Transcriptome Analysis of Ochratoxin A-Induced Apoptosis in Differentiated Caco-2 Cells
Abstract
1. Introduction
2. Results
2.1. OTA Induces Apoptosis in Differentiated Caco-2 Cells in a Dose-Dependent Manner
2.2. Effect of OTA on Gene Expression Patterns
2.3. Gene Ontology (GO) Annotation and KEGG Enrichment Analysis of DEGs
2.4. Key Pathways and DEGs Related to Cell Apoptosis
2.5. Validation of RNA-Seq Results by qRT-PCR
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Cell Culture and Treatments
4.3. Cell Apoptosis Assay by Annexin V-FITC/PI FACS
4.4. RNA Extraction, Library Construction, and Transcriptome Sequencing
4.4.1. RNA Extraction
4.4.2. Construction of cDNA Library and Illumina Sequencing
4.4.3. De Novo Assembly and Quantification of Gene Abundance
4.4.4. Differentially Expressed Genes and their Dynamic Expression Profile
4.5. Validation of RNA-Seq Results Using qRT-PCR
4.6. Western Blotting Assays
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Creppy, E.E. Update of survey, regulation and toxic effects of mycotoxins in Europe. Toxicol. Lett. 2002, 127, 19–28. [Google Scholar] [CrossRef]
- Van der Merwe, K.J.; Steyn, P.S.; Fourie, L.; Scott, D.B.; Theron, J.J. Ochratoxin A, a toxic metabolite produced by Aspergillus ochraceus Wilh. Nature 1965, 205, 1112–1113. [Google Scholar] [CrossRef] [PubMed]
- Duarte, S.C.; Pena, A.; Lino, C.M. A review on ochratoxin A occurrence and effects of processing of cereal and cereal derived food products. Food Microbiol. 2010, 27, 187–198. [Google Scholar] [CrossRef] [PubMed]
- Clark, H.A.; Snedeker, S.M. Ochratoxin A: Its cancer risk and potential for exposure. J. Toxicol. Environ. Health B Crit. Rev. 2006, 9, 265–296. [Google Scholar] [CrossRef] [PubMed]
- Kononenko, G.P.; Burkin, A.A.; Zotova, E.V.; Soboleva, N.A. Ochratoxin A: Study of grain contamination. Prikl. Biokhim. Mikrobiol. 2000, 36, 209–213. [Google Scholar] [PubMed]
- Duarte, S.C.; Lino, C.M.; Pena, A. Food safety implications of ochratoxin A in animal-derived food products. Vet. J. 2012, 192, 286–292. [Google Scholar] [CrossRef]
- Ringot, D.; Chango, A.; Schneider, Y.J.; Larondelle, Y. Toxicokinetics and toxicodynamics of ochratoxin A, an update. Chem. Biol. Interact. 2006, 159, 18–46. [Google Scholar] [CrossRef]
- Capriotti, A.L.; Caruso, G.; Cavaliere, C.; Foglia, P.; Samperi, R.; Laganà, A. Multiclass mycotoxin analysis in food, environmental and biological matrices with chromatography/mass spectrometry. Mass Spectrom. Rev. 2012, 31, 466–503. [Google Scholar] [CrossRef]
- Flores-Flores, M.E.; Lizarraga, E.; de Cerain, A.L.; Gonzalez-Penas, E. Presence of mycotoxins in animal milk: A review. Food Control. 2015, 53, 163–176. [Google Scholar] [CrossRef]
- Joint FAO/WHO Expert Committee on Food Additives. Safety Evaluation of Certain Mycotoxins in Food; World Health Organization: Geneva, Switzerland, 2001. [Google Scholar]
- Pattono, D.; Gallo, P.F.; Civera, T. Detection and quantification of Ochratoxin A in milk produced in organic farms. Food Chem. 2011, 127, 374–377. [Google Scholar] [CrossRef]
- Huang, L.C.; Zheng, N.; Zheng, B.Q.; Wen, F.; Cheng, J.B.; Han, R.W.; Xu, X.M.; Li, S.L.; Wang, J.Q. Simultaneous determination of aflatoxin M1, ochratoxin A, zearalenone and alpha-zearalenol in milk by UHPLC-MS/MS. Food Chem. 2014, 146, 242–249. [Google Scholar] [CrossRef] [PubMed]
- Elzupir, A.O.; Makawi, S.Z.A.; Elhussein, A.M. Determination of Aflatoxins and Ochratoxin a in Dairy Cattle Feed and Milk in Wad Medani, Sudan. J. Anim. Vet. Adv. 2009, 8, 2508–2511. [Google Scholar]
- Cancer IAFO. Some Naturally Occurring Substances: Food Items and Constituents, Heterocyclic Aromatic Amines and Mycotoxins; International Agency for Research on Cancer: Geneva, Switzerland, 1993. [Google Scholar]
- Gambacorta, L.; Pinton, P.; Avantaggiato, G.; Oswald, I.P.; Solfrizzo, M. Grape Pomace, an Agricultural Byproduct Reducing Mycotoxin Absorption: In Vivo Assessment in Pig Using Urinary Biomarkers. J. Agric. Food Chem. 2016, 64, 6762–6771. [Google Scholar] [CrossRef] [PubMed]
- Bouhet, S.; Oswald, I.P. The effects of mycotoxins, fungal food contaminants, on the intestinal epithelial cell-derived innate immune response. Vet. Immunol. Immunopathol. 2005, 108, 199–209. [Google Scholar] [CrossRef] [PubMed]
- Pfohl-Leszkowicz, A.; Manderville, R.A. Ochratoxin A: An overview on toxicity and carcinogenicity in animals and humans. Mol. Nutr. Food Res. 2007, 51, 61–99. [Google Scholar] [CrossRef]
- Elling, F.; Hald, B.; Jacobsen, C.; Krogh, P. Spontaneous toxic nephropathy in poultry associated with ochratoxin A. Acta Pathol. Microbiol. Scand. A 1975, 83, 739–741. [Google Scholar] [CrossRef]
- Gekle, M.; Silbernagl, S. Renal toxicodynamics of ochratoxin A: A pathophysiological approach. Kidney Blood Press. Res. 1996, 19, 225–235. [Google Scholar] [CrossRef]
- Wang, H.; Chen, Y.; Zhai, N.; Chen, X.; Gan, F.; Li, H.; Huang, K. Ochratoxin A-Induced Apoptosis of IPEC-J2 Cells through ROS-Mediated Mitochondrial Permeability Transition Pore Opening Pathway. J. Agric. Food Chem. 2017, 65, 10630–10637. [Google Scholar] [CrossRef]
- Gao, Y.; Li, S.; Wang, J.; Luo, C.; Zhao, S.; Zheng, N. Modulation of Intestinal Epithelial Permeability in Differentiated Caco-2 Cells Exposed to Aflatoxin M1 and Ochratoxin A Individually or Collectively. Toxins 2018, 10, 13. [Google Scholar] [CrossRef]
- Maresca, M.; Fantini, J. Some food-associated mycotoxins as potential risk factors in humans predisposed to chronic intestinal inflammatory diseases. Toxicon 2010, 56, 282–294. [Google Scholar] [CrossRef]
- Schrickx, J.; Lektarau, Y.; Fink-Gremmels, J. Ochratoxin A secretion by ATP-dependent membrane transporters in Caco-2 cells. Arch. Toxicol. 2006, 80, 243–249. [Google Scholar] [CrossRef] [PubMed]
- Stoev, S.D.; Stefanov, M.; Denev, S.; Radic, B.; Domijan, A.M.; Peraica, M. Experimental mycotoxicosis in chickens induced by ochratoxin A and penicillic acid and intervention with natural plant extracts. Vet. Res. Commun. 2004, 28, 727–746. [Google Scholar] [CrossRef] [PubMed]
- Dortant, P.M.; Peters-Volleberg, G.W.; Van Loveren, H.; Marquardt, R.R.; Speijers, G.J. Age-related differences in the toxicity of ochratoxin A in female rats. Food Chem. Toxicol. 2001, 39, 55–65. [Google Scholar] [CrossRef]
- Solcan, C.; Pavel, G.; Floristean, V.C.; Chiriac, I.S.; Şlencu, B.G.; Solcan, G. Effect of ochratoxin A on the intestinal mucosa and mucosa-associated lymphoid tissues in broiler chickens. Acta Vet. Hung. 2015, 63, 30–48. [Google Scholar] [CrossRef]
- Cano-Sancho, G.; González-Arias, C.A.; Ramos, A.J.; Sanchis, V.; Fernández-Cruz, M.L. Cytotoxicity of the mycotoxins deoxynivalenol and ochratoxin A on Caco-2 cell line in presence of resveratrol. Toxicol. In Vitro 2015, 29, 1639–1646. [Google Scholar] [CrossRef]
- Revajová, V.; Levkut, M.; Levkutová, M.; Bořutová, R.; Grešaková, L.; Košiková, B.; Leng, L. Effect of lignin supplementation of a diet contaminated with Fusarium mycotoxins on blood and intestinal lymphocyte subpopulations in chickens. Acta Vet. Hung. 2013, 61, 354–365. [Google Scholar] [CrossRef]
- Ranaldi, G.; Caprini, V.; Sambuy, Y.; Perozzi, G.; Murgia, C. Intracellular zinc stores protect the intestinal epithelium from Ochratoxin A toxicity. Toxicol. In Vitro 2009, 23, 1516–1521. [Google Scholar] [CrossRef]
- Bouaziz, C.; Sharaf el dein, O.; Martel, C.; El Golli, E.; Abid-Essefi, S.; Brenner, C.; Lemaire, C.; Bacha, H. Molecular events involved in ochratoxin A induced mitochondrial pathway of apoptosis, modulation by Bcl-2 family members. Environ. Toxicol. 2011, 26, 579–590. [Google Scholar] [CrossRef]
- Rached, E.; Pfeiffer, E.; Dekant, W.; Mally, A. Ochratoxin A: Apoptosis and aberrant exit from mitosis due to perturbation of microtubule dynamics? Toxicol. Sci. 2006, 92, 78–86. [Google Scholar] [CrossRef]
- Gekle, M.; Sauvant, C.; Schwerdt, G. Ochratoxin A at nanomolar concentrations: A signal modulator in renal cells. Mol. Nutr. Food Res. 2005, 49, 118–130. [Google Scholar] [CrossRef]
- Li, J.; Yin, S.; Dong, Y.; Fan, L.; Hu, H. P53 activation inhibits ochratoxin A-induced apoptosis in monkey and human kidney epithelial cells via suppression of JNK activation. Biochem. Biophys. Res. Commun. 2011, 411, 458–463. [Google Scholar] [CrossRef] [PubMed]
- Cui, J.; Xing, L.; Li, Z.; Wu, S.; Wang, J.; Liu, J.; Wang, J.; Yan, X.; Zhang, X. Ochratoxin A induces G2 phase arrest in human gastric epithelium GES-1 cells in vitro. Toxicol. Lett. 2010, 193, 152–158. [Google Scholar] [CrossRef] [PubMed]
- Chopra, M.; Link, P.; Michels, C.; Schrenk, D. Characterization of ochratoxin A-induced apoptosis in primary rat hepatocytes. Cell Biol. Toxicol. 2010, 26, 239–254. [Google Scholar] [CrossRef] [PubMed]
- Artursson, P.; Palm, K.; Luthman, K. Caco-2 monolayers in experimental and theoretical predictions of drug transport. Adv. Drug Deliv. Rev. 2012, 64, 280–289. [Google Scholar] [CrossRef]
- Akbari, P.; Braber, S.; Varasteh, S.; Alizadeh, A.; Garssen, J.; Fink-Gremmels, J. The intestinal barrier as an emerging target in the toxicological assessment of mycotoxins. Arch. Toxicol. 2017, 91, 1007–1029. [Google Scholar] [CrossRef]
- Sambuy, Y.; De Angelis, I.; Ranaldi, G.; Scarino, M.L.; Stammati, A.; Zucco, F. The Caco-2 cell line as a model of the intestinal barrier: Influence of cell and culture-related factors on Caco-2 cell functional characteristics. Cell Biol. Toxicol. 2005, 21, 1–26. [Google Scholar] [CrossRef]
- Derks, K.W.; Misovic, B.; van den Hout, M.C.; Kockx, C.E.; Gomez, C.P.; Brouwer, R.W.; Vrieling, H.; Hoeijmakers, J.H.; van IJcken, W.F.; Pothof, J. Deciphering the RNA landscape by RNAome sequencing. RNA Biol. 2015, 12, 30–42. [Google Scholar] [CrossRef][Green Version]
- Nagalakshmi, U.; Waern, K.; Snyder, M. RNA-Seq: A method for comprehensive transcriptome analysis. Curr. Protoc. Mol. Biol. 2010, 11, 1–13. [Google Scholar] [CrossRef]
- Mutz, K.O.; Heilkenbrinker, A.; Lönne, M.; Walter, J.G.; Stahl, F. Transcriptome analysis using next-generation sequencing. Curr. Opin. Biotechnol. 2013, 24, 22–30. [Google Scholar] [CrossRef]
- Peraica, M.; Flajs, D.; Domijan, A.M.; Ivić, D.; Cvjetković, B. Ochratoxin A Contamination of Food from Croatia. Toxins 2010, 2, 2098–2105. [Google Scholar] [CrossRef]
- Sergent, T. Differential modulation of ochratoxin A absorption across Caco-2 cells by dietary polyphenols, used at realistic intestinal concentrations. Toxicol. Lett. 2005, 159, 60–70. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; Deng, L.; Yu, X.; Wang, X.; Zhu, L.; Yu, T.; Zhang, Y.; Zhou, B.; Xu, W.; Chen, L.; et al. MiR-122 partly mediates the ochratoxin A-induced GC-2 cell apoptosis. Toxicol. In Vitro 2015, 30, 264–273. [Google Scholar] [CrossRef] [PubMed]
- Giromini, C.; Rebucci, R.; Fusi, E.; Rossi, L.; Saccone, F.; Baldi, A. Cytotoxicity, apoptosis, DNA damage and methylation in mammary and kidney epithelial cell lines exposed to ochratoxin A. Cell Biol. Toxicol. 2016, 32, 249–258. [Google Scholar] [CrossRef] [PubMed]
- Zhao, D.Y.; Zhang, W.X.; Qi, Q.Q.; Long, X.; Li, X.; Yu, Y.B.; Zuo, X.L. Brain-derived neurotrophic factor modulates intestinal barrier by inhibiting intestinal epithelial cells apoptosis in mice. Physiol. Res. 2018, 67, 475–485. [Google Scholar] [CrossRef] [PubMed]
- Rai, M.F.; Tycksen, E.D.; Sandell, L.J.; Brophy, R.H. Advantages of RNA-seq compared to RNA microarrays for transcriptome profiling of anterior cruciate ligament tears. J. Orthop. Res. 2018, 36, 484–497. [Google Scholar] [CrossRef] [PubMed]
- Assaf, H.; Azouri, H.; Pallardy, M. Ochratoxin A induces apoptosis in human lymphocytes through down regulation of Bcl-xL. Toxicol. Sci. 2004, 79, 335–344. [Google Scholar] [CrossRef]
- Ozcan, Z.; Gul, G.; Yaman, I. Ochratoxin A activates opposing c-MET/PI3K/Akt and MAPK/ERK 1-2 pathways in human proximal tubule HK-2 cells. Arch. Toxicol. 2015, 89, 1313–1327. [Google Scholar] [CrossRef]
- Bouaziz, C.; Sharaf El Dein, O.; El Golli, E.; Abid-Essefi, S.; Brenner, C.; Lemaire, C.; Bacha, H. Different apoptotic pathways induced by zearalenone, T-2 toxin and ochratoxin A in human hepatoma cells. Toxicology 2008, 254, 19–28. [Google Scholar] [CrossRef]
- Vettorazzi, A.; van Delft, J.; de Cerain López, A. A review on ochratoxin A transcriptomic studies. Food Chem. Toxicol. 2013, 59, 766–783. [Google Scholar] [CrossRef]
- Zhang, Y.; Qi, X.; Zheng, J.; Luo, Y.; Huang, K.; Xu, W. High-Throughput Tag-Sequencing Analysis of Early Events Induced by Ochratoxin A in HepG-2 Cells. J. Biochem. Mol. Toxicol. 2016, 30, 29–36. [Google Scholar] [CrossRef]
- Vanacloig-Pedros, E.; Proft, M.; Pascual-Ahuir, A. Different Toxicity Mechanisms for Citrinin and Ochratoxin A Revealed by Transcriptomic Analysis in Yeast. Toxins 2016, 8, 273. [Google Scholar] [CrossRef] [PubMed]
- Boesch-Saadatmandi, C.; Matzner, N.; Matzner, N.; Lang, F.; Blank, R.; Wolffram, S.; Blaschek, W.; Rimbach, G. Ochratoxin A lowers mRNA levels of genes encoding for key proteins of liver cell metabolism. Cancer Genom. Proteom. 2008, 5, 319–332. [Google Scholar]
- Liang, R.; Shen, X.L.; Zhang, B.; Li, Y.; Xu, W.; Zhao, C.; Luo, Y.; Huang, K. Apoptosis Signal-regulating Kinase 1 promotes Ochratoxin A-induced renal cytotoxicity. Sci. Rep. 2015, 5, 8078–8089. [Google Scholar] [CrossRef] [PubMed]
- Gekle, M.; Schwerdt, G.; Freudinger, R.; Mildenberger, S.; Wilflingseder, D.; Pollack, V.; Dander, M.; Schramek, H. Ochratoxin A induces JNK activation and apoptosis in MDCK-C7 cells at nanomolar concentrations. J. Pharmacol. Exp. Ther. 2000, 293, 837–844. [Google Scholar] [PubMed]
- Darif, Y.; Mountassif, D.; Belkebir, A.; Zaid, Y.; Basu, K.; Mourad, W.; Oudghiri, M. Ochratoxin A mediates MAPK activation, modulates IL-2 and TNF-alpha mRNA expression and induces apoptosis by mitochondria-dependent and mitochondria-independent pathways in human H9 T cells. J. Toxicol. Sci. 2016, 41, 403–416. [Google Scholar] [CrossRef]
- Kaminska, B. MAPK signalling pathways as molecular targets for anti-inflammatory therapy—From molecular mechanisms to therapeutic benefits. Biochim. Biophys. Acta 2005, 1754, 253–262. [Google Scholar] [CrossRef]
- Horvath, A.; Upham, B.L.; Ganev, V.; Trosko, J.E. Determination of the epigenetic effects of ochratoxin in a human kidney and a rat liver epithelial cell line. Toxicon 2002, 40, 273–282. [Google Scholar] [CrossRef]
- Sauvant, C.; Holzinger, H.; Gekle, M. The nephrotoxin ochratoxin A induces key parameters of chronic interstitial nephropathy in renal proximal tubular cells. Cell Physiol. Biochem. 2005, 15, 125–134. [Google Scholar] [CrossRef]
- Sharma, R.P.; He, Q.; Johnson, V.J.; Voss, K.A. Increased expression of CD95-ligand and other apoptotic signaling factors by fumonisin B1, a hepatotoxic mycotoxin, in livers of mice lacking tumor necrosis factor α. Cytokine 2003, 24, 226–236. [Google Scholar] [CrossRef]
- Wang, L.; Feng, Z.; Wang, X.; Zhang, X. DEGseq: An R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics 2010, 26, 136–138. [Google Scholar] [CrossRef]
- Hibi, D.; Kijima, A.; Suzuki, Y.; Ishii, Y.; Jin, M.; Sugita-Konishi, Y.; Yanai, T.; Nishikawa, A.; Umemura, T. Effects of p53 knockout on ochratoxin A-induced genotoxicity in p53-deficient gpt delta mice. Toxicology 2013, 304, 92–99. [Google Scholar] [CrossRef] [PubMed]
- Shangary, S.; Wang, S. Targeting the MDM2-p53 interaction for cancer therapy. Clin. Cancer Res. 2008, 14, 5318–5324. [Google Scholar] [CrossRef] [PubMed]
- Fridman, J.S.; Lowe, S.W. Control of apoptosis by p53. Oncogene 2003, 22, 9030–9340. [Google Scholar] [CrossRef] [PubMed]
- Hibi, D.; Kijima, A.; Kuroda, K.; Suzuki, Y.; Ishii, Y.; Jin, M.; Nakajima, M.; Sugita-Konishi, Y.; Yanai, T.; Nohmi, T.; et al. Molecular mechanisms underlying ochratoxin A-induced genotoxicity: Global gene expression analysis suggests induction of DNA double-strand breaks and cell cycle progression. J. Toxicol. Sci. 2013, 38, 57–69. [Google Scholar] [CrossRef] [PubMed]
- Arbillaga, L.; Vettorazzi, A.; Gil, A.G.; van Delft, J.H.; García-Jalón, J.A.; de Cerain, A.L. Gene expression changes induced by ochratoxin A in renal and hepatic tissues of male F344 rat after oral repeated administration. Toxicol. Appl. Pharmacol. 2008, 230, 197–207. [Google Scholar] [CrossRef] [PubMed]
- Vassilev, L.T.; Uesugi, M. In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science 2004, 303, 844–848. [Google Scholar] [CrossRef]
- De Rozieres, S.; Maya, R.; Oren, M.; Lozano, G. The loss of mdm2 induces p53-mediated apoptosis. Oncogene 2000, 19, 1691–1697. [Google Scholar] [CrossRef]
- Silke, J.; Meier, P. Inhibitor of Apoptosis (IAP) Proteins-Modulators of Cell Death and Inflammation. Cold Spring Harb. Perspect. Biol. 2013, 5, 008730. [Google Scholar] [CrossRef]
- Picksley, S.M.; Lane, D.P. The p53-mdm2 autoregulatory feedback loop: A paradigm for the regulation of growth control by p53? Bioessays 1993, 15, 689–690. [Google Scholar] [CrossRef]
- Gu, H.; Wang, X.; Rao, S.; Wang, J.; Zhao, J.; Ren, F.L.; Mu, R.; Yang, Y.; Qi, Q.; Liu, W.; et al. Gambogic acid mediates apoptosis as a p53 inducer through down-regulation of mdm2 in wild-type p53-expressing cancer cells. Mol. Cancer Ther. 2008, 7, 3298–3305. [Google Scholar] [CrossRef]
- Alshatwi, A.A.; Subash-Babu, P.; Antonisamy, P. Violacein induces apoptosis in human breast cancer cells through up regulation of BAX, p53 and down regulation of MDM2. Exp. Toxicol. Pathol. 2016, 68, 89–97. [Google Scholar] [CrossRef] [PubMed]
- Kuroda, K.; Hibi, D.; Ishii, Y.; Takasu, S.; Kijima, A.; Matsushita, K.; Masumura, K.I.; Watanabe, M.; Sugita-Konishi, Y.; Sakai, H.; et al. Ochratoxin A induces DNA double-strand breaks and large deletion mutations in the carcinogenic target site of gpt delta rats. Mutagenesis 2014, 29, 27–36. [Google Scholar] [CrossRef] [PubMed]
- Chapman, J.R.; Taylor, M.R.G.; Simon, J. Boulton, Playing the End Game: DNA Double-Strand Break Repair Pathway Choice. Mol. Cell 2012, 47, 497–510. [Google Scholar] [CrossRef] [PubMed]
- Pfohl-Leszkowicz, A. MESNA protects rats against nephrotoxicity but not carcinogenity induced by Ochratoxin A, implicating two separate pathways. Med. Biol. 2002, 9, 6357–6361. [Google Scholar]
- Guikema, