Effect of Plasma-Activated Water Bubbles on Fusarium graminearum, Deoxynivalenol, and Germination of Naturally Infected Barley during Steeping
Abstract
1. Introduction
2. Results and Discussion
2.1. Characteristics of PAW Bubbles
2.2. EPR Spectroscopy
2.3. Efficacy of PAW Bubble Treatments on DON Reduction
2.4. Germination of NIB Grains after PAW Bubble Treatments
2.5. Effect of PAW Bubble Treatments on Microflora and F. graminearum in NIB Grains
2.6. Effect of PAW Bubble Treatment on Fungal Biomass of F. graminearum
3. Conclusions
4. Materials and Methods
4.1. Barley Grains
4.2. PAW Bubble Production
4.3. PAW Bubble Characterisation
4.4. EPR Spectroscopy
4.5. DON Quantification after PAW Bubble Treatments
4.6. Grain Germination and Enzymatic Activity after PAW Bubble Treatments
4.7. Analysis of Microbial Contamination and In Vitro Germination
4.8. DNA Extraction
4.9. Quantitative PCR
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Guo, J.; Wang, J.; Xie, H.; Jiang, J.; Li, C.; Li, W.; Li, L.; Liu, X.; Lin, F. Inactivation effects of plasma-activated water on Fusarium graminearum. Food Control 2021, 134, 108683. [Google Scholar] [CrossRef] [Scilit]
- Feizollahi, E.; Roopesh, M.S. Mechanisms of deoxynivalenol (DON) degradation during different treatments: A review. Crit. Rev. Food Sci. Nutr. 2021, 62, 5903–5924. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sobrova, P.; Adam, V.; Vasatkova, A.; Beklova, M.; Zeman, L.; Kizek, R. Deoxynivalenol and its toxicity. Interdiscip. Toxicol. 2010, 3, 94–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Misra, N.; Yadav, B.; Roopesh, M.; Jo, C. Cold Plasma for Effective Fungal and Mycotoxin Control in Foods: Mechanisms, Inactivation Effects, and Applications. Compr. Rev. Food Sci. Food Saf. 2019, 18, 106–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Misra, N.; Schlüter, O.; Cullen, P. Plasma in food and agriculture. In Cold Plasma in Food and Agriculture; Elsevier: Amsterdam, The Netherlands, 2016; pp. 1–16. [Google Scholar]
- Rathore, V.; Patel, D.; Butani, S.; Nema, S.K. Investigation of physicochemical properties of plasma activated water and its bactericidal efficacy. Plasma Chem. Plasma Process. 2021, 41, 871–902. [Google Scholar] [CrossRef] [Scilit]
- Rathore, V.; Nema, S.K. Optimization of process parameters to generate plasma activated water and study of physicochemical properties of plasma activated solutions at optimum condition. J. Appl. Phys. 2021, 129, 084901. [Google Scholar] [CrossRef] [Scilit]
- Wu, M.C.; Liu, C.T.; Chiang, C.Y.; Lin, Y.J.; Lin, Y.H.; Chang, Y.W.; Wu, J.S. Inactivation Effect of Colletotrichum Gloeosporioides by Long-Lived Chemical Species Using Atmospheric-Pressure Corona Plasma-Activated Water. IEEE Trans. Plasma Sci. 2019, 47, 1100–1104. [Google Scholar] [CrossRef] [Scilit]
- Grainge, G.; Nakabayashi, K.; Steinbrecher, T.; Kennedy, S.; Ren, J.; Iza, F.; Leubner-Metzger, G. Molecular mechanisms of seed dormancy release by gas plasma-activated water technology. J. Exp. Bot. 2022, 73, 4065–4078. [Google Scholar] [CrossRef] [Scilit]
- Jirešová, J.; Scholtz, V.; Julák, J.; Šerá, B. Comparison of the Effect of Plasma-Activated Water and Artificially Prepared Plasma-Activated Water on Wheat Grain Properties. Plants 2022, 11, 1471. [Google Scholar] [CrossRef] [Scilit]
- McCormick, S.P.; Stanley, A.M.; Stover, N.A.; Alexander, N.J. Trichothecenes: From simple to complex mycotoxins. Toxins 2011, 3, 802–814. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faltusová, Z.; Vaculová, K.; Pavel, J.; Svobodová, I.; Hajšlová, J.; Ovesná, J. Fusarium culmorum Tri genes and barley HvugT13248 gene transcription in infected barley cultivars. Plant Prot. Sci. 2019, 55, 172–180. [Google Scholar] [CrossRef] [Scilit]
- Boutigny, A.L.; Gautier, A.; Basler, R.; Dauthieux, F.; Leite, S.; Valade, R.; Aguayo, J.; Ioos, R.; Laval, V. Metabarcoding targeting the EF1 alpha region to assess Fusarium diversity on cereals. PLoS ONE 2019, 14, e0207988. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dominguez, R.; Holmes, K.C. Actin structure and function. Annu. Rev. Biophys. 2011, 40, 169–186. [Google Scholar] [CrossRef] [Scilit]
- Feizollahi, E.; Roopesh, M.S. Degradation of Zearalenone by Atmospheric Cold Plasma: Effect of Selected Process and Product Factors. Food Bioprocess Technol. 2021, 14, 2107–2119. [Google Scholar] [CrossRef] [Scilit]
- Julák, J.; Hujacová, A.; Scholtz, V.; Khun, J.; Holada, K. Contribution to the chemistry of plasma-activated water. Plasma Phys. Rep. 2018, 44, 125–136. [Google Scholar] [CrossRef] [Scilit]
- Egorova, G.; Voblikova, V.; Sabitova, L.; Tkachenko, I.; Tkachenko, S.; Lunin, V. Ozone solubility in water. Mosc. Univ. Chem. Bull. 2015, 70, 207–210. [Google Scholar] [CrossRef] [Scilit]
- Park, J.Y.; Lee, Y.N. Solubility and decomposition kinetics of nitrous acid in aqueous solution. J. Phys. Chem. 1988, 92, 6294–6302. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.W.; Lee, H.-M.; Chang, M.B. Inactivation of aquatic microorganisms by low-frequency AC discharges. IEEE Trans. Plasma Sci. 2008, 36, 215–219. [Google Scholar] [CrossRef] [Scilit]
- Liu, D.X.; Liu, Z.C.; Chen, C.; Yang, A.J.; Li, D.; Rong, M.Z.; Chen, H.L.; Kong, M.G. Aqueous reactive species induced by a surface air discharge: Heterogeneous mass transfer and liquid chemistry pathways. Sci. Rep. 2016, 6, 23737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, C.; Li, F.; Chen, H.-L.; Kong, M.G. Interaction between air plasma-produced aqueous 1O2 and the spin trap DMPO in electron spin resonance. Phys. Plasmas 2017, 24, 103501. [Google Scholar] [CrossRef] [Scilit]
- Floyd, R.A.; Soong, L.M. Spin trapping in biological systems. Oxidation of the spin trap 5,5-dimethyl-1-pyrroline-1-oxide by a hydroperoxide-hematin system. Biochem. Biophys. Res. Commun. 1977, 74, 79–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, Y.; Li, M.; Sun, C.; Zhang, X. Microbubble-enhanced water activation by cold plasma. Chem. Eng. J. 2022, 446, 137318. [Google Scholar] [CrossRef] [Scilit]
- Qiu, Y.; Chen, X.; Zhang, J.; Ding, Y.; Lyu, F. Effects of tempering with plasma activated water on the degradation of deoxynivalenol and quality properties of wheat. Food Res. Int. 2022, 162, 112070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fang, H.; Zhang, C.; Sun, A.; Man, C.; Zhang, Q.; Kuang, Y.; Wang, K.; Liu, A.; Shao, T. Effect of Reactive Chemical Species on the Degradation of Deoxynivalenol, 3-Acetyldeoxynivalenol, and 15-Acetyldeoxynivalenol in Low-Temperature Plasmas. ACS Food Sci. Technol. 2022, 2, 558–567. [Google Scholar] [CrossRef] [Scilit]
- Mishra, S.; Dixit, S.; Dwivedi, P.D.; Pandey, H.P.; Das, M. Influence of temperature and pH on the degradation of deoxynivalenol (DON) in aqueous medium: Comparative Cytotoxicity of DON and degraded product. Food Addit. Contam. Part A 2014, 31, 121–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, D.; Chen, P.; Cheng, Y.; Peng, P.; Liu, J.; Ma, Y.; Liu, Y.; Ruan, R. Deoxynivalenol Decontamination in Raw and Germinating Barley Treated by Plasma-Activated Water and Intense Pulsed Light. Food Bioprocess Tech. 2018, 12, 246–254. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Qiu, Y.; Zhang, J.; Guo, Y.; Ding, Y.; Lyu, F. Degradation efficiency and products of deoxynivalenol treated by cold plasma and its application in wheat. Food Control 2022, 136, 108874. [Google Scholar] [CrossRef] [Scilit]
- Siciliano, I.; Spadaro, D.; Prelle, A.; Vallauri, D.; Cavallero, M.C.; Garibaldi, A.; Gullino, M.L. Use of cold atmospheric plasma to detoxify hazelnuts from aflatoxins. Toxins 2016, 8, 125. [Google Scholar] [CrossRef] [Scilit]
- Edwards, S.G.; Dickin, E.T.; MacDonald, S.; Buttler, D.; Hazel, C.M.; Patel, S.; Scudamore, K.A. Distribution of Fusarium mycotoxins in UK wheat mill fractions. Food Addit. Contam. Part A 2011, 28, 1694–1704. [Google Scholar] [CrossRef] [Scilit]
- Than, H.A.Q.; Pham, T.H.; Nguyen, D.K.V.; Pham, T.H.; Khacef, A. Non-thermal Plasma Activated Water for Increasing Germination and Plant Growth of Lactuca sativa L. Plasma Chem. Plasma Process. 2022, 42, 73–89. [Google Scholar] [CrossRef] [Scilit]
- Szőke, C.; Nagy, Z.; Gierczik, K.; Székely, A.; Spitkól, T.; Zsuboril, Z.T.; Galiba, G.; Marton, C.L.; Kutasi, K. Effect of the afterglows of low pressure Ar/N2-O2 surface-wave microwave discharges on barley and maize seeds. Plasma Process. Polym. 2018, 15, 1700138. [Google Scholar] [CrossRef] [Scilit]
