Nephrotoxic Effects in Zebrafish after Prolonged Exposure to Aristolochic Acid
Abstract
1. Introduction
2. Results
2.1. Aristolochic Acid I (AAI) Causes Toxic and Lethal Effects in ZF
2.2. AAI Causes Morphological Kidney Injury
2.3. AA Causes Histological Changes in the Kidney
2.4. AAI Does Not Induce Gene Expression of Fibrogenesis Biomarkers
2.5. AAI Causes Functional Damage to the Kidney
2.6. AAI-Treatment of Tert−/− Zebrafish Larvae
3. Discussion
4. Materials and Methods
4.1. Zebrafish Lines, Husbandry, and Chemicals
4.2. Aristolochic Acid I Treatment
4.3. Generation of Tg(nphs2:mCherry) and Tg(enpep:EGFP) Transgenic Zebrafish Lines
4.4. Morphological Phenotyping and Lethality
4.5. Whole-Mount Imaging
4.6. Histological Analysis
4.7. Quantification of Gene Expression
4.8. Renal Function Assessment
4.9. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Humphreys, B.D. Mechanisms of Renal Fibrosis. Annual Review of Physiol. 2018, 80, 309–326. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Norman, J.T.; Shrivastav, S.; Lucio-Cazana, J.; Kopp, J.B. In Vitro Models of TGF-β-Induced FIbrosis Suitable for High-Throughput Screening of Antifibrotic Agents. Ren. Physiol. 2007, 293, 631–640. [Google Scholar] [CrossRef] [PubMed]
- Traykova-Brauch, M.; Schönig, K.; Greiner, O.; Miloud, T.; Jauch, A.; Bode, M.; Felsher, D.W.; Glick, A.B.; Kwiatkowski, D.J.; Bujard, H.; et al. An Efficient and Versatile System for Acute and Chronic Modulation of Renal Tubular Function in Transgenic Mice. Nat. Med. 2008, 14, 979–984. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Klimova, E.; Aparicio-Trejo, O.E.; Tapia, E.; Pedraza-Chaverri, J. Unilateral Ureteral Obstruction as a Model to Investigate Fibrosis-Attenuating Treatments. Biomolecules 2019, 9, 141. [Google Scholar] [CrossRef] [PubMed]
- Diwan, V.; Brown, L.; Gobe, G.C. Adenine-Induced Chronic Kidney Disease in Rats. Nephrol. 2018, 23, 5–11. [Google Scholar] [CrossRef]
- Jiang, K.; Ponzo, T.A.; Tang, H.; Mishra, P.K.; Macura, S.I.; Lerman, L.O. Multiparametric MRI Detects Longitudinal Evolution of Folic Acid-Induced Nephropathy in Mice. Am. J. Physiol.-Ren. Physiol. 2018, 315, F1252–F1260. [Google Scholar] [CrossRef]
- Debelle, F.D.; Nortier, J.L.; Prez, E.G.D.; Garbar, C.H.; Vienne, A.R.; Salmon, I.J.; Deschodt-Lanckman, M.M.; Vanherweghem, J.L. Aristolochic Acids Induce Chronic Renal Failure with Interstitial Fibrosis in Salt-Depleted Rats. J. Am. Soc. Nephrol. 2002, 13, 431–436. [Google Scholar]
- Jadot, I.; Colombaro, V.; Martin, B.; Habsch, I.; Botton, O.; Nortier, J.; Declèves, A.-E.; Caron, N. Restored Nitric Oxide Bioavailability Reduces the Severity of Acute-to-Chronic Transition in a Mouse Model of Aristolochic Acid Nephropathy. PLoS ONE 2017, 12, e0183604. [Google Scholar] [CrossRef]
