Evaluation and Characterization of the Insecticidal Activity and Synergistic Effects of Different GroEL Proteins from Bacteria Associated with Entomopathogenic Nematodes on Galleria mellonella
Abstract
1. Introduction
2. Results
2.1. Evaluation of the Insecticidal Activity of GroEL Proteins
2.2. Evaluation of the Phenoloxidase Activity

2.3. Protein Sequence and Structural Analysis
2.4. GroEL Interacts Cooperatively with ExoA to Increase Toxicity
3. Discussion
4. Materials and Methods
4.1. Maintenance of Insects
4.2. Cloning, Expression, and Purification of GroEL Proteins and ExoA
4.3. Evaluation of the Insecticidal Activity of GroEL Proteins
4.4. Sequence and Structure Analysis
4.5. Assessment of the Biochemical Activity of Chaperonin GroEL
4.6. In Vitro Phenoloxidase Activity Assay
4.7. Determination of the Synergistic Effect of GroEL with Exotoxin A
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Horwich, A.L.; Fenton, W.A.; Chapman, E.; Farr, W.G. Two families of chaperonin: Physiology and mechanism. Annu. Rev. Cell Dev. Biol. 2007, 23, 115–145. [Google Scholar] [CrossRef] [PubMed]
- Keskin, O.; Bahar, I.; Flatow, D.; Covell, D.G.; Jernigan, R.L. Molecular mechanisms of chaperonin GroEL-GroES function. Biochemistry 2002, 41, 491–501. [Google Scholar] [CrossRef] [PubMed]
- Hayer-Hartl, M.; Bracher, A.; Hartl, F.U. The GroEL-GroES chaperonin machine: A nano-cage for protein folding. Trends Biochem. Sci. 2016, 41, 62–76. [Google Scholar] [CrossRef]
- Bartolucci, C.; Lamba, D.; Grazulis, S.; Manakova, E.; Heumann, H. Crystal structure of wild-type chaperonin GroEL. J. Mol. Biol. 2005, 354, 940–951. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ricci, C.; Ortore, M.G.; Vilasi, S.; Carrotta, R.; Mangione, M.R.; Bulone, D.; Librizzi, F.; Spinozzi, F.; Burgio, G.; Amenitsch, H.; et al. Stability and disassembly properties of human naive Hsp60 and bacterial GroEL chaperonins. Biophys. Chem. 2016, 208, 68–75. [Google Scholar] [CrossRef]
- Kudryavtseva, S.S.; Pichkur, E.B.; Yaroshevich, I.A.; Mamchur, A.A.; Panina, I.S.; Moiseenko, A.V.; Sokolova, O.S.; Muronetz, V.I.; Stanishneva-Konovalova, T.B. Novel cryo-EM structure of an ADP-bound GroEL–GroES complex. Sci. Rep. 2021, 11, 18241. [Google Scholar] [CrossRef]
- Martin, J.; Mayhew, M.; Langer, T.; Hartl, U. The reaction cycle of GroEL and GroES in chaperonin-assisted protein folding. Nature 1993, 366, 228–233. [Google Scholar] [CrossRef]
- Kim, Y.E.; Hipp, M.S.; Bracher, A.; Hayer-Hartl, M.; Hartl, F.U. Molecular chaperone functions in protein folding and proteostasis. Annu. Rev. Biochem. 2013, 82, 323–355. [Google Scholar] [CrossRef]
- Horwich, A.L.; Fenton, W.A. Chaperonin-Mediated Protein Folding: Using a Central Cavity to Kinetically Assist Polypeptide Chain Folding. Q. Rev. Biophys. 2009, 42, 83–116. [Google Scholar] [CrossRef]
- Jeffery, C.J. Moonlighting Proteins. Trends Biochem. Sci. 1999, 24, 8–11. [Google Scholar] [CrossRef]
- Jeffery, C.J. Protein moonlighting: What is it, and why is it important? Philos. Trans. R. Soc. B Biol. Sci. 2018, 373, 20160523. [Google Scholar] [CrossRef] [PubMed]
