Cyanotoxins Occurrence in Portugal: A New Report on Their Recent Multiplication
Abstract
1. Introduction
2. Results
2.1. Bloom Frequency and Composition
2.2. Microcystins
2.3. Cylindrospermopsins
2.4. Anatoxin-a
2.5. Saxitoxins
2.6. DNA Sequencing
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Sampling
5.2. DNA Extraction
5.3. PCR Amplifications
5.4. DNA Sequencing
5.5. ELISA Immunological Assays
Author Contributions
Funding
Conflicts of Interest
References
- Van Apeldoorn, M.E.; van Egmond, H.P.; Speijers, G.J.A.; Bakker, G.J.I. Toxins of cyanobacteria. Mol. Nutr. Food Res. 2007, 51, 7–60. [Google Scholar] [CrossRef] [PubMed]
- Jochimsen, E.M.; Carmichael, W.W.; An, J.; Cardo, D.M.; Cookson, S.T.; Holmes, C.M.D.; Antunes, M.B.D.; De Melo, D.A.; Lyra, T.M.; Barreto, V.S.T.; et al. Liver failure and death after exposure to microcystins at a hemodialyses center in Brazil. N. Engl. J. Med. 1998, 338, 873–878. [Google Scholar] [CrossRef] [PubMed]
- Bourke, A.T.C.; Hawes, R.B.; Neilson, A.; Stallman, N.D. An outbreak of hepato-enteritis (the Palm Island mystery disease) possibly caused by algal intoxication. Toxicon 1983, 21, 45–48. [Google Scholar] [CrossRef]
- Hawkins, P.R.; Runnegar, M.T.C.; Jackson, A.R.B.; Falconer, I. Severe hepatotoxicity caused by the tropical cyanobacterium (blue-green alga) Cylindrospermopsis raciborskii (Woloszynska) Seenaya and Subba Raju isolated from a domestic water supply reservoir. Appl. Environ. Microbiol. 1985, 51, 1292–1295. [Google Scholar] [CrossRef]
- Ferrão-Filho, A.S.; Kozlowsky-Suzuki, B. Cyanotoxins: Bioaccumulation and effects on aquatic animals. Mar. Drugs. 2011, 9, 2729–2772. [Google Scholar] [CrossRef]
- Flores, N.M.; Miller, T.R.; Stockwell, J.D. A Global Analysis of the Relationship between Concentrations of Microcystins in Water and Fish. Front. Mar. Sci. 2018, 5. [Google Scholar] [CrossRef]
- Fergusson, K.M.; Saint, C.P. Multiplex PCR assay for Cylindrospermopsis raciborskii and cylindrospermopsin-Producing cyanobacteria. Environ. Toxicol. 2003, 18, 120–125. [Google Scholar] [CrossRef]
- Hisbergues, M.; Christiansen, G.; Rouhiainen, L.; Sivonen, K.; Börner, T. PCR-Based identification of microcystin-Producing genotypes of different cyanobacterial genera. Arch. Microbiol. 2003, 180, 402–410. [Google Scholar] [CrossRef]
- Kellmann, R.; Mills, T.; Neilan, B.A. Functional modeling and phylogenetic distribution of putative cylindrospermopsin biosynthesis enzymes. J. Mol. Evol. 2006, 62, 267–280. [Google Scholar] [CrossRef]
- Lopes, V.R.; Ramos, V.; Martins, A.; Sousa, M.; Welker, M.; Antunes, A.; Vasconcelos, V. Phylogenetic, chemical and morphological diversity of cyanobacteria from Portuguese temperate estuaries. Mar. Environ. Res. 2012, 73, 7–16. [Google Scholar] [CrossRef]
- Mihali, T.K.; Kellmann, R.; Muenchoff, J.; Barrow, K.D.; Neilan, B.A. Characterization of the gene cluster responsible for cylindrospermopsin biosynthesis. Appl. Environ. Microbiol. 2008, 74, 716–722. [Google Scholar] [CrossRef] [PubMed]
