Co-Occurrence of Staphylococcus aureus and Ochratoxin A in Pasteurized Milk
Abstract
:1. Introduction
2. Results
2.1. Identification of S. aureus and Detection of Enterotoxin Genes
2.2. Occurrence of OTA in Pasteurized Milk
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Sampling
5.2. Isolation and Detection of S. aureus
5.3. Detection of OTA
5.3.1. OTA Extraction
5.3.2. LC-MS/MS Analysis
5.3.3. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Iqbal, S.Z.; Jinap, S.; Pirouz, A.A.; Ahmad Faizal, A.R. Aflatoxin M1 in Milk and Dairy Products, Occurrence and Recent Challenges: A Review. Trends Food Sci. Technol. 2015, 46, 110–119. [Google Scholar] [CrossRef]
- Mohammedi-Ameur, S.; Dahmane, M.; Brera, C.; Kardjadj, M.; Ben-Mahdi, M.H. Occurrence and Seasonal Variation of Aflatoxin M1 in Raw Cow Milk Collected from Different Regions of Algeria. Vet. World 2020, 13, 433–439. [Google Scholar] [CrossRef] [PubMed]
- Shahbazi, Y.; Ahmadi, F.; Fakhari, F. Voltammetric Determination of Pb, Cd, Zn, Cu and Se in Milk and Dairy Products Collected from Iran: An Emphasis on Permissible Limits and Risk Assessment of Exposure to Heavy Metals. Food Chem. 2016, 192, 1060–1067. [Google Scholar] [CrossRef]
- Bahrami, R.; Shahbazi, Y.; Nikousefat, Z. Aflatoxin M1 in Milk and Traditional Dairy Products from West Part of Iran: Occurrence and Seasonal Variation with an Emphasis on Risk Assessment of Human Exposure. Food Control 2016, 62, 250–256. [Google Scholar] [CrossRef]
- Younis, G.; Ibrahim, D.; Awad, A.; El Bardisy, M.M. Determination of Aflatoxin M1 and Ochratoxin A in Milk and Dairy Products in Supermarkets Located in Mansoura City, Egypt. Adv. Anim. Vet. Sci. 2016, 4, 114–121. [Google Scholar] [CrossRef]
- Becheva, Z.R.; Ivanov, Y.L.; Godjevargova, T.I.; Tchorbanov, A.I. Simultaneous Determination of Ochratoxin A and Enterotoxin A in Milk by Magnetic Nanoparticles Based Fluorescent Immunoassay. Food Addit. Contam. Part A 2021, 38, 1218–1236. [Google Scholar] [CrossRef]
- Dai, J.; Wu, S.; Huang, J.; Wu, Q.; Zhang, F.; Zhang, J.; Wang, J.; Ding, Y.; Zhang, S.; Yang, X.; et al. Prevalence and Characterization of Staphylococcus Aureus Isolated from Pasteurized Milk in China. Front. Microbiol. 2019, 10, 641. [Google Scholar] [CrossRef]
- Mehta, R.; Shetty, S.A.; Young, M.F.; Ryan, P.B.; Rangiah, K. Quantification of Aflatoxin and Ochratoxin Contamination in Animal Milk Using UHPLC-MS/SRM Method: A Small-Scale Study. J. Food Sci. Technol. 2021, 58, 3453–3464. [Google Scholar] [CrossRef] [PubMed]
- Hennekinne, J.-A.; De Buyser, M.-L.; Dragacci, S. Staphylococcus aureus and Its Food Poisoning Toxins: Characterization and Outbreak Investigation. FEMS Microbiol. Rev. 2012, 36, 815–836. [Google Scholar] [CrossRef] [Green Version]
- Bania, J.; Dabrowska, A.; Bystron, J.; Korzekwa, K.; Chrzanowska, J.; Molenda, J. Distribution of Newly Described Enterotoxin-like Genes in Staphylococcus Aureus from Food. Int. J. Food Microbiol. 2006, 108, 36–41. [Google Scholar] [CrossRef]
- Wu, S.; Huang, J.; Wu, Q.; Zhang, F.; Zhang, J.; Lei, T.; Chen, M.; Ding, Y.; Xue, L. Prevalence and Characterization of Staphylococcus Aureus Isolated from Retail Vegetables in China. Front. Microbiol. 2018, 9, 1263. [Google Scholar] [CrossRef]