- Vanherweghem, J.L.; Depierreux, M.; Tielemans, C.; Abramowicz, D.; Dratwa, M.; Jadoul, M.; Richard, C.; Vandervelde, D.; Verbeelen, D.; Vanhaelen-Fastre, R. Rapidly Progressive Interstitial Renal Fibrosis in Young Women: Association with Slimming Regimen Including Chinese Herbs. Lancet 1993, 341, 387–391. [Google Scholar] [CrossRef]
- Jadot, I.; Declèves, A.E.; Nortier, J.; Caron, N. An Integrated View of Aristolochic Acid Nephropathy: Update of the Literature. Int. J. Mol. Sci. 2017, 18, 297. [Google Scholar] [CrossRef]
- Chan, W.; Pavlović, N.M.; Li, W.; Chan, C.K.; Liu, J.; Deng, K.; Wang, Y.; Milosavljević, B.; Kostić, E.N. Quantitation of Aristolochic Acids in Corn, Wheat Grain, and Soil Samples Collected in Serbia: Identifying a Novel Exposure Pathway in the Etiology of Balkan Endemic Nephropathy. J. Agric. Food Chem. 2016, 64, 5928–5934. [Google Scholar] [CrossRef]
- Li, W.; Chan, C.-K.; Liu, Y.; Yao, J.; Mitić, B.; Kostić, E.N.; Milosavljević, B.; Davinić, I.; Orem, W.H.; Tatu, C.A.; et al. Aristolochic Acids as Persistent Soil Pollutants: Determination of Risk for Human Exposure and Nephropathy from Plant Uptake. J. Agric. Food Chem. 2018, 66, 11468–11476. [Google Scholar] [CrossRef] [PubMed]
- Chan, C.K.; Pavlović, N.M.; Chan, W. Development of a Novel Liquid Chromatography-Tandem Mass Spectrometric Method for Aristolochic Acids Detection: Application in Food and Agricultural Soil Analyses. Food Chem. 2019, 289, 673–679. [Google Scholar] [CrossRef] [PubMed]
- Tung, K.K.; Chan, C.K.; Zhao, Y.; Chan, K.K.J.; Liu, G.; Pavlović, N.M.; Chan, W. Occurrence and Environmental Stability of Aristolochic Acids in Groundwater Collected from Serbia: Links to Human Exposure and Balkan Endemic Nephropathy. Environ. Sci. Technol. 2020, 54, 1554–1561. [Google Scholar] [CrossRef] [PubMed]
- Pozdzik, A.A.; Salmon, I.J.; Debelle, F.D.; Decaestecker, C.; Van den Branden, C.; Verbeelen, D.; Deschodt-Lanckman, M.M.; Vanherweghem, J.L.; Nortier, J.L. Aristolochic Acid Induces Proximal Tubule Apoptosis and Epithelial to Mesenchymal Transformation. Kidney Int. 2008, 73, 595–607. [Google Scholar] [CrossRef] [PubMed]
- Lebeau, C.; Debelle, F.D.; Arlt, V.M.; Pozdzik, A.; De Prez, E.G.; Phillips, D.H.; Deschodt-Lanckman, M.M.; Vanherweghem, J.L.; Nortier, J.L. Early Proximal Tubule Injury in Experimental Aristolochic Acid Nephropathy: Functional and Histological Studies. Nephrol. Dial. Transplant. 2005, 20, 2321–2332. [Google Scholar] [CrossRef]
- Gorgulho, R.; Jacinto, R.; Lopes, S.S.; Pereira, S.A.; Tranfield, E.M.; Martins, G.G.; Gualda, E.J.; Derks, R.J.E.; Correia, A.C.; Steenvoorden, E.; et al. Usefulness of Zebrafish Larvae to Evaluate Drug-Induced Functional and Morphological Renal Tubular Alterations. Arch. Toxicol. 2018, 92, 411–423. [Google Scholar] [CrossRef]
- Cully, M. Zebrafish Earn Their Drug Discovery Stripes. Nat. Rev. Drug Discov. 2019, 18, 811–813. [Google Scholar] [CrossRef]
- Ding, Y.J.; Chen, Y.H. Developmental Nephrotoxicity of Aristolochic Acid in a Zebrafish Model. Toxicol. Appl. Pharmacol. 2012, 261, 59–65. [Google Scholar] [CrossRef]
- Wang, X.; Liu, K.C.; Sun, G.J.; Han, L.W.; Wang, R.C.; Peng, W.B.; Sun, C.; Hsiao, C.D.; Zhang, Y.; Hou, H.R. Evaluation of Nephrotoxic Effects of Aristolochic Acid on Zebrafish (Danio Rerio) Larvae. Hum. & Exp. Toxicol. 2016, 35, 974–982. [Google Scholar] [CrossRef]
- Gemberling, M.; Bailey, T.J.; Hyde, D.R.; Poss, K.D. The Zebrafish as a Model for Complex Tissue Regeneration. Trends Genet. 2013, 29, 611–620. [Google Scholar] [CrossRef] [PubMed]
- Henriques, C.M.; Carneiro, M.C.; Tenente, I.M.; Jacinto, A.; Ferreira, M.G. Telomerase Is Required for Zebrafish Lifespan. PLoS Genet. 2013, 9, e1003214. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.M.; Tang, P.M.K.; Li, J.; Lan, H.Y. TGF-β/Smad Signaling in Renal Fibrosis. Front. Physiol. 2015, 6, 82. [Google Scholar] [CrossRef]
- Mehta, N.; Krepinsky, J.C. The Emerging Role of Activins in Renal Disease. Curr. Opin. Nephrol. Hypertens. 2020, 29, 136–144. [Google Scholar] [CrossRef] [PubMed]
- Szóstek-Mioduchowska, A.Z.; Lukasik, K.; Skarzynski, D.J.; Okuda, K. Effect of Transforming Growth Factor -Β1 on α-Smooth Muscle Actin and Collagen Expression in Equine Endometrial Fibroblasts. Theriogenol. 2019, 124, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.H.; Lv, L.L.; Zhang, X.; Hu, H.; Ding, L.H.; Yin, D.; Zhang, Y.Z.; Ni, H.F.; Chen, P.S.; Liu, B.C. Urinary Vimentin MRNA as a Potential Novel Biomarker of Renal Fibrosis. Am. J. Physiol. Ren. Physiol. 2015, 309, F514–F522. [Google Scholar] [CrossRef] [PubMed]
- Ling, L.; Chen, L.; Zhang, C.; Gui, S.; Zhao, H.; Li, Z. High Glucose Induces Podocyte Epithelial-to-mesenchymal Transition by Demethylation-mediated Enhancement of MMP9 Expression. Mol. Med. Rep. 2018, 17, 5642–5651. [Google Scholar] [CrossRef]
- Lin, C.Y.; Tsai, P.H.; Kandaswami, C.C.; Lee, P.P.; Huang, C.J.; Hwang, J.J.; Lee, M.T. Matrix Metalloproteinase-9 Cooperates with Transcription Factor Snail to Induce Epithelial–Mesenchymal Transition. Cancer Sci. 2011, 102, 815–827. [Google Scholar] [CrossRef]
- Zhou, W.; Hildebrandt, F. Inducible Podocyte Injury and Proteinuria in Transgenic Zebrafish. J. Am. Soc. Nephrol. 2012, 23, 1039–1047. [Google Scholar] [CrossRef]
- Hanke, N.; King, B.L.; Vaske, B.; Haller, H.; Schiffer, M. A Fluorescence-Based Assay for Proteinuria Screening in Larval Zebrafish (Danio Rerio). Zebrafish 2015, 12, 372–376. [Google Scholar] [CrossRef]
- McCampbell, K.K.; Wingert, R.A. Using Zebrafish to Study Renal Regeneration. Transl. Res. 2014, 163, 109–122. [Google Scholar] [CrossRef] [PubMed]
- McCampbell, K.K.; Springer, K.N.; Wingert, R.A. Atlas of Cellular Dynamics during Zebrafish Adult Kidney Regeneration. St. Cells Int. 2015, 2015, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Carneiro, M.C.; de Castro, I.P.; Ferreira, M.G. Telomeres in Aging and Disease: Lessons from Zebrafish. Dis Model Mech. 2016, 9, 737–748. [Google Scholar] [CrossRef] [PubMed]
- Anchelin, M.; Alcaraz-Pérez, F.; Martínez, C.M.; Bernabé-García, M.; Mulero, V.; Cayuela, M.L. Premature Aging in Telomerase-Deficient Zebrafish. Dis. Models & Mech. 2013, 6, 1101–1112. [Google Scholar] [CrossRef]
- Shubin, A.V.; Demidyuk, I.V.; Komissarov, A.A.; Rafieva, L.M.; Kostrov, S.V. Cytoplasmic Vacuolization in Cell Death and Survival. Oncotarget 2016, 7, 55863–55889. [Google Scholar] [CrossRef]
- Zhou, W.; Boucher, R.C.; Bollig, F.; Englert, C.; Hildebrandt, F. Characterization of Mesonephric Development and Regeneration Using Transgenic Zebrafish. Am. J. Physiol. Ren. Physiol. 2010, 299, F1040–F1047. [Google Scholar] [CrossRef]
- Dickman, K.G.; Sweet, D.H.; Bonala, R.; Ray, T.; Wu, A. Physiological and Molecular Characterization of Aristolochic Acid Transport by the Kidney. J. Pharmacol. Exp. Ther. 2011, 338, 588–597. [Google Scholar] [CrossRef]
- Dragojević, J.; Mihaljević, I.; Popović, M.; Zaja, R.; Smital, T. In Vitro Characterization of Zebrafish (Danio Rerio) Organic Anion Transporters Oat2a-e. Toxicol. In Vitro 2018, 46, 246–256. [Google Scholar] [CrossRef]
- Cruz-Solbes, A.S.; Youker, K. Epithelial to Mesenchymal Transition (EMT) and Endothelial to Mesenchymal Transition (EndMT): Role and Implications in Kidney Fibrosis. In Kidney Development and Disease; Miller, R.K., Ed.; Results and Problems in Cell Differentiation; Springer International Publishing: Cham, Switzerland, 2017; pp. 345–372. [Google Scholar] [CrossRef]
- Johnson, C.S.; Holzemer, N.F.; Wingert, R.A. Laser Ablation of the Zebrafish Pronephros to Study Renal Epithelial Regeneration. J. Vis. Exp. 2011, e2845. [Google Scholar] [CrossRef]
- Diep, C.Q.; Ma, D.; Deo, R.C.; Holm, T.M.; Naylor, R.W.; Arora, N.; Wingert, R.A.; Bollig, F.; Djordjevic, G.; Lichman, B.; et al. Identification of Adult Nephron Progenitors Capable of Kidney Regeneration in Zebrafish. Nature 2011, 470, 95–100. [Google Scholar] [CrossRef]
- Gallegos, T.F.; Kamei, C.N.; Rohly, M.; Drummond, I.A. Fibroblast Growth Factor Signaling Mediates Progenitor Cell Aggregation and Nephron Regeneration in the Adult Zebrafish Kidney. Dev. Biol. 2019, 454, 44–51. [Google Scholar] [CrossRef] [PubMed]
- Teichroeb, J.H.; Kim, J.; Betts, D.H. The Role of Telomeres and Telomerase Reverse Transcriptase Isoforms in Pluripotency Induction and Maintenance. RNA Biol. 2016, 13, 707–719. [Google Scholar] [CrossRef] [PubMed]
- Bednarek, D.; González-Rosa, J.M.; Guzmán-Martínez, G.; Gutiérrez-Gutiérrez, Ó.; Aguado, T.; Sánchez-Ferrer, C.; Marques, I.J.; Galardi-Castilla, M.; de Diego, I.; Gómez, M.J.; et al. Telomerase Is Essential for Zebrafish Heart Regeneration. Cell Rep. 2015, 12, 1691–1703. [Google Scholar] [CrossRef] [PubMed]
- Povedano, J.M.; Martinez, P.; Flores, J.M.; Mulero, F.; Blasco, M.A. Mice with Pulmonary Fibrosis Driven by Telomere Dysfunction. Cell Rep. 2015, 12, 286–299. [Google Scholar] [CrossRef] [PubMed]
- Sourbron, J.; Schneider, H.; Kecskés, A.; Liu, Y.; Buening, E.M.; Lagae, L.; Smolders, I.; de Witte, P. Serotonergic Modulation as Effective Treatment for Dravet Syndrome in a Zebrafish Mutant Model. ACS Chem. Neurosci. 2016, 7, 588–598. [Google Scholar] [CrossRef] [PubMed]
- Seiler, C.; Pack, M. Transgenic Labeling of the Zebrafish Pronephric Duct and Tubules Using a Promoter from the Enpep Gene. Gene Expr. Patterns 2011, 11, 118–121. [Google Scholar] [CrossRef] [PubMed]
- Siekierska, A.; Stamberger, H.; Deconinck, T.; Oprescu, S.N.; Partoens, M.; Zhang, Y.; Sourbron, J.; Adriaenssens, E.; Mullen, P.; Wiencek, P.; et al. Biallelic VARS Variants Cause Developmental Encephalopathy with Microcephaly That Is Recapitulated in Vars Knockout Zebrafish. Nat Commun 2019, 10, 708. [Google Scholar] [CrossRef] [PubMed]
- Bauman, T.M.; Nicholson, T.M.; Abler, L.L.; Eliceiri, K.W.; Huang, W.; Vezina, C.M.; Ricke, W.A. Characterization of Fibrillar Collagens and Extracellular Matrix of Glandular Benign Prostatic Hyperplasia Nodules. PLoS ONE 2014, 9. [Google Scholar] [CrossRef]









| Gene | Primer Sequence (5’→3’) |
|---|---|
| 18s: FW | TCGCTAGTTGGCATCGTTTATG |
| 18s: RV | CGGAGGTTCGAAGACGATCA |
| acta2: FW | ACTGTGTAAGGCAGGCTTCG |
| acta2: RV | CACACGGAGCTCGTTGTAGA |
| vim: FW | CCATGGAGGCGTCTGGTTAT |
| vim: RV | TTCCTTCATGGACTCTCGCAG |
| tnfa: FW | GGAGAGTTGCCTTTACCGCT |
| tnfa: RV | CTTGTTGATTGCCCTGGGTCT |
| tgfb1a: FW | CAACGTGTCCGAGATGAAGC |
| tgfb1a: RV | TGGAGACAAAGCGAGTTCCC |
| col1a1a: FW | AGCCCTGGACCTGATGGAAA |
| col1a1a: RV | CACCCTGCTCACCAGACTTT |
| col4a1: FW | GACCACGGCTTCCTTGTAAC |
| col4a1: RV | GTGACCTTTCATTGCCCTGG |
| fn1a: FW | GCAGTGTATGCCGAAAGGAAC |
| fn1a: RV | CAAGTGCAAAGAAGCGTGCT |
| mmp9: FW | ATGGACCTAGAACTGGCCCT |
| mmp9: RV | TGATTTGGCAGGCATCGTCT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Giusti, A.; Ny, A.; de Witte, P.A. Nephrotoxic Effects in Zebrafish after Prolonged Exposure to Aristolochic Acid. Toxins 2020, 12, 217. https://doi.org/10.3390/toxins12040217
Wang X, Giusti A, Ny A, de Witte PA. Nephrotoxic Effects in Zebrafish after Prolonged Exposure to Aristolochic Acid. Toxins. 2020; 12(4):217. https://doi.org/10.3390/toxins12040217
Chicago/Turabian StyleWang, Xixin, Arianna Giusti, Annelii Ny, and Peter A. de Witte. 2020. "Nephrotoxic Effects in Zebrafish after Prolonged Exposure to Aristolochic Acid" Toxins 12, no. 4: 217. https://doi.org/10.3390/toxins12040217
APA StyleWang, X., Giusti, A., Ny, A., & de Witte, P. A. (2020). Nephrotoxic Effects in Zebrafish after Prolonged Exposure to Aristolochic Acid. Toxins, 12(4), 217. https://doi.org/10.3390/toxins12040217