- Rantala-Ylinen, A.; Känä, S.; Wang, H.; Rouhiainen, L.; Wahlsten, M.; Rizzi, E.; Berg, K.; Gugger, M.; Sivonnen, K. Anatoxin-A synthetase gene cluster of the cyanobacterium Anabaena sp. strain 37 and molecular methods to detect potential producers. Appl. Environ. Microbiol. 2011, 77, 7271–7278. [Google Scholar] [CrossRef] [PubMed]
- Savela, H.; Spoof, L.; Perälä, N.; Preede, M.; Lamminmäki, U.; Nybom, S.; Häggqvist, K.; Meriluoto, J.; Vehniäinena, M. Detection of cyanobacterial sxt genes and paralytic shellfish toxins in freshwater lakes and brackish waters on Åland Islands, Finland. Harmful Algae 2015, 47, 1–10. [Google Scholar] [CrossRef]
- Mikalsen, B.; Boison, G.; Skulberg, O.M.; Fastner, J.; Davies, W.; Gabrielsen, T.M.; Rudi, K.; Jakobsen, K.S. Natural variation in the microcystin synthetase operon mcyABC and impact on microcystin production in Microcystis strains. J. Bacteriol. 2003, 185, 2774–2785. [Google Scholar] [CrossRef]
- Ouahid, Y.; Pérez-Silva, G.; del Campo, F.F. Identification of potentially toxic environmental Microcystis by individual and multiple PCR amplification of specific microcystin synthetase gene regions. Environ. Toxicol. 2005, 20, 235–242. [Google Scholar] [CrossRef]
- Araújo, F. Cianobacterias: Ocurrencias y gestión del riesgo en Portugal de 1993 a 2005. In Jornada Sobre las Cianobacterias tóxicas; Problemas Asociados. Seguimiento y Control: Madrid, Spain, 2006; Available online: http://ceh-flumen64.cedex.es/Ecosistemas/Jornadas%20Cianos/F.Araujo.pdf (accessed on 2 May 2019).
- CyanoNews. Toxin Suspect in Mass Killing. Cyanonews 1996, 12, 4. Available online: http://wwwcyanosite.bio.purdue.edu/cyanonews/cn122/cn122.pdf (accessed on 2 May 2019).
- Vasconcelos, V.M.; Sivonen, K.; Evans, W.R.; Carmichael, W.W.; Namikoshi, M. Isolation and characterization of microcystins (heptapeptide hepatotoxins) from portuguese strains of Microcystis aeruginosa Kutz. emend Elekin. Arch. für Hydrobiol. 1995, 134, 295–305. [Google Scholar]
- Pereira, P.; Onodera, H.; Andrinolo, D.; Franca, S.; Araújo, F.; Lagos, N.; Oshima, Y. Paralytic shellfish toxins in the freshwater cyanobacterium Aphanizomenon flos-aquae, isolated from Montargil reservoir, Portugal. Toxicon 2000, 38, 1689–1702. [Google Scholar] [CrossRef]
- Osswald, J.; Rellán, S.; Gago, A.; Vasconcelos, V. Production of anatoxin-A by cyanobacterial strains isolated from Portuguese fresh water systems. Ecotoxicology 2009, 18, 1110–1115. [Google Scholar] [CrossRef]
- Moreira, C.; Mendes, R.; Azevedo, J.; Vasconcelos, V.; Antunes, A. First occurrence of cylindrospermopsin in Portugal: A contribution to its continuous global dispersal. Toxicon 2017, 130, 87–90. [Google Scholar] [CrossRef]
- De la Cruz, A.A.; Hiskia, A.; Kaloudis, T.; Chernoff, N.; Hill, D.; Antoniou, M.G.; He, X.; Loftin, K.; O’Shea, K.; Zhao, C.; et al. A review on cylindrospermopsin: The global occurrence, detection, toxicity and degradation of a potent cyanotoxin. Environ. Sci. Process. Impacts 2013, 15, 1979–2003. [Google Scholar] [CrossRef] [PubMed]
- Mankiewicz-Boczek, J.; Kokociński, M.; Gagała, I.; Pawełczyk, J.; Jurczak, T.; Dziadek, J. Preliminary molecular identification of cylindrospermopsin-Producing Cyanobacteria in two Polish lakes (Central Europe). FEMS Microbiol. Lett. 2012, 326, 173–179. [Google Scholar] [CrossRef] [PubMed]
- Moreira, C.; Martins, A.; Azevedo, J.; Freitas, M.; Regueiras, A.; Vale, M.; Antunes, A.; Vasconcelos, V. Application of real-Time PCR in the assessment of the toxic cyanobacterium Cylindrospermopsis raciborskii abundance and toxicological potential. Appl. Microbiol. Biotechnol. 2011, 92, 189–197. [Google Scholar] [CrossRef] [PubMed]
- Savela, H.; Spoof, L.; Höysniemi, N.; Vehniäinen, M.; Mankiewicz-Boczek, J.; Jurczak, T.; Kokociński, M.; Meriluoto, J. First report of cyanobacterial paralytic shellfish toxin biosynthesis genes and paralytic shellfish toxin production in Polish freshwater lakes. Adv. Oceanogr. Limnol. 2017, 8. [Google Scholar] [CrossRef]
- Zervou, S.K.; Christophoridis, C.; Kaloudis, T.; Triantis, T.M.; Hiskia, A. New SPE-LC-MS/MS method for simultaneous determination of multi-class cyanobacterial and algal toxins. J. Hazard. Mater. 2017, 5, 56–66. [Google Scholar] [CrossRef]
Cyanotoxins | MC | CYN | ATX | SXT | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Assessment | PCR | ELISA (µg/L) | PCR | ELISA (µg/L) | PCR | ELISA (µg/L) | PCR | ELISA (µg/L) | |||||||||||
Location | mcyA | mcyB | mcyC | mcyD | mcyE | mcyG | cyrA | cyrB | cyrC | cyrJ | anaC | anab/anac | sxtA | sxtG | sxtI | ||||
River Tâmega | |||||||||||||||||||
April | + | - | - | + | - | - | 0.3 | - | - | - | - | ND | - | - | 0.2 | - | - | - | 0.0 |
May | + | - | - | + | + | - | 0.2 | - | - | - | - | ND | - | - | 0.7 | - | - | - | 0.1 |
June | + | - | + | - | + | - | 0.5 | - | - | + | - | ND | - | - | 0.2 | - | - | - | 0.1 |
July | + | + | + | + | + | + | 0.4 | - | - | - | - | ND | + | - | 0.3 | - | + | + | 0.1 |
August | + | + | + | + | + | + | 18.8 | - | - | - | - | ND | + | - | 1.0 | - | + | + | 1.1 |
September | + | + | + | + | + | + | 17.0 | - | - | - | - | ND | + | - | 0.8 | - | + | - | 0.1 |
Torrão Reservoir | |||||||||||||||||||
April | + | + | + | + | - | - | 2.7 | - | - | + | - | ND | + | - | 0.3 | - | - | + | 0.1 |
May | - | - | - | - | - | - | 0.3 | - | - | - | - | ND | + | - | 1.0 | - | - | - | 0.1 |
June | + | - | + | - | + | - | 0.3 | - | - | + | - | ND | - | - | 0.4 | - | - | - | 0.1 |
July | + | + | + | + | + | + | 0.2 | - | - | + | - | ND | + | - | 0.2 | - | + | + | 0.3 |
August | + | + | + | + | + | + | 16.0 | - | - | - | - | ND | + | - | 0.3 | - | + | + | 0.7 |
September | + | + | + | + | + | + | 5.0 | - | + | - | - | ND | + | - | 0.2 | - | + | + | 0.2 |
Porto City Lake 1 | |||||||||||||||||||
April | + | + | + | + | - | - | 4.3 | - | - | - | - | ND | - | - | 5.2 | - | - | − | 0.2 |
May | + | + | + | + | + | - | 11.3 | - | - | - | - | ND | + | - | 2.1 | - | - | - | 0.3 |
June | + | + | + | + | + | - | 3.5 | - | + | - | - | ND | + | - | 6.8 | - | - | - | 0.2 |
July | + | + | + | + | + | + | 1.6 | - | - | - | - | ND | - | - | 0.4 | - | + | - | 0.1 |
August | + | + | + | + | + | + | 2.1 | - | - | - | - | ND | + | - | 1.9 | - | + | + | 0.3 |
September | + | + | + | + | + | + | 2.6 | - | - | - | - | ND | + | - | 1.6 | - | + | + | 0.5 |
Porto City Lake 2 | |||||||||||||||||||
April | - | - | + | - | - | - | 0.3 | - | - | - | - | ND | - | - | 0.2 | - | - | - | 0.2 |
May | + | + | + | + | + | - | 2.0 | - | - | - | - | ND | - | - | 0.4 | - | - | + | 0.2 |
June | + | + | + | + | + | - | 13.3 | - | - | - | - | ND | - | - | 1.5 | - | - | - | 0.3 |
July | + | - | + | + | + | + | 3.9 | - | - | + | - | ND | + | - | 0.4 | - | + | + | 0.9 |
August | + | + | + | + | + | + | 4.8 | - | - | + | - | ND | + | - | 0.9 | - | + | + | 4.3 |
September | + | + | + | + | + | + | 6.5 | - | - | + | - | ND | + | - | 0.6 | - | + | + | 2.6 |
Porto City Lake 3 | |||||||||||||||||||
April | + | - | - | + | - | - | 0.3 | - | - | - | - | ND | - | - | 1.8 | - | - | - | 0.1 |
May | - | - | - | - | - | - | 0.2 | - | - | - | - | ND | - | - | 0.4 | - | - | - | 0.2 |
June | - | - | + | - | - | - | 0.1 | - | - | - | - | ND | - | - | 1.0 | - | - | - | 0.2 |
July | + | - | + | + | + | + | 0.2 | - | - | - | - | ND | - | - | 1.1 | - | + | - | 0.2 |
August | + | + | + | + | + | + | 0.4 | - | - | + | - | ND | - | - | 0.3 | - | + | - | 0.2 |
September | + | + | + | + | + | + | 1.9 | - | - | + | - | ND | - | - | 0.4 | - | + | + | 0.2 |
Mira Lagoon | |||||||||||||||||||
April | - | - | - | - | - | - | 0.5 | - | - | - | - | ND | - | - | 0.4 | - | - | - | 0.1 |
May | - | - | - | - | - | - | 0.3 | - | - | - | - | ND | - | - | 0.5 | - | - | + | 0.2 |
June | - | - | - | - | - | - | 0.3 | - | - | + | - | ND | - | - | 0.5 | - | - | + | 0.6 |
July | + | + | + | + | + | - | 0.6 | - | - | + | - | ND | - | - | 2.1 | - | - | + | 0.3 |
August | + | + | + | + | + | - | 0.3 | - | - | - | - | ND | - | - | 0.6 | - | - | + | 0.5 |
September | + | + | + | + | + | + | 1.9 | - | - | + | - | ND | + | - | 1.0 | - | + | + | 1.3 |
Vela Lagoon | |||||||||||||||||||
April | - | - | - | - | - | - | 0.3 | - | - | - | - | 0.1 | - | - | 1.6 | - | - | - | 1.9 |
May | + | - | - | - | - | - | 0.3 | - | - | - | - | 0.1 | - | - | 0.5 | - | - | + | 1.4 |
June | - | - | - | - | - | - | 0.4 | - | - | + | - | 0.1 | - | - | 1.7 | - | - | + | 1.8 |
July | + | + | + | + | + | + | 2.1 | - | - | + | - | 0.0 | - | - | 0.9 | - | + | - | 1.9 |
August | + | - | - | + | + | + | 0.9 | - | - | - | - | 0.1 | + | - | 0.8 | - | + | + | 1.8 |
September | + | - | - | + | - | + | 8.7 | - | - | - | - | 0.0 | - | - | 1.1 | - | + | - | 2.4 |
Geography | Sampling Site | Trophic Status | Ecosystem Uses | Socio-economic Activities |
---|---|---|---|---|
North Region | River Tâmega | Eutrophic | Recreational | Sports, Fishing |
Torrão Reservoir | Eutrophic | Water provision, irrigation, recreational | Agriculture, Sports, Tourism | |
Porto City Park Lake 1 | Eutrophic | Recreational | Tourism | |
Porto City Park Lake 2 | Eutrophic | Recreational | Tourism | |
Porto City Park Lake 3 | Mesotrophic | Recreational | Tourism | |
Center Region | Mira Lagoon | Eutrophic | Irrigation, Recreational | Agriculture, Sports, Tourism |
Vela Lagoon | Eutrophic | Irrigation, Recreational | Agriculture, Sports, Tourism |
Target | Primer | Primer Sequence 5′-3′ | Reference |
---|---|---|---|
mcyA | mcyA-CD1F | AAAATTAAAAGCCGTATCAAA | [8] |
mcyA-CD1R | AAAAGTGTTTTATTAGCGGCTCAT | ||
mcyB | mcyB 2156-F | ATCACTTCAATCTAACGACT | [14] |
mcyB 3111-R | AGTTGCTGCTGTAAGAAA | ||
mcyC | PSCF1 | GCAACATCCCAAGAGCAAAG | [15] |
PSCR1 | CCGACAACATCACAAAGGC | ||
mcyD | PKDF1 | GACGCTCAAATGATGAAAC | [15] |
PKDR1 | GCAACCGATAAAAACTCCC | ||
mcyE | PKEF1 | CGCAAACCCGATTTACAG | [15] |
PKER1 | CCCCTACCATCTTCATCTTC | ||
mcyG | PKGF1 | ACTCTCAAGTTATCCTCCCTC | [15] |
PKGR1 | AATCGCTAAAACGCCACC | ||
cyrA | AMT Fw | ATTGTAAATAGCTGGAATGAGTGG | [9] |
AMT Rev | TTAGGGAAGTAATCTTCACAG | ||
cyrB | M13 | GGCAAATTGTGATAGCCACGAGC | [7] |
M14 | GATGGAACATCGCTCACTGGTG | ||
cyrC | K18 | CCTCGCACATAGCCATTTGC | [7] |
M4 | GAAGCTCTGGAATCCGGTAA | ||
cyrJ | cynsulfF | ACTTCTCTCCTTTCCCTATC | [11] |
cylnamR | GAGTGAAAATGCGTAGAACTTG | ||
anaC | anaC-genF | TCTGGTATTCAGTCCCCTCTAT | [12] |
anaC-genR | CCCAATAGCCTGTCATCAA | ||
Dolichospermum sp. anaC | anaC-anabF | GCCCGATATTGAAACAAGT | [12] |
anaC-anabR | CACCCTCTGGAGATTGTTTA | ||
sxtA | sxtA855_F | GACTCGGCTTGTTGCTTCCCC | [13] |
sxtA1480_R | GCCAAACTCGCAACAGGAGAAGG | ||
sxtG | sxtG432_F | AATGGCAGATCGCAACCGCTAT | [13] |
sxtG928_R | ACATTCAACCCTGCCCATTCACT | ||
sxtI | sxtI 682F | GGATCTCAAAGAAGATGGCA | [10] |
sxtI 877R | GCCAAACGCAGTACCACTT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moreira, C.; Gomes, C.; Vasconcelos, V.; Antunes, A. Cyanotoxins Occurrence in Portugal: A New Report on Their Recent Multiplication. Toxins 2020, 12, 154. https://doi.org/10.3390/toxins12030154
Moreira C, Gomes C, Vasconcelos V, Antunes A. Cyanotoxins Occurrence in Portugal: A New Report on Their Recent Multiplication. Toxins. 2020; 12(3):154. https://doi.org/10.3390/toxins12030154
Chicago/Turabian StyleMoreira, Cristiana, Cidália Gomes, Vitor Vasconcelos, and Agostinho Antunes. 2020. "Cyanotoxins Occurrence in Portugal: A New Report on Their Recent Multiplication" Toxins 12, no. 3: 154. https://doi.org/10.3390/toxins12030154
APA StyleMoreira, C., Gomes, C., Vasconcelos, V., & Antunes, A. (2020). Cyanotoxins Occurrence in Portugal: A New Report on Their Recent Multiplication. Toxins, 12(3), 154. https://doi.org/10.3390/toxins12030154