- Hossain, M.A.; Bhattacharjee, S.; Armin, S.-M.; Qian, P.; Xin, W.; Li, H.-Y.; Burritt, D.J.; Fujita, M.; Tran, L.-S.P. Hydrogen peroxide priming modulates abiotic oxidative stress tolerance: Insights from ROS detoxification and scavenging. Front Plant Sci. 2015, 6, 420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barba-Espin, G.; Diaz-Vivancos, P.; Clemente-Moreno, M.J.; Albacete, A.; Faize, L.; Faize, M.; Pérez-Alfocea, F.; Hernández, J.A. Interaction between hydrogen peroxide and plant hormones during germination and the early growth of pea seedlings. Plant Cell Environ. 2010, 33, 981–994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Attri, P.; Koga, K.; Okumura, T.; Shiratani, M. Impact of atmospheric pressure plasma treated seeds on germination, morphology, gene expression and biochemical responses. Jpn. J. Appl. Phys. 2021, 60, 040502. [Google Scholar] [CrossRef] [Scilit]
- Kaur, M.; Huberli, D.; Bayliss, K. A protocol for the use of cold plasma treatment to inhibit in vitro growth of Fusarium graminearum. bioRxiv 2022. [Google Scholar] [CrossRef] [Scilit]
- Devi, Y.; Thirumdas, R.; Sarangapani, C.; Deshmukh, R.R.; Annapure, U.S. Influence of cold plasma on fungal growth and aflatoxins production on groundnuts. Food Control 2017, 77, 187–191. [Google Scholar] [CrossRef] [Scilit]
- Guo, J.; Qin, D.; Li, W.; Wu, F.; Li, L.; Liu, X. Inactivation of Penicillium italicum on kumquat via plasma-activated water and its effects on quality attributes. Int. J. Food Microbiol. 2021, 343, 109090. [Google Scholar] [CrossRef] [Scilit]
- Sen, Y.; Onal-Ulusoy, B.; Mutlu, M. Aspergillus decontamination in hazelnuts: Evaluation of atmospheric and low-pressure plasma technology. Innov. Food Sci. Emerg. Technol. 2019, 54, 235–242. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.; Tian, Y.; Ma, R.; Liu, Q.; Zhang, J. Effect of plasma activated water on the postharvest quality of button mushrooms, Agaricus bisporus. Food Chem. 2016, 197, 436–444. [Google Scholar] [CrossRef] [Scilit]
- Filatova, I.; Azharonok, V.; Shik, A.; Antoniuk, A.; Terletskaya, N. Fungicidal effects of plasma and radio-wave pre-treatments on seeds of grain crops and legumes. In Plasma for Bio-Decontamination, Medicine and Food Security; Springer: Berlin/Heidelberg, Germany, 2012; pp. 469–479. [Google Scholar]
- Thompson, D.P.; Metevia, L.; Vessel, T. Influence of pH Alone and in Combination with Phenolic Antioxidants on Growth and Germination of Mycotoxigenic Species of Fusarium and Penicillium. J. Food Prot. 1993, 56, 134–138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Panwar, V.; Aggarwal, A.; Paul, S.; Singh, V.; Singh, P.K.; Sharma, D.; Shaharan, M. Effect of temperature and pH on the growth of Fusarium spp. causing Fusarium head blight (FHB) in wheat. South Asian J. Exp. Biol. 2016, 6, 186–193. [Google Scholar] [CrossRef] [Scilit]
- Demeke, T.; Gräfenhan, T.; Clear, R.M.; Phan, A.; Ratnayaka, I.; Chapados, J.; Patrick, S.K.; Gaba, D.; Lévesque, C.A.; Seifert, K.A. Development of a specific TaqMan real-time PCR assay for quantification of Fusarium graminearum clade 7 and comparison of fungal biomass determined by PCR with deoxynivalenol content in wheat and barley. Int. J. Food Microbiol. 2010, 141, 45–50. [Google Scholar] [CrossRef] [Scilit]
- Wegulo, S.N. Factors influencing deoxynivalenol accumulation in small grain cereals. Toxins 2012, 4, 1157–1180. [Google Scholar] [CrossRef] [Scilit]
- Kimura, M.; Tokai, T.; Takahashi-Ando, N.; Ohsato, S.; Fujimura, M. Molecular and genetic studies of Fusarium trichothecene biosynthesis: Pathways, genes, and evolution. Biosci. Biotechnol. Biochem. 2007, 71, 2105–2123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hafez, M.; Abdelmagid, A.; Adam, L.R.; Daayf, F. Specific Detection and Identification of Fusarium graminearum Sensu Stricto Using a PCR-RFLP Tool and Specific Primers Targeting the Translational Elongation Factor 1α Gene. Plant Dis. 2020, 104, 1076–1086. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, G.; Chen, A.; Dawood, D.H.; Liang, J.; Chen, Y.; Ma, Z. Capping proteins regulate fungal development, DON-toxisome formation and virulence in Fusarium graminearum. Mol. Plant Pathol. 2020, 21, 173–187. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khaneghah, A.M.; Martins, L.M.; von Hertwig, A.M.; Bertoldo, R.; Sant’Ana, A.S. Deoxynivalenol and its masked forms: Characteristics, incidence, control and fate during wheat and wheat based products processing—A review. Trends Food Sci. Technol. 2018, 71, 13–24. [Google Scholar] [CrossRef] [Scilit]
- Kamle, M.; Mahato, D.K.; Gupta, A.; Pandhi, S.; Sharma, B.; Dhawan, K.; Vasundhara; Mishra, S.; Kumar, M.; Tripathi, A.D.; et al. Deoxynivalenol: An Overview on Occurrence, Chemistry, Biosynthesis, Health Effects and Its Detection, Management, and Control Strategies in Food and Feed. Microbiol. Res. 2022, 13, 292–314. [Google Scholar] [CrossRef] [Scilit]
- Veerana, M.; Yu, N.; Ketya, W.; Park, G. Application of Non-Thermal Plasma to Fungal Resources. J. Fungi 2022, 8, 102. [Google Scholar] [CrossRef] [Scilit]
- AACC International. AACC Approved Methods of Analysis. 11th Ed. Method 44-19.01. Moisture—Air-Oven Method, Drying at 135 °C. In AACC Approved Methods of Analysis; Cereals & Grains Association: St. Paul, MN, USA, 3 November 1999. [Google Scholar] [CrossRef] [Scilit]
- Leslie, J.F.; Summerell, B.A. The Fusarium Laboratory Manual; Blackwell Publishing Ltd.: Oxford, UK, 2008. [Google Scholar]




| pH | ORP (mV) | H2O2 (ppm) | NO−3 (ppm) | NO−2 (ppm) | O3 (ppm) | |
|---|---|---|---|---|---|---|
| DW | 8.1 ± 0.2 a | 208 ± 33.2 c | - | - | - | - |
| Treatment A 1 | 2.7 ± 0.06 d | 599 ± 1 a | 87.3 ± 11.9 b | 277.47 ± 19.6 b | 22.6 ± 2.2 b | 79.6 ± 8.2 b |
| Treatment A + 5 h storage | 2.64 ± 0.06 d | 594.3 ± 0.6 a | 54.7 ± 3.8 c | 299.6 ± 5.7 b | 16 ± 0.7 c | 34.1 ± 3.4 cd |
| Treatment B without ice | 2.5 ± 0.04 d | 606.7 ± 4.2 a | 15.6 ± 0.9 d | 238.6 ± 5.6 c | 6.3 ± 0.1 d | 22.7 ± 2.5 d |
| Treatment B | 2.5 ± 0.07 d | 608.7 ± 3.2 a | 133.5 ± 14.9 a | 465.2 ± 24.3 a | 33.7 ± 2.5 a | 103.8 ± 20 a |
| Treatment B + 5 h storage | 2.5 ± 0.04 d | 600 ± 1 a | 59 ± 6.2 c | 267.7 ± 40.1 bc | 16.9 ± 2.1 c | 42.8 ± 5.5 c |
| Treatment D | 5.99 ± 0.15 b | 236.3 ± 13.8 c | 0.3 ± 0.06 e | 4.24 ± 0.3 d | 0.057 ± 0.004 e | 0.08 ± 0.02 e |
| Treatment D + 5 h storage | 6.04 ± 0.14 b | 210.7 ± 10 c | 0.28 ± 0.06 e | 4.14 ± 0.4 d | 0.037 ± 0.006 e | 0.03 ± 0.006 e |
| Treatment E | 5.07 ± 0.2 c | 336 ± 31.4 b | 0.23 ± 0.04 e | 4.22 ± 0.69 d | 0.043 ± 0.003 e | 0.06 ± 0.01 e |
| DON Content (ppm) | Minimum (ppm) | Maximum (ppm) | Reduction (%) | |
|---|---|---|---|---|
| Dry grain | 5.2 ± 0.6 a | 4.6 | 5.9 | 0 b |
| Control (5 h steeping) + 19 h air rest | 3.3 ± 1 b | 2.6 | 4.4 | 36.9 ± 18.4 a |
| Treatment A + 4 h 40 min steeping + 19 h air rest 1 | 3.3 ± 0.9 b | 2.4 | 4.1 | 37.6 ± 16.2 a |
| Treatment B + 4.5 h steeping + 19 h air rest | 2.2 ± 0.7 b | 1.5 | 3 | 57.3 ± 14.3 a |
| Treatment C + 5 h steeping + 19 h air rest | 3.6 ± 0.5 b | 3.2 | 4.1 | 31.2 ± 8.8 a |
| Control D + 4.5 h steeping + 19 h air rest | 3.3 ± 1.1 b | 2 | 4.9 | 37.7 ± 20.1 a |
| Treatment D + 4.5 h steeping + 19 h air rest | 2.9 ± 0.5 b | 2.6 | 3.5 | 44.6 ± 9.9 a |
| Control E + 4.5 h steeping + 19 h air rest | 3 ± 0.6 b | 2.5 | 3.7 | 43.3 ± 12.3 a |
| Treatment E + 4 h steeping + 19 h air rest | 3.1 ± 0.3 b | 2.9 | 3.5 | 40.1 ± 6.1 a |
| MC 1st Day Steeping (g Water/100 g Sample) | MC 2nd Day Steeping (g Water/100 g Sample) | Germinated Acrospire (%) | Germinated Rootlets (%) | α-Amylase (Units/g Dry Basis) | β-Amylase (Units/g Dry Basis) | β-Glucanase (Units/g Dry Basis) | |
|---|---|---|---|---|---|---|---|
| Dry grain | - | - | - | - | 12.6 ± 1.6 b | 31.6 ± 2.1 a,b | 22.3 ± 3.7 d |
| DW + 5 h steeping + 19 h air rest | 30.9 ± 0.6 a | 41.2 ± 0.8 a | 47.3 ± 7 a | 58.2 ± 2.7 a | 41.9 ± 0.7 a | 31.8 ± 1 ab | 33.3 ± 2.9 b,c |
| Treatment A + 4 h 40 min steeping + 19 h air rest 1 | 31.7 ± 1.4 a | 42.7 ± 0.9 a | 15.1 ± 0.7 b | 70.1 ± 7 a | 45.1 ± 6.5 a | 33.4 ± 1 a | 39.9 ± 4.6 b |
| Treatment B + 4 h 30 min steeping + 19 h air rest | 32.9 ± 1.9 a | 42.6 ± 1.5 a | 3.6 ± 6.2 c | 18.5 ± 16.9 b | 39.5 ± 7.4 a | 30.9 ± 0.5 a,b | 26.7 ± 2.8 c,d |
| Treatment C + 5 h steeping + 19 h air rest | 31.5 ± 1.7 a | 41.7 ± 3 a | 38.1 ± 4.8 a | 75.08 ± 7.3 a | - | - | - |
| Control D + 4 h 30 min steeping + 19 h air rest | 33.36 ± 0.7 a | 42.5 ± 0.8 a | 41.1 ± 10.4 a | 63.7 ± 8.1 a | - | - | - |
| Treatment D + 4 h 30 min steeping + 19 h air rest | 33.46 ± 0.5 a | 43.6 ± 0.7 a | 44.1 ± 4.7 a | 68.5 ± 11 a | 39.2 ± 1.6 a | 30.2 ± 1.3 b | 51.6 ± 7.3 a |
| Average Colony Diameter on PDA (cm) 2 | Number of F. graminearum Colonies on PDA | Number of F. graminearum Colonies on WA | Plant Shoot Length on WA (cm) | Germination % on WA | |
|---|---|---|---|---|---|
| Dry grain | 2.12 ± 0.06 a | 1.2 ± 0.8 a | 1.2 ± 1 a | 3.66 ± 0.06 b | 85.6 ± 1.9 a |
| Control 5 h steeping + 19 h air rest | 1.99 ± 0.07 b | 2.1 ± 1.4 a | 0.7 ± 0.5 a | 4.51 ± 0.69 a | 86.7 ± 3.3 a |
| Treatment A + 4 h 40 min steeping + 19 h air rest | 1.99 ± 0.08 b | 1.4 ± 1.4 a | 1.4 ± 1.1 a | 4.29 ± 0.36 ab | 87.8 ± 5.1 a |
| Treatment C + 5 h steeping + 19 h air rest | 1.89 ± 0.04 b | 2.3 ± 2.1 a | 1.4 ± 1.2 a | 4.38 ± 0.47 ab | 84.4 ± 5.1 a |
| Treatment F + 4.5 h steeping + 19 h air rest | 1.99 ± 0.05 b | 1.3 ± 0.9 a | 1.1 ± 1.1 a | 4.89 ± 0.34 a | 81.1 ± 1.9 a |
| Name | Treatment Name |
|---|---|
| Treatment A | Direct 20 min BSD (surrounded by ice) |
| Treatment B | Direct 30 min BSD (surrounded by ice) |
| Treatment C | Indirect 30 min BSD |
| Control D | Control 30 min CJ |
| Treatment D | Direct 30 min CJ |
| Control E | Control 1 h CJ |
| Treatment E | Direct 1 h CJ |
| Treatment F | Direct 30 min BJ |
| Forward PRIMER (5′–3′) | Tm (°C) | Reverse Primer | Product Size (bp) | Tm (°C) | |
|---|---|---|---|---|---|
| Tri6 | GCGGCATTACCGACAACACT | 60 | CGCACTGTTGGTTTGTGCTT | 1247 | 58 |
| EF1A | AAATTTTGCGGCTTTGTCGTA | 58 | GGCTTCCTATTGACAGGTGGTT | 629 | 58 |
| Actin | CGTCGCCCTTGACTTCGA | 59 | CCAAGGACAGAAGGCTGGAA | 1544 | 59 |
| Tri5 | AGGAGCGCATCGAGAATTTG | 59 | TTGCCCAGCTGTATACAACCAT | 1062 | 58 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Feizollahi, E.; Basu, U.; Fredua-Agyeman, R.; Jeganathan, B.; Tonoyan, L.; Strelkov, S.E.; Vasanthan, T.; Siraki, A.G.; Roopesh, M.S. Effect of Plasma-Activated Water Bubbles on Fusarium graminearum, Deoxynivalenol, and Germination of Naturally Infected Barley during Steeping. Toxins 2023, 15, 124. https://doi.org/10.3390/toxins15020124
Feizollahi E, Basu U, Fredua-Agyeman R, Jeganathan B, Tonoyan L, Strelkov SE, Vasanthan T, Siraki AG, Roopesh MS. Effect of Plasma-Activated Water Bubbles on Fusarium graminearum, Deoxynivalenol, and Germination of Naturally Infected Barley during Steeping. Toxins. 2023; 15(2):124. https://doi.org/10.3390/toxins15020124
Chicago/Turabian StyleFeizollahi, Ehsan, Urmila Basu, Rudolph Fredua-Agyeman, Brasathe Jeganathan, Lusine Tonoyan, Stephen E. Strelkov, Thava Vasanthan, Arno G. Siraki, and M. S. Roopesh. 2023. "Effect of Plasma-Activated Water Bubbles on Fusarium graminearum, Deoxynivalenol, and Germination of Naturally Infected Barley during Steeping" Toxins 15, no. 2: 124. https://doi.org/10.3390/toxins15020124
APA StyleFeizollahi, E., Basu, U., Fredua-Agyeman, R., Jeganathan, B., Tonoyan, L., Strelkov, S. E., Vasanthan, T., Siraki, A. G., & Roopesh, M. S. (2023). Effect of Plasma-Activated Water Bubbles on Fusarium graminearum, Deoxynivalenol, and Germination of Naturally Infected Barley during Steeping. Toxins, 15(2), 124. https://doi.org/10.3390/toxins15020124

