxin Res. 2023, 39, 3–18. [Google Scholar] [CrossRef]
- Miedaner, T.; Reinbrecht, C.; Lauber, U.; Schollenberger, M.; Geiger, H.H. Effects of genotype and genotype-environment interaction on deoxynivalenol accumulation and resistance to Fusarium head blight in rye, triticale and wheat. Plant Breed. 2001, 120, 97–105. [Google Scholar] [CrossRef]
- Xu, X.M.; Monger, W.; Ritieni, A.; Nicholson, P. Effect of temperature and duration of wetness during initial infection periods on disease development, fungal biomass and mycotoxin concentrations on wheat inoculated with single, or combinations of, Fusarium species. Plant Pathol. 2007, 56, 943–956. [Google Scholar] [CrossRef]
- Gautam, P.; Dill-Macky, R. Impact of moisture, host genetics and Fusarium graminearum isolates on Fusarium head blight development and trichothecene accumulation in spring wheat. Mycotoxin Res. 2012, 28, 45–58. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.; Yang, R.; Zhang, H.Q. Recent advances in the action of pulsed electric fields on enzymes and food component proteins. Trends Food Sci. Technol. 2012, 27, 83–96. [Google Scholar] [CrossRef]
- Tibola, C.S.; Fernandes, J.M.C.; Guarienti, E.M.; Nicolau, M. Distribution of Fusarium mycotoxins in wheat milling process. Food Control 2015, 53, 91–95. [Google Scholar] [CrossRef]
- Edwards, S.G.; Dickin, E.T.; MacDonald, S.; Buttler, D.; Hazel, C.M.; Patel, S.; Scudamore, K.A. Distribution of Fusarium mycotoxins in UK wheat mill fractions. Food Addit. Contam. A 2011, 28, 1694–1704. [Google Scholar] [CrossRef]
- Chelkowski, J. Distribution of Fusarium Species and Their Mycotoxins in Cereal Grains. In Mycotoxins in Agriculture and Food Safety, 1st ed.; CRC Press: Boca Raton, FL, USA, 1998. [Google Scholar] [CrossRef]
- Lewandowski, S.M.; Bushnell, W.R.; Evans, C.K. Distribution of mycelial colonies and lesions in field-grown barley inoculated with Fusarium graminearum. Phytopathology 2007, 96, 567–581. [Google Scholar] [CrossRef]
- Jin, Z.; Solanki, S.; Ameen, G.; Gross, T.; Poudel, R.S.; Borowicz, P.; Brueggeman, R.S.; Schwarz, P. Expansion of Internal Hyphal Growth in Fusarium Head Blight-Infected Grains Contributes to the Elevated Mycotoxin Production During the Malting Process. Molec. Plant-Microbe Interact. 2021, 34, 793–802. [Google Scholar] [CrossRef]
- Munkvold, G.P.; Proctor, R.H.; Moretti, A. Mycotoxin Production in Fusarium According to Contemporary Species Concepts. Annu. Rev. Phytopathol. 2021, 59, 373–402. [Google Scholar] [CrossRef]
- Xue, A.G.; Armstrong, K.C.; Voldeng, H.D.; Fedak, G.; Babcock, C. Comparative aggressiveness of isolates of Fusarium spp. causing head blight on wheat in Canada. Can. J. Plant Pathol. 2004, 26, 81–88. [Google Scholar] [CrossRef]
- Wagacha, J.M.; Oerke, E.C.; Dehne, H.W.; Steiner, U. Interactions of Fusarium species during prepenetration development. Fungal Biol. 2012, 116, 836–847. [Google Scholar] [CrossRef]
- Velluti, A.; Marín, S.; Bettucci, L.; Ramos, A.J.; Sanchis, V. The effect of fungal competition on colonization of maize grain by Fusarium moniliforme, F. proliferatum and F. graminearum and on fumonisin B1 and zearalenone formation. Int. J. Food Microbiol. 2000, 59, 59–66. [Google Scholar] [CrossRef]
- Etcheverry, M. Aflatoxin B1, zearalenone and deoxynivalenol production by Aspergillus parasiticus and Fusarium graminearum in interactive cultures on irradiated corn kernels. Mycopathologia 1998, 142, 37–42. [Google Scholar] [CrossRef] [PubMed]
- Martins, M.P.; Silva, L.G.; Rossi, A.; Sanches, P.R.; Souza, L.D.R.; Martinez-Rossi, N.M. Global analysis of cell wall genes revealed putative virulence factors in the dermatophyte Trichophyton rubrum. Front. Microbiol. 2019, 10, 2168. [Google Scholar] [CrossRef] [PubMed]
- Djordjevic, J.T. Role of phospholipases in fungal fitness, pathogenicity, and drug development—Lessons from Cryptococcus neoformans. Front. Microbiol. 2010, 1, 125. [Google Scholar] [CrossRef] [PubMed]
- Westrick, N.M.; Park, S.C.; Keller, N.P.; Smith, D.L.; Kabbage, M. A broadly conserved fungal alcohol oxidase (AOX) facilitates fungal invasion of plants. Molec. Plant Pathol. 2023, 24, 28–43. [Google Scholar] [CrossRef] [PubMed]
- Gai, X.; Li, S.; Jiang, N.; Sun, Q.; Xuan, Y.H.; Xia, Z. Comparative transcriptome analysis reveals that ATP synthases regulate Fusarium oxysporum virulence by modulating sugar transporter gene expressions in tobacco. Front. Plant Sci. 2022, 13, 978951. [Google Scholar] [CrossRef]
- Sella, L.; Gazzetti, K.; Faoro, F.; Odorizzi, S.; D’Ovidio, R.; Schäfer, W.; Favaron, F. A Fusarium graminearum xylanase expressed during wheat infection is a necrotizing factor but is not essential for virulence. Plant Physiol. Biochem. 2013, 64, 1–10. [Google Scholar] [CrossRef]
- Chen, W.; Lee, M.K.; Jefcoate, C.; Kim, S.C.; Chen, F.; Yu, J.H. Fungal cytochrome P450 monooxygenases: Their distribution, structure, functions, family expansion, and evolutionary origin. Genome Biol. Evol. 2014, 6, 1620–1634. [Google Scholar] [CrossRef]
- Cui, Y.; Peng, Y.; Zhang, Q.; Xia, S.; Ruan, B.; Xu, Q.; Yu, X.; Zhou, T.; Liu, H.; Zeng, D.; et al. Disruption of EARLY LESION LEAF 1, encoding a cytochrome P450 monooxygenase, induces ROS accumulation and cell death in rice. Plant J. 2021, 105, 942–956. [Google Scholar] [CrossRef]
- Laugé, R.; Joosten, M.H.A.J.; Van den Ackerveken, G.F.J.M.; Van den Broek, H.W.J.; De Wit, P.J.G.M. The in planta-produced extracellular proteins ECP1 and ECP2 of Cladosporium fulvum are virulence factors. Mol. Plant-Microbe Interact. 1997, 10, 725–734. [Google Scholar] [CrossRef]
- Gozzi, M.; Blandino, M.; Bruni, R.; Capo, L.; Righetti, L.; Dall’Asta, C. Mycotoxin occurrence in kernels and straws of wheat, barley, and tritordeum. Mycotoxin Res. 2024, 40, 203–210. [Google Scholar] [CrossRef]
- Peiris, K.; Pumphrey, M.; Dong, Y.; Dowell, F. Fusarium Head Blight Symptoms and Mycotoxin Levels in Single Kernels of Infected Wheat Spikes. Cereal Chem. 2011, 88, 291–295. [Google Scholar] [CrossRef]
- Janik, E.; Niemcewicz, M.; Podogrocki, M.; Ceremuga, M.; Stela, M.; Bijak, M. T-2 Toxin-The Most Toxic Trichothecene Mycotoxin: Metabolism, Toxicity, and Decontamination Strategies. Molecules 2021, 26, 6868. [Google Scholar] [CrossRef] [PubMed]
- Ohshima, T.; Tanino, T.; Hashimoto, Y. Inactivation of a plant pathogenic fungus by pulsed electric field treatment. Int. J. Plasma Environ. Sci. Technol. 2020, 14, e02007. [Google Scholar] [CrossRef]
- Chrpova, J.; Šíp, V.; Matejova, E.; Sýkorova, S. Resistance of Winter Wheat Varieties Registered in the Czech Republic to Mycotoxin Accumulation in Grain Following Inoculation with Fusarium culmorum. Czech J. Genet. Plant Breed. 2007, 43, 44–52. [Google Scholar] [CrossRef]
- Dzuman, Z.; Zachariasova, M.; Lacina, O.; Veprikova, Z.; Slavikova, P.; Hajslova, J. A rugged high-throughput analytical approach for the determination and quantification of multiple mycotoxins in complex feed matrices. Talanta 2014, 121, 263–272. [Google Scholar] [CrossRef]
- Ovesna, J.; Vacke, J.; Kucera, L.; Chrpova, J.; Novakova, I.; Jahoor, A.; Šíp, V. Genetic analysis of resistance in barley to barley yellow dwarf virus. Plant Breed. 2000, 119, 481–486. [Google Scholar] [CrossRef]
- Leišová, L.; Kučera, L.; Chrpová, J.; Sýkorová, S.; Šíp, V.; Ovesná, J. Quantification of Fusarium culmorum in Wheat and Barley Tissues Using Real-Time PCR in Comparison with DON Content. J. Phytopathol. 2006, 154, 603–611. [Google Scholar] [CrossRef]
- Yli-Mattila, T.; Paavanen-Huhtala, S.; Jestoi, M.; Parikka, P.; Hietaniemi, V.; Gagkaeva, T.; Sarlin, T.; Haikara, A.; Laaksonen, S.; Rizzo, A. Real-time PCR detection and quantification of Fusarium poae, F. graminearum, F. sporotrichioides and F. langsethiae in cereal grains in Finland and Russia. Arch. Phytopathol. Plant Protect. 2008, 41, 243–260. [Google Scholar] [CrossRef]
- Köhl, J.; Lombaers, C.; Moretti, A.; Bandyopadhyay, R.; Somma, S.; Kastelein, P. Analysis of microbial taxonomical groups present in maize stalks suppressive to colonization by toxigenic Fusarium spp.: A strategy for the identification of potential antagonists. Biol. Control 2015, 83, 20–28. [Google Scholar] [CrossRef]
- Bluhm, B.H.; Cousin, M.A.; Woloshuk, C.P. Multiplex real-time PCR detection of fumonisin-producing and trichothecene-producing groups of Fusarium species. J. Food Prot. 2004, 67, 536–543. [Google Scholar] [CrossRef]
- European Brewing Convention. Analytica EBC. Chapter: 4.12.2—Diastatic Power of Malt by Segmented Flow Analysis. Available online: https://brewup.eu/ebc-analytica/malt/diastatic-power-of-malt-by-segmented-flow-analysis/4.12.2. (accessed on 28 November 2023).
- Megazyme Ltd. α-Amylase Assay Kit (Ceralpha Method). Available online: https://www.megazyme.com/documents/Assay_Protocol/K-CERA_DATA.pdf (accessed on 28 November 2023).
- Megazyme Ltd. β-Glucanase Assay Kit (Malt and Microbial). Available online: https://d1kkimny8vk5e2.cloudfront.net/documents/Assay_Protocol/K-MBGL_DATA.pdf (accessed on 28 November 2023).
Species | Fungal DNA Content (µg/kg) (n = 9) | Produced Mycotoxins | Mycotoxin Content (µg/kg) (n = 9) | |||
---|---|---|---|---|---|---|
Mean a | Range b | Mean a | Range b | |||
Barley grown in 2020 | DON | 896 | 781–1047 | |||
F. culmorum | 56 | 48–65 | D3G | 335 | 238–403 | |
3-acetylDON (3-ADON) | 55 | 46–66 | ||||
F. graminearum | 15-acetylDON (15-ADON) | 7.3 | 6.4–8.7 | |||
63 | 52–71 | NIV | 104 | 85–121 | ||
ZEA | 36 | 28–43 | ||||
Neosolaniol (NEO) | 34 | 29–42 | ||||
Diacetoxyscirpenol (DAS) | 4.2 | 3.4–5.2 | ||||
F. sporototrichioides | 60 | 38–84 | HT-2 | 542 | 486–627 | |
T-2 | 319 | 256–386 | ||||
Enniatin A (Enn-A) | 8.1 | 4.9–14.4 | ||||
Enniatin A1 (Enn-A1) | 42 | 27–57 | ||||
F. poae | 81 | 63–98 | Enn-B | 373 | 313–458 | |
Enn-B1 | 138 | 104–172 | ||||
Beauvericin (BEA) | 31 | 24–42 | ||||
Barley grown in 2021 | F. culmorum | 15 | 12–18 | DON | 2094 | 1807–2347 |
D3G | 596 | 517–678 | ||||
3-ADON | 62 | 50–71 | ||||
F. graminearum | 8 | 5–13 | 15-ADON | 17 | 12–22 | |
NIV | 778 | 689–895 | ||||
ZEA | 83 | 60–103 | ||||
F. sporototrichioides | 48 | 34–58 | NEO | 12 | 5–17 | |
DAS | 3.9 | 2.9–4.7 | ||||
HT-2 | 263 | 203–310 | ||||
T-2 | 85 | 60–97 | ||||
Enn-A | 3.9 | 1.9–6.1 | ||||
F. poae | 24 | 17–34 | Enn-A1 | 21 | 14–29 | |
Enn-B | 326 | 212–502 | ||||
Enn-B1 | 110 | 57–171 | ||||
BEA | 50 | 40–62 |
Fusarium Species Strains | DON | D3G | 3-ADON | 15-ADON | NIV | ZEA | NEO | DAS | HT-2 | T-2 | Enn-A | Enn-A1 | Enn-B | Enn-B1 | BEA |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
F. culmorum B (VURV-F 425) | 3503 | <50 | 919 | 375 | <50 | 20 | 34 a | <2.0 | 22 a | 35 a | <1.0 | <1.0 | <1.0 | <1.0 | <1.0 |
F. graminearum 12M1 (VURV-F 357) | <50 | <50 | <10 | <5 | <50 | 1.4 | <1.0 | <2.0 | <2.0 | <1.0 | <1.0 | <1.0 | <1.0 | <1.0 | <1.0 |
F. graminearum 354 (VURV-F 354) | 169 | <50 | 29 | 10 | <50 | <1.0 | 21 a | <2.0 | 43 b | 68 b | <1.0 | <1.0 | <1.0 | <1.0 | <1.0 |
F. graminearum 52M1 (VURV-F 361) | <50 | <50 | <10 | <5 | <50 | <1.0 | <1.0 | <2.0 | 132 b | 20 a | <1.0 | <1.0 | <1.0 | <1.0 | <1.0 |
F. poae 5M (VURV-F 995) | <50 | <50 | <10 | <5 | 151 a | <1.0 | 1.3 a | 240 | <2.0 | 3.2 a | <1.0 | <1.0 | <1.0 | <1.0 | 483 |
F. poae 80M1 (VURV-F 996) | <50 | <50 | <10 | <5 | 342 b | <1.0 | 5.8 | 24 b | 39 | 72 | <1.0 | <1.0 | <1.0 | <1.0 | 140 |
F. sporotrichioides 146 (VURV-F 146) | <50 | <50 | <10 | <5 | <50 | 5.2 | 35,376 | 1472 | 665,849 | 108,713 | <1.0 | <1.0 | <1.0 | <1.0 | 84 |
F. sporotrichioides 205 (VURV-F 205) | <50 | <50 | <10 | <5 | <50 | <1.0 | 21,186 | 718 | 134,945 | 37,587 | <1.0 | <1.0 | <1.0 | <1.0 | 49 |
F. sporotrichioides 239 (VURV-F 239) | <50 | <50 | <10 | <5 | <50 | <1.0 | 39,886 | 1549 | 716,174 | 128,106 | <1.0 | <1.0 | <1.0 | <1.0 | 96 |
Enzyme | Unit | Experiment I | Experiment II | ||
---|---|---|---|---|---|
Control Malt | PEF-Supported Malt | Control Malt | PEF-Supported Malt | ||
α-Amylase | U/kg | 240 | 66 | 211 | 203 |
β-Glucanase | U/kg | 603 | 80 | 448 | 503 |
Diastatic power | WK u. | 364 | 202 | 251 | 255 |
Log2FC | |||||
---|---|---|---|---|---|
Micromycete Species | Expressed Gene ID | PEF-Supported Green Malt II/Control Green Malt II | PEF-Supported Green Malt II/Input Barley | Control Green Malt II/Input Barley | Encoded Proteins Description |
F. culmorum | FCUL_03776.1 | 2.401 * | 3.527 | 1.293 | Cell wall protein phiA |
F. culmorum | FCUL_05985.1 | 2.234 * | 4.348 * | 2.269 | Lysophospholipase |
F. culmorum | FCUL_10667.1 | 0.735 | 2.555 * | 1.879 | Alcohol oxidase 1 |
F. graminearum | MDC_LOCUS513367 | 2.406 * | 3.843 * | 1.359 | Cell wall protein phiA |
F. poae | FPOA_06190 | −1.473 | 3.601 | 5.128 * | ATP synthase |
F. poae | FPOA_09175 | −2.32 | 1.795 | 4.103 * | Endo-1,4-beta-xylanase C |
F. poae | FPOA_13679 | 3.914 | 4.684 * | 0.93 | Cytochrome P450 monooxygenase |
F. sporotrichioides | FSPOR_7594 | −1.539 | 3.228 | 5.391 * | Ecp2 effector protein |
Name | Sequence (5′ → 3′)—Fluorochrom/Quencher | Reference | |
---|---|---|---|
F. culmorum | Forward | TTCACTAGATCGTCCGGCAG | [49] |
Reverse | GAGCCCTCCAAGCGAGAAG | ||
Probe | AAAGAAGTTGCAATGTTAGTG–VIC/MGB | ||
F. gramineum | Forward | CTCCGGATATGTTGCGTCAA | [50] |
Reverse | CGAAGCATATCCAGATCATCCA | ||
Probe | TGAGAATGTCTTGAGGCAATGCGAACTTT–ABY/QSY | ||
F. sporotrichoides | Forward | GGTTGGCGTCTCACTTATAC | [51] |
Reverse | AATTTCTGATTCGCTAAAGTGG | ||
Probe | CACACCCATAGTTACGTGTAA | ||
F. poae | Forward | GCTGAGGGTAAGCCGTCCTT | [50] |
Reverse | TCTGTCCCCCCTACCAAGCT | ||
Probe | ATTTCCCCAACTTCGACTCTCCGAGGA–ABY/QSY | ||
Fusarium species (ITS) | Forward | AACTCCCAAACCCCTGTGAACATA | [52] |
Reverse | TTTAACGGCGTGGCCGC | ||
Probe | CGCTCGAACAGGCATGCCCGCCAGAATAC–VIC/QSY |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Prusova, N.; Karabin, M.; Jelinek, L.; Chrpova, J.; Ovesna, J.; Svoboda, P.; Dolezalova, T.; Behner, A.; Hajslova, J.; Stranska, M. Application of Pulsed Electric Field During Malting: Impact on Fusarium Species Growth and Mycotoxin Production. Toxins 2024, 16, 537. https://doi.org/10.3390/toxins16120537
Prusova N, Karabin M, Jelinek L, Chrpova J, Ovesna J, Svoboda P, Dolezalova T, Behner A, Hajslova J, Stranska M. Application of Pulsed Electric Field During Malting: Impact on Fusarium Species Growth and Mycotoxin Production. Toxins. 2024; 16(12):537. https://doi.org/10.3390/toxins16120537
Chicago/Turabian StylePrusova, Nela, Marcel Karabin, Lukas Jelinek, Jana Chrpova, Jaroslava Ovesna, Pavel Svoboda, Tereza Dolezalova, Adam Behner, Jana Hajslova, and Milena Stranska. 2024. "Application of Pulsed Electric Field During Malting: Impact on Fusarium Species Growth and Mycotoxin Production" Toxins 16, no. 12: 537. https://doi.org/10.3390/toxins16120537
APA StylePrusova, N., Karabin, M., Jelinek, L., Chrpova, J., Ovesna, J., Svoboda, P., Dolezalova, T., Behner, A., Hajslova, J., & Stranska, M. (2024). Application of Pulsed Electric Field During Malting: Impact on Fusarium Species Growth and Mycotoxin Production. Toxins, 16(12), 537. https://doi.org/10.3390/toxins16120537