- Bianchi, D.M.; Gallina, S.; Bellio, A.; Chiesa, F.; Civera, T.; Decastelli, L. Enterotoxin Gene Profiles of Staphylococcus aureus Isolated from Milk and Dairy Products in Italy. Lett. Appl. Microbiol. 2014, 58, 190–196. [Google Scholar] [CrossRef] [PubMed]
- Evenson, M.L.; Ward Hinds, M.; Bernstein, R.S.; Bergdoll, M.S. Estimation of Human Dose of Staphylococcal Enterotoxin A from a Large Outbreak of Staphylococcal Food Poisoning Involving Chocolate Milk. Int. J. Food Microbiol. 1988, 7, 311–316. [Google Scholar] [CrossRef]
- Asao, T.; Kumeda, Y.; Kawai, T.; Shibata, T.; Oda, H.; Haruki, K.; Nakazawa, H.; Kozaki, S. An Extensive Outbreak of Staphylococcal Food Poisoning Due to Low-Fat Milk in Japan: Estimation of Enterotoxin A in the Incriminated Milk and Powdered Skim Milk. Epidemiol. Infect. 2003, 130, 33–40. [Google Scholar] [CrossRef]
- Schmid, D.; Fretz, R.; Winter, P.; Mann, M.; Höger, G.; Stöger, A.; Ruppitsch, W.; Ladstätter, J.; Mayer, N.; de Martin, A.; et al. Outbreak of Staphylococcal Food Intoxication after Consumption of Pasteurized Milk Products, June 2007, Austria. Wien. Klin. Wochenschr. 2009, 121, 125–131. [Google Scholar] [CrossRef]
- Wu, S.; Duan, N.; Gu, H.; Hao, L.; Ye, H.; Gong, W.; Wang, Z. A Review of the Methods for Detection of Staphylococcus Aureus Enterotoxins. Toxins 2016, 8, 176. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grispoldi, L.; Massetti, L.; Sechi, P.; Iulietto, M.F.; Ceccarelli, M.; Karama, M.; Popescu, P.A.; Pandolfi, F.; Cenci-Goga, B.T. Short Communication: Characterization of Enterotoxin-Producing Staphylococcus Aureus Isolated from Mastitic Cows. J. Dairy Sci. 2019, 102, 1059–1065. [Google Scholar] [CrossRef] [Green Version]
- Malir, F.; Ostry, V.; Pfohl-Leszkowicz, A.; Malir, J.; Toman, J. Ochratoxin A: 50 Years of Research. Toxins 2016, 8, 191. [Google Scholar] [CrossRef] [Green Version]
- Frisvad, J.C.; Hubka, V.; Ezekiel, C.N.; Hong, S.-B.; Nováková, A.; Chen, A.J.; Arzanlou, M.; Larsen, T.O.; Sklenář, F.; Mahakarnchanakul, W.; et al. Taxonomy of Aspergillus Section Flavi and Their Production of Aflatoxins, Ochratoxins and Other Mycotoxins. Stud. Mycol. 2019, 93, 1–63. [Google Scholar] [CrossRef]
- Pfohl-Leszkowicz, A.; Manderville, R.A. An Update on Direct Genotoxicity as a Molecular Mechanism of Ochratoxin a Carcinogenicity. Chem. Res. Toxicol. 2012, 25, 252–262. [Google Scholar] [CrossRef]
- Zheng, J.; Zhang, Y.; Xu, W.; Luo, Y.; Hao, J.; Shen, X.L.; Yang, X.; Li, X.; Huang, K. Zinc Protects HepG2 Cells against the Oxidative Damage and DNA Damage Induced by Ochratoxin, A. Toxicol. Appl. Pharmacol. 2013, 268, 123–131. [Google Scholar] [CrossRef]
- Zhao, T.; Shen, X.L.; Chen, W.; Liao, X.; Yang, J.; Wang, Y.; Zou, Y.; Fang, C. Advances in Research of Nephrotoxicity and Toxic Antagonism of Ochratoxin, A. Toxin Rev. 2017, 36, 39–44. [Google Scholar] [CrossRef]
- Samuel, M.S.; Jeyaram, K.; Datta, S.; Chandrasekar, N.; Balaji, R.; Selvarajan, E. Detection, Contamination, Toxicity, and Prevention Methods of Ochratoxins: An Update Review. J. Agric. Food Chem. 2021, 69, 13974–13989. [Google Scholar] [CrossRef]
- Boudra, H.; Le Bars, P.; Le Bars, J. Thermostability of Ochratoxin A in Wheat under Two Moisture Conditions. Appl. Env. Microbiol. 1995, 61, 1156–1158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pinotti, L.; Ottoboni, M.; Giromini, C.; Dell’Orto, V.; Cheli, F. Mycotoxin Contamination in the EU Feed Supply Chain: A Focus on Cereal Byproducts. Toxins 2016, 8, 45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, P.; Mahato, D.K.; Sharma, B.; Borah, R.; Haque, S.; Mahmud, M.M.C.; Shah, A.K.; Rawal, D.; Bora, H.; Bui, S. Ochratoxins in Food and Feed: Occurrence and Its Impact on Human Health and Management Strategies. Toxicon 2020, 187, 151–162. [Google Scholar] [CrossRef]
- Tale, H.; Joshaghani, H.; Rahimzadeh, H.; Niknejad, F.; Kiaie, M. Ochratoxin a in Cow’s Milk Collected from Cattle Farms of Golestan Province. Med. Lab. J. 2016, 10, 13–16. [Google Scholar]
- Flores-Flores, M.E.; Lizarraga, E.; López de Cerain, A.; González-Peñas, E. Presence of Mycotoxins in Animal Milk: A Review. Food Control 2015, 53, 163–176. [Google Scholar] [CrossRef]
- Elzupir, A.O.; Makawi, S.; Elhussein, A.M. Determination of Aflatoxins and Ochratoxin a in Dairy Cattle Feed and Milk in Wad Medani, Sudan. J. Anim. Vet. Adv. 2009, 12, 2508–2511. [Google Scholar]
- Vitale, M.; Gaglio, S.; Galluzzo, P.; Cascone, G.; Piraino, C.; Di Marco Lo Presti, V.; Alduina, R. Antibiotic Resistance Profiling, Analysis of Virulence Aspects and Molecular Genotyping of Staphylococcus aureus Isolated in Sicily, Italy. Foodborne Pathog. Dis. 2018, 15, 177–185. [Google Scholar] [CrossRef] [Green Version]
- Bastos, C.P.; Bassani, M.T.; Mata, M.M.; Lopes, G.V.; da Silva, W.P. Prevalence and Expression of Staphylococcal Enterotoxin Genes in Staphylococcus Aureus Isolated from Food Poisoning Outbreaks. Can. J. Microbiol. 2017, 63, 834–840. [Google Scholar] [CrossRef] [Green Version]
- Seyoum, E.T.; Mekonene, T.K.; Woldetsadik, D.A.; Zewudie, B.M.; Gebreyes, W.A. Enterotoxin Gene Profile of Staphylococcus Aureus Isolates Recovered from Bovine Milk Produced in Central Ethiopia. J. Infect. Dev. Ctries. 2016, 10, 138–142. [Google Scholar] [CrossRef]
- Babić, M.; Pajić, M.; Radinović, M.; Boboš, S.; Bulajić, S.; Nikolić, A.; Velebit, B. Effects of Temperature Abuse on the Growth and Staphylococcal Enterotoxin A Gene (Sea) Expression of Staphylococcus aureus in Milk. Foodborne Pathog. Dis. 2019, 16, 282–289. [Google Scholar] [CrossRef] [PubMed]
- Duquenne, M.; Fleurot, I.; Aigle, M.; Darrigo, C.; Borezée-Durant, E.; Derzelle, S.; Bouix, M.; Deperrois-Lafarge, V.; Delacroix-Buchet, A. Tool for Quantification of Staphylococcal Enterotoxin Gene Expression in Cheese. Appl. Environ. Microbiol. 2010, 76, 1367–1374. [Google Scholar] [CrossRef] [Green Version]
- Necidová, L.; Janštová, B.; Karpíšková, R. Dynamics of Staphylococcal Enterotoxin Production in Model Experiments Simulating the Fresh Cheese Environment. Acta Vet. Brno 2012, 81, 391–396. [Google Scholar] [CrossRef] [Green Version]
- Ding, T.; Yu, Y.-Y.; Hwang, C.-A.; Dong, Q.-L.; Chen, S.-G.; Ye, X.-Q.; Liu, D.-H. Modeling the Effect of Water Activity, PH, and Temperature on the Probability of Enterotoxin A Production by Staphylococcus Aureus. J. Food Prot. 2016, 79, 148–152. [Google Scholar] [CrossRef] [PubMed]
- Schelin, J.; Susilo, Y.B.; Johler, S. Expression of Staphylococcal Enterotoxins under Stress Encountered during Food Production and Preservation. Toxins 2017, 9, 401. [Google Scholar] [CrossRef] [Green Version]
- Homsombat, T.; Boonyayatra, S.; Awaiwanont, N.; Pichpol, D. Effect of Temperature on the Expression of Classical Enterotoxin Genes among Staphylococci Associated with Bovine Mastitis. Pathogens 2021, 10, 975. [Google Scholar] [CrossRef]
- Rosengren, Å.; Lindblad, M.; Lindqvist, R. The Effect of Undissociated Lactic Acid on Staphylococcus Aureus Growth and Enterotoxin A Production. Int. J. Food Microbiol. 2013, 162, 159–166. [Google Scholar] [CrossRef]
- Zeaki, N.; Rådström, P.; Schelin, J. Evaluation of Potential Effects of NaCl and Sorbic Acid on Staphylococcal Enterotoxin A Formation. Microorganisms 2015, 3, 551–566. [Google Scholar] [CrossRef] [Green Version]
- Walker-York-Moore, L.; Moore, S.; Fox, E. Characterization of Enterotoxigenic Bacillus Cereus Sensu Lato and Staphylococcus Aureus Isolates and Associated Enterotoxin Production Dynamics in Milk or Meat-Based Broth. Toxins 2017, 9, 225. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Altafini, A.; Roncada, P.; Guerrini, A.; Minkoumba Sonfack, G.; Fedrizzi, G.; Caprai, E. Occurrence of Ochratoxin A in Different Types of Cheese Offered for Sale in Italy. Toxins 2021, 13, 540. [Google Scholar] [CrossRef] [PubMed]
- Ahmadi, E. Potential Public Health Risk Due to Consumption of Contaminated Bovine Milk with Aflatoxin M1 and Coxiella burnetii in the West of Iran. Int. J. Dairy Technol. 2020, 73, 479–485. [Google Scholar] [CrossRef]
- Turkoglu, C.; Keyvan, E. Determination of Aflatoxin M1 and Ochratoxin A in Raw, Pasteurized and UHT Milk in Turkey. Acta Sci. Vet. 2019, 47. [Google Scholar] [CrossRef] [Green Version]
- Mokhtari, S.A.; Nemati, A.; Fazlzadeh, M.; Moradi-Asl, E.; Ardabili, V.T.; Seddigh, A. Aflatoxin M1 in Distributed Milks in Northwestern Iran: Occurrence, Seasonal Variation, and Risk Assessment. Environ. Sci. Pollut. Res. 2022, 29, 41429–41438. [Google Scholar] [CrossRef] [PubMed]
- Ansari, F.; Pourjafar, H.; Christensen, L. A Study on the Aflatoxin M1 Rate and Seasonal Variation in Pasteurized Cow Milk from Northwestern Iran. Env. Monit. Assess. 2018, 191, 6. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.C.; Zheng, N.; Zheng, B.Q.; Wen, F.; Cheng, J.B.; Han, R.W.; Xu, X.M.; Li, S.L.; Wang, J.Q. Simultaneous Determination of Aflatoxin M1, Ochratoxin A, Zearalenone and α-Zearalenol in Milk by UHPLC–MS/MS. Food Chem. 2014, 146, 242–249. [Google Scholar] [CrossRef]
- Pattono, D.; Gallo, P.F.; Civera, T. Detection and Quantification of Ochratoxin A in Milk Produced in Organic Farms. Food Chem. 2011, 127, 374–377. [Google Scholar] [CrossRef]
- Boudra, H.; Barnouin, J.; Dragacci, S.; Morgavi, D.P. Aflatoxin M1 and Ochratoxin A in Raw Bulk Milk from French Dairy Herds. J. Dairy Sci. 2007, 90, 3197–3201. [Google Scholar] [CrossRef] [Green Version]
- Anna, B.E.; Monica, O.; Agneta, O.; Ira, P.; Karl, H. Ochratoxin A in Cow’s Milk and in Human Milk with Corresponding Human Blood Samples. J. AOAC Int. 1993, 76, 842–846. [Google Scholar] [CrossRef]
- Skaug, M.A. Analysis of Norwegian Milk and Infant Formulas for Ochratoxin, A. Food Addit. Contam. 1999, 16, 75–78. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vainio, H.; Heseltine, E.; Wilbourn, J. Report on an IARC Working Group Meeting on Some Naturally Occurring Substances. Int. J. Cancer 1993, 53, 535–537. [Google Scholar] [CrossRef] [PubMed]
- Mehrotra, M.; Wang, G.; Johnson, W.M. Multiplex PCR for Detection of Genes for Staphylococcus Aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance. J. Clin. Microbiol. 2000, 38, 1032–1035. [Google Scholar] [CrossRef] [PubMed]
Enterotoxin Gene | sea | seb | sec | sed | see |
---|---|---|---|---|---|
Number | 5 | 7 | 6 | 4 | 3 |
Proportion (%) | 17.24 | 24.14 | 20.69 | 13.79 | 10.34 |
Contamination Level of OTA (μg/L) | Total | ||||
---|---|---|---|---|---|
>0.049 and <1.0 | 1.0–5.0 | 5.0–10.0 | >10.0 | ||
Number | 21 | 2 | 3 | 5 | 31 |
Proportion (%) | 17.50 | 1.67 | 2.5 | 4.16 | 25.83 |
Country | Sample | Method of Analysis | LOD μg/kg | LOQ μg/kg | Prevalence (%) | Range (μg/L or μg/kg | Reference |
---|---|---|---|---|---|---|---|
China | raw cow milk | UHPLC-MS/MS | 0.004 | 0.012 | - | 0.0567–0.0841 | [47] |
liquid cow milk | 0.003 | 0.009 | 0.0268–0.0579 | [47] | |||
Italy | organic | LC-FD | - | 0.05 | 3/63 (4.8%) | 0.07–0.11 | [48] |
Sudan | raw cow milk | HPLC-UV | - | - | 1/5 (20%) | 0.000–2.730 | [29] |
France | raw cow milk | LC-FLD | - | - | 3/264 (1.1%) | 0.005–0.0066 | [49] |
Sweden | raw cow milk | HPLC-FD | - | - | 5/36 (14%) | 0.010–0.040 | [50] |
Norway | organic | LC-FLD | - | - | 5/47 (11%) | 0.015–0.028 | [51] |
conventional | 6/40 (15%) | 0.011–0.058 | [51] |
Gene | Primer | Sequence (5’-3’) | Size (bp) | Annealing Temperature (°C) | Reference |
---|---|---|---|---|---|
nuc | NUC-F | AGGGCAATACGCAAAGAGGTT | 592 | 62 | This work |
NUC-R | TGAATCAGCGTTGTCTTCGC | ||||
sea | SEA-F | TTGGAAACGGTTAAAACGAA | 120 | 50 | [53] |
SEA-R | GAACCTTCCCATCAAAAACA | ||||
seb | SEB-F | TCGCATCAAACTGACAAACG | 478 | 50 | [53] |
SEB-R | GCAGGTACTCTATAAGTGCC | ||||
sec | SEC-F | GACATAAAAGCTAGGAATTT | 257 | 50 | [53] |
SEC-R | AAATCGGATTAACATTATCC | ||||
sed | SED-F | CTAGTTTGGTAATATCTCCT | 317 | 50 | [53] |
SED-R | TAATGCTATATCTTATAGGG | ||||
see | SEE-F | TAGATAAAGTTAAAACAAGC | 170 | 50 | [53] |
SEE-R | TAACTTACCGTGGACCCTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Z.; Song, Y.; Ma, L.; Huang, K.; Liang, Z. Co-Occurrence of Staphylococcus aureus and Ochratoxin A in Pasteurized Milk. Toxins 2022, 14, 718. https://doi.org/10.3390/toxins14100718
Zhang Z, Song Y, Ma L, Huang K, Liang Z. Co-Occurrence of Staphylococcus aureus and Ochratoxin A in Pasteurized Milk. Toxins. 2022; 14(10):718. https://doi.org/10.3390/toxins14100718
Chicago/Turabian StyleZhang, Zhenzhen, Yanmin Song, Liyan Ma, Kunlun Huang, and Zhihong Liang. 2022. "Co-Occurrence of Staphylococcus aureus and Ochratoxin A in Pasteurized Milk" Toxins 14, no. 10: 718. https://doi.org/10.3390/toxins14100718