Neuroprotective and Anti—Neuroinflammatory Effects of a Poisonous Plant Croton tiglium Linn. Extract
Abstract
1. Introduction
2. Results
2.1. Anti-Neuroinflammatory Effect of CTE
2.2. Verification of the Anti-Neuroinflammatory Effect of CTE by Using Primary Microglia and Astrocytes
2.3. Alternative Activation of Microglia
2.4. Cytotoxicity Assay in Neuron
2.5. Neuroprotective Effect of CTE
2.6. Anti-Neuroinflammatory Effect of CTE is Crotonic Acid-Independent
2.7. Anti-Neuroinflammatory Effect of CTE Is MAPK-Dependent
3. Discussion
4. Conclusions
5. Materials and Methods
Author Contributions
Funding
Conflicts of Interest
References
- Sarkar, S.N.; Russell, A.E.; Engler-Chiurazzi, E.B.; Porter, K.N.; Simpkins, J.W. MicroRNAs and the genetic nexus of brain aging, neuroinflammation, neurodegeneration, and brain trauma. Aging Dis. 2019, 10, 329–352. [Google Scholar] [CrossRef] [PubMed]
- Song, G.J.; Suk, K. Pharmacological modulation of functional phenotypes of microglia in neurodegenerative diseases. Front. Aging Neurosci. 2017, 9, 139. [Google Scholar] [CrossRef] [PubMed]
- Schain, M.; Kreisl, W.C. Neuroinflammation in neurodegenerative disorders—A review. Curr. Neurol. Neurosci. Rep. 2017, 17, 25. [Google Scholar] [CrossRef] [PubMed]
- Manchikalapudi, A.L.; Chilakala, R.R.; Kalia, K.; Sunkaria, A. Evaluating the role of microglial cells in clearance of abeta from Alzheimer’s brain. ACS Chem. Neurosci. 2019, 10, 1149–1156. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; Le, W. Differential roles of M1 and M2 microglia in neurodegenerative diseases. Mol. Neurobiol. 2016, 53, 1181–1194. [Google Scholar] [CrossRef] [PubMed]
- Krasemann, S.; Madore, C.; Cialic, R.; Baufeld, C.; Calcagno, N.; El Fatimy, R.; Beckers, L.; O’Loughlin, E.; Xu, Y.; Fanek, Z.; et al. The TREM2-APOE pathway drives the transcriptional phenotype of dysfunctional microglia in neurodegenerative diseases. Immunity 2017, 47, 566–581.e569. [Google Scholar] [CrossRef]
- Jha, M.K.; Lee, W.H.; Suk, K. Functional polarization of neuroglia: Implications in neuroinflammation and neurological disorders. Biochem. Pharmacol. 2016, 103, 1–16. [Google Scholar] [CrossRef]
- Brown, G.C.; Neher, J.J. Microglial phagocytosis of live neurons. Nat. Rev. Neurosci. 2014, 15, 209–216. [Google Scholar] [CrossRef]
- Saputera, M.D.; Raharja, S.; Kardono, L.B.; Iswantini, D. Characteristics, efficacy and safety testing of standardized extract of Croton tiglium seed from Indonesia as laxative material. Pak. J. Biol. Sci. 2008, 11, 618–622. [Google Scholar]
- Tsai, J.C.; Tsai, S.; Chang, W.C. Effect of ethanol extracts of three Chinese medicinal plants with laxative properties on ion transport of the rat intestinal epithelia. Biol. Pharm. Bull. 2004, 27, 162–165. [Google Scholar] [CrossRef]
- Morimura, K. The role of special group article in ancient Chinese medical prescription. Hist. Sci. (Tokyo) 2003, 13, 1–12. [Google Scholar] [PubMed]
- Wang, X.; Lan, M.; Wu, H.P.; Shi, Y.Q.; Lu, J.; Ding, J.; Wu, K.C.; Jin, J.P.; Fan, D.M. Direct effect of croton oil on intestinal epithelial cells and colonic smooth muscle cells. World J. Gastroenterol. 2002, 8, 103–107. [Google Scholar] [CrossRef]
- Liu, Z.; Gao, W.; Zhang, J.; Hu, J. Antinociceptive and smooth muscle relaxant activity of Croton tiglium L. seed: An in-vitro and in-vivo study. Iran. J. Pharm. Res. 2012, 11, 611–620. [Google Scholar]
- Lin, H.C.; Kuo, Y.L.; Lee, W.J.; Yap, H.Y.; Wang, S.H. Antidermatophytic activity of ethanolic extract from Croton tiglium. Biomed. Res. Int. 2016, 2016, 3237586. [Google Scholar] [CrossRef] [PubMed]
- Shahid, M.; Tayyab, M.; Naz, F.; Jamil, A.; Ashraf, M.; Gilani, A.H. Activity-guided isolation of a novel protein from Croton tiglium with antifungal and antibacterial activities. Phytother. Res. 2008, 22, 1646–1649. [Google Scholar] [CrossRef] [PubMed]
- Mahmoud Aboulthana, W.; Youssef, A.; M El-Feky, A.; El-Sayed Ibrahim, N.; M Seif, M.; Kamal Hassan, A. Evaluation of antioxidant efficiency of Croton tiglium L. seeds extracts after incorporating silver nanoparticles. Egypt. J. Chem. 2019, 62, 181–200. [Google Scholar] [CrossRef]
- Glass, C.K.; Saijo, K.; Winner, B.; Marchetto, M.C.; Gage, F.H. Mechanisms underlying inflammation in neurodegeneration. Cell 2010, 140, 918–934. [Google Scholar] [CrossRef] [PubMed]
- Cho, K.S.; Lee, J.H.; Cho, J.; Cha, G.H.; Song, G.J. Autophagy modulators and neuroinflammation. Curr. Med. Chem. 2018. [Google Scholar] [CrossRef]
- Subhramanyam, C.S.; Wang, C.; Hu, Q.; Dheen, S.T. Microglia-mediated neuroinflammation in neurodegenerative diseases. Semin. Cell Dev. Biol. 2019, 94, 112–120. [Google Scholar] [CrossRef]
- Franco, R.; Fernandez-Suarez, D. Alternatively activated microglia and macrophages in the central nervous system. Prog. Neurobiol. 2015, 131, 65–86. [Google Scholar] [CrossRef]
- Sinsinwar, S.; Paramasivam, I.; Muthuraman, M.S. An overview of the biological and chemical perspectives of Croton tiglium. Der. Pharm. Lett. 2016, 8, 324–328. [Google Scholar]
- Li, Y.Z.; Yu, S.; Yan, P.A.; Gong, D.Y.; Wu, F.L.; He, Z.; Yuan, Y.Y.; Zhao, A.Y.; Tang, X.; Zhang, R.Q.; et al. Crotonoside exhibits selective post-inhibition effect in AML cells via inhibition of FLT3 and HDAC3/6. Oncotarget 2017, 8, 103087–103099. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Ye, J.; Chen, X.; Shi, J.; Wu, W.; Lin, W.; Lin, W.; Li, Y.; Fu, H.; Li, S. Valproic acid attenuates traumatic spinal cord injury-induced inflammation via STAT1 and NF-kappaB pathway dependent of HDAC3. J. Neuroinflammation 2018, 15, 150. [Google Scholar] [CrossRef] [PubMed]
- Stefano, L.; Al Sarraj, J.; Rossler, O.G.; Vinson, C.; Thiel, G. Up-regulation of tyrosine hydroxylase gene transcription by tetradecanoylphorbol acetate is mediated by the transcription factors Ets-like protein-1 (Elk-1) and Egr-1. J. Neurochem. 2006, 97, 92–104. [Google Scholar] [CrossRef] [PubMed]
- Choe, Y.; Lee, B.J.; Kim, K. Participation of protein kinase C alpha isoform and extracellular signal-regulated kinase in neurite outgrowth of GT1 hypothalamic neurons. J. Neurochem. 2002, 83, 1412–1422. [Google Scholar] [CrossRef]
- Du, Q.; Zhao, Y.; Liu, H.; Tang, C.; Zhang, M.; Ke, C.; Ye, Y. Isolation and structure characterization of cytotoxic Phorbol esters from the seeds of Croton tiglium. Planta Med. 2017, 83, 1361–1367. [Google Scholar] [CrossRef]
- Xu, Z.; Han, K.; Chen, J.; Wang, C.; Dong, Y.; Yu, M.; Bai, R.; Huang, C.; Hou, L. Vascular endothelial growth factor is neuroprotective against ischemic brain injury by inhibiting scavenger receptor A expression on microglia. J. Neurochem. 2017, 142, 700–709. [Google Scholar] [CrossRef]
- Liu, L.; Yu, H.; Wu, H.; Yang, X.; Pan, Y.; Chen, Y.; Wang, K.; Wang, W.; Zhang, W.; Jin, Y.; et al. Toxic proteins from Croton tiglium L. exert a proinflammatory effect by inducing release of proinflammatory cytokines and activating the p38-MAPK signaling pathway. Mol. Med. Rep. 2017, 16, 631–638. [Google Scholar] [CrossRef]
- Colombo, E.; Farina, C. Astrocytes: Key regulators of neuroinflammation. Trends Immunol. 2016, 37, 608–620. [Google Scholar] [CrossRef]
- De Lucia, C.; Rinchon, A.; Olmos-Alonso, A.; Riecken, K.; Fehse, B.; Boche, D.; Perry, V.H.; Gomez-Nicola, D. Microglia regulate hippocampal neurogenesis during chronic neurodegeneration. Brain Behav. Immun. 2016, 55, 179–190. [Google Scholar] [CrossRef]
- Valero, J.; Bernardino, L.; Cardoso, F.L.; Silva, A.P.; Fontes-Ribeiro, C.; Ambrosio, A.F.; Malva, J.O. Impact of neuroinflammation on hippocampal neurogenesis: Relevance to aging and Alzheimer’s disease. J. Alzheimers Dis. 2017, 60, S161–S168. [Google Scholar] [CrossRef] [PubMed]
- Ryan, S.M.; Nolan, Y.M. Neuroinflammation negatively affects adult hippocampal neurogenesis and cognition: Can exercise compensate? Neurosci. Biobehav. Rev. 2016, 61, 121–131. [Google Scholar] [CrossRef] [PubMed]
- Neumann, H. Molecular mechanisms of axonal damage in inflammatory central nervous system diseases. Curr. Opin. Neurol. 2003, 16, 267–273. [Google Scholar] [CrossRef] [PubMed]
- Yong, H.Y.F.; Rawji, K.S.; Ghorbani, S.; Xue, M.; Yong, V.W. The benefits of neuroinflammation for the repair of the injured central nervous system. Cell. Mol. Immunol. 2019, 16, 540–546. [Google Scholar] [CrossRef]
- Vay, S.U.; Flitsch, L.J.; Rabenstein, M.; Rogall, R.; Blaschke, S.; Kleinhaus, J.; Reinert, N.; Bach, A.; Fink, G.R.; Schroeter, M.; et al. The plasticity of primary microglia and their multifaceted effects on endogenous neural stem cells in vitro and in vivo. J. Neuroinflammation 2018, 15, 226. [Google Scholar] [CrossRef]
- Sun, G.Y.; Chen, Z.; Jasmer, K.J.; Chuang, D.Y.; Gu, Z.; Hannink, M.; Simonyi, A. Quercetin attenuates inflammatory responses in BV-2 microglial cells: Role of MAPKs on the Nrf2 pathway and induction of heme oxygenase-1. PLoS ONE 2015, 10, e0141509. [Google Scholar] [CrossRef]
- Yu, T.; Yu, H.; Zhang, B.; Wang, D.; Li, B.; Zhu, J.; Zhu, W. Promising neuroprotective function for M2 microglia in kainic acid-induced neurotoxicity via the down-regulation of NF-kappaB and Caspase 3 signaling pathways. Neuroscience 2019, 406, 86–96. [Google Scholar] [CrossRef]
- Meng, J.; Ni, J.; Wu, Z.; Jiang, M.; Zhu, A.; Qing, H.; Nakanishi, H. The critical role of IL-10 in the antineuroinflammatory and antioxidative effects of rheum tanguticum on activated microglia. Oxidative Med. Cell. Longev. 2018, 2018, 1083596. [Google Scholar] [CrossRef]
- Ekdahl, C.T.; Kokaia, Z.; Lindvall, O. Brain inflammation and adult neurogenesis: The dual role of microglia. Neuroscience 2009, 158, 1021–1029. [Google Scholar] [CrossRef]
- Song, G.J.; Nam, Y.; Jo, M.; Jung, M.; Koo, J.Y.; Cho, W.; Koh, M.; Park, S.B.; Suk, K. A novel small-molecule agonist of PPAR-gamma potentiates an anti-inflammatory M2 glial phenotype. Neuropharmacology 2016, 109, 159–169. [Google Scholar] [CrossRef]
- Cheepsunthorn, P.; Radov, L.; Menzies, S.; Reid, J.; Connor, J.R. Characterization of a novel brain-derived microglial cell line isolated from neonatal rat brain. Glia 2001, 35, 53–62. [Google Scholar] [CrossRef] [PubMed]
- Song, G.J.; Jeon, H.; Seo, M.; Jo, M.; Suk, K. Interaction between optineurin and Rab1a regulates autophagosome formation in neuroblastoma cells. J. Neurosci. Res. 2018, 96, 407–415. [Google Scholar] [CrossRef] [PubMed]
- Song, G.J.; Rahman, M.H.; Jha, M.K.; Gupta, D.P.; Park, S.H.; Kim, J.-H.; Lee, S.-H.; Lee, I.-K.; Sim, T.; Bae, Y.C.; et al. A Bcr-Abl inhibitor GNF-2 attenuates inflammatory activation of glia and chronic pain. Front. Pharmacol. 2019, 10, 543. [Google Scholar] [CrossRef] [PubMed]







| Target Genes | Accession Number | Forward Primer (5’-3’) | Reverse Primer (5’-3’) | Temp (°C) | Cycles |
|---|---|---|---|---|---|
| TNF-α | NM_013693.2 | CATCTTCTCAAAATTCGAGTGACAA | ACTTGGGCAGATTGACCTCAG | 60 | 25 |
| iNOS | NM_010927.3 | CCCTTCCGAAGTTTCTGGCAGCAGC | GGCTGTCAGAGCCTCGTGGCTTTGG | 70 | 30 |
| Arg-1 | NM_007482 | CGCCTTTCTCAAAAGGACAG | CCAGCTCTTCATTGGCTTTC | 60 | 29 |
| BDNF | NM_007540.4 | CGCAAACATGTCTATGAGGGTTC | TAGTAAGGGCCCGAACATACGAT | 60 | 30 |
| GAPDH | NM_008084 | ACCACAGTCCATGCCATCAC | TCCACCACCCTGTTGCTGTA | 60 | 25 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gupta, D.P.; Park, S.H.; Yang, H.-J.; Suk, K.; Song, G.J. Neuroprotective and Anti—Neuroinflammatory Effects of a Poisonous Plant Croton tiglium Linn. Extract. Toxins 2020, 12, 261. https://doi.org/10.3390/toxins12040261
Gupta DP, Park SH, Yang H-J, Suk K, Song GJ. Neuroprotective and Anti—Neuroinflammatory Effects of a Poisonous Plant Croton tiglium Linn. Extract. Toxins. 2020; 12(4):261. https://doi.org/10.3390/toxins12040261
Chicago/Turabian StyleGupta, Deepak Prasad, Sung Hee Park, Hyun-Jeong Yang, Kyoungho Suk, and Gyun Jee Song. 2020. "Neuroprotective and Anti—Neuroinflammatory Effects of a Poisonous Plant Croton tiglium Linn. Extract" Toxins 12, no. 4: 261. https://doi.org/10.3390/toxins12040261
APA StyleGupta, D. P., Park, S. H., Yang, H.-J., Suk, K., & Song, G. J. (2020). Neuroprotective and Anti—Neuroinflammatory Effects of a Poisonous Plant Croton tiglium Linn. Extract. Toxins, 12(4), 261. https://doi.org/10.3390/toxins12040261