- Henderson, B.; Fares, M.A.; Lund, P.A. Chaperonin 60: A Paradoxical, Evolutionarily Conserved Protein Family with Multiple Moonlighting Functions. Biol. Rev. 2013, 88, 955–987. [Google Scholar] [CrossRef] [PubMed]
- Kupper, M.; Gupta, S.K.; Feldhaar, H.; Gross, R. Versatile roles of the chaperonin GroEL in microorganism–insect interactions. FEMS Microbiol. Lett. 2014, 353, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, N.; Oeda, K.; Watanabe, E.; Mikami, T.; Fukita, Y.; Nishimura, K.; Komai, K.; Matsuda, K. Chaperonin Turned Insect Toxin. Nature 2001, 411, 44. [Google Scholar] [CrossRef]
- Khandelwal, P.; Choudhury, D.; Birah, A.; Reddy, M.K.; Gupta, G.P.; Banerjee, N. Insecticidal Pilin Subunit from the Insect Pathogen Xenorhabdus Nematophila. J. Bacteriol. 2004, 186, 6465–6476. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Joshi, M.C.; Sharma, A.; Kant, S.; Birah, A.; Gupta, G.P.; Khan, S.R.; Bhatnagar, R.; Banerjee, N. An Insecticidal GroEL Protein with Chitin Binding Activity from Xenorhabdus nematophila. J. Biol. Chem. 2008, 283, 28287–28296. [Google Scholar] [CrossRef]
- Shi, H.; Zeng, H.; Yang, X.; Zhao, J.; Chen, M.; Qiu, D. An Insecticidal Protein from Xenorhabdus ehlersii Triggers Prophenoloxidase Activation and Hemocyte Decrease in Galleria mellonella. Curr. Microbiol. 2012, 64, 604–610. [Google Scholar] [CrossRef]
- Yang, J.; Zeng, H.-M.; Lin, H.-F.; Yang, X.-F.; Liu, Z.; Guo, L.-H.; Yuan, J.-J.; Qiu, D.-W. An Insecticidal Protein from Xenorhabdus budapestensis That Results in Prophenoloxidase Activation in the Wax Moth, Galleria mellonella. J. Invertebr. Pathol. 2012, 110, 60–67. [Google Scholar] [CrossRef]
- García-Gómez, B.I.; Cano, S.N.; Zagal, E.E.; Dantán-Gonzalez, E.; Bravo, A.; Soberón, M. Insect Hsp90 Chaperone Assists Bacillus thuringiensis Cry Toxicity by Enhancing Protoxin Binding to the Receptor and by Protecting Protoxin from Gut Protease Degradation. MBio 2019, 10, 10–1128. [Google Scholar] [CrossRef]
- García-Gomez, B.I.; Sánchez, T.A.; Cano, S.N.; do Nascimento, N.A.; Bravo, A.; Soberón, M. Insect Chaperones Hsp70 and Hsp90 Cooperatively Enhance Toxicity of Bacillus thuringiensis Cry1A Toxins and Counteract Insect Resistance. Front. Immunol. 2023, 14, 1151943. [Google Scholar] [CrossRef]
- Quiroz-Castañeda, R.E.; Mendoza-Mejía, A.; Obregón-Barboza, V.; Martínez-Ocampo, F.; Hernández-Mendoza, A.; Martínez-Garduño, F.; Guillén-Solís, G.; Sánchez-Rodríguez, F.; Peña-Chora, G.; Ortíz-Hernández, L. Identification of a New Alcaligenes faecalis Strain MOR02 and Assessment of Its Toxicity and Pathogenicity to Insects. Biomed. Res. Int. 2015, 2015, 570243. [Google Scholar] [CrossRef]
- Rivera-Ramírez, A.; Salgado-Morales, R.; Jiménez-Pérez, A.; Pérez-Martínez, R.; García-Gómez, B.I.; Dantán-González, E. Comparative Genomics and Pathogenicity Analysis of Two Bacterial Symbionts of Entomopathogenic Nematodes: The Role of the GroEL Protein in Virulence. Microorganisms 2022, 10, 486. [Google Scholar] [CrossRef]
- Marieshwari, B.N.; Bhuvaragavan, S.; Sruthi, K.; Mullainadhan, P.; Janarthanan, S. Insect phenoloxidase and its diverse roles: Melanogenesis and beyond. J. Comp. Physiol. B 2023, 193, 1–23. [Google Scholar] [CrossRef]
- Cerenius, L.; Söderhäll, K. The Prophenoloxidase-activating System in Invertebrates. Immunol. Rev. 2004, 198, 116–126. [Google Scholar] [CrossRef]
- Waterhouse, A.; Procter, J.; Martin, D.; Clamp, M.; Barton, G. Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Zhang, Y. I-TASSER Server: New Development for Protein Structure and Function Predictions. Nucleic Acids Res. 2015, 43, W174–W181. [Google Scholar] [CrossRef] [PubMed]
- William, H. VMD-Visual Molecular Dynamics. J. Mol. Graph. 1996, 14, 33–38. [Google Scholar]
- Roberts, E.; Eargle, J.; Wright, D.; Luthey-Schulten, Z. MultiSeq: Unifying Sequence and Structure Data for Evolutionary Analysis. BMC Bioinform. 2006, 7, 382. [Google Scholar] [CrossRef] [PubMed]
- Hristozova, N.; Tompa, P.; Kovacs, D. A Novel Method for Assessing the Chaperone Activity of Proteins. PLoS ONE 2016, 11, e0161970. [Google Scholar] [CrossRef]



| Name | Sequence (5′→3′) | Reference | 
|---|---|---|
| GroELAF_Fw | CATATGACCGCAAAACAAGTTTACTTCG | [21] | 
| GroELAF_Rv | GAATTCTTAGAAGCCGCCCATACCACCCATGC | |
| GroELEc_Fw | CCATATGGCAGCTAAAGACGTAAAATTCG | |
| GroELEc_Rv | GAATTCATTACATCATGCCGCCCATGCCAC | |
| GroELPa_Fw | CATATGGCTGCCAAAGAAGTTAAGTTC | In this work | 
| GroELPa_Rv | GAATTCTTACATCATGCCGCCCATGC | |
| GroELPl_Fw | CATATGGCAGCTAAAGACGTAAAATTTGG | In this work | 
| GroELPl_Rv | GAATTCTTACATCATGCCGCCCATACCG | |
| GroELXn_Fw | CATATGGCAGCTAAAGACGTAAAATTTG | [22] | 
| GroELXn_Rv | GAATTCACATCATGCCGCCCATTCCAC | |
| ExoA_Fw | CATATGGCCGAGGAAGCCTTCGATCTCTCT | In this work | 
| ExoA_Rv | GAATTCTTACTTCAGGTCCTCG | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rivera-Ramírez, A.; Salgado-Morales, R.; Onofre-Lemus, J.; García-Gómez, B.I.; Lanz-Mendoza, H.; Dantán-González, E. Evaluation and Characterization of the Insecticidal Activity and Synergistic Effects of Different GroEL Proteins from Bacteria Associated with Entomopathogenic Nematodes on Galleria mellonella. Toxins 2023, 15, 623. https://doi.org/10.3390/toxins15110623
Rivera-Ramírez A, Salgado-Morales R, Onofre-Lemus J, García-Gómez BI, Lanz-Mendoza H, Dantán-González E. Evaluation and Characterization of the Insecticidal Activity and Synergistic Effects of Different GroEL Proteins from Bacteria Associated with Entomopathogenic Nematodes on Galleria mellonella. Toxins. 2023; 15(11):623. https://doi.org/10.3390/toxins15110623
Chicago/Turabian StyleRivera-Ramírez, Abraham, Rosalba Salgado-Morales, Janette Onofre-Lemus, Blanca I. García-Gómez, Humberto Lanz-Mendoza, and Edgar Dantán-González. 2023. "Evaluation and Characterization of the Insecticidal Activity and Synergistic Effects of Different GroEL Proteins from Bacteria Associated with Entomopathogenic Nematodes on Galleria mellonella" Toxins 15, no. 11: 623. https://doi.org/10.3390/toxins15110623
APA StyleRivera-Ramírez, A., Salgado-Morales, R., Onofre-Lemus, J., García-Gómez, B. I., Lanz-Mendoza, H., & Dantán-González, E. (2023). Evaluation and Characterization of the Insecticidal Activity and Synergistic Effects of Different GroEL Proteins from Bacteria Associated with Entomopathogenic Nematodes on Galleria mellonella. Toxins, 15(11), 623. https://doi.org/10.3390/toxins15110623
 
        


 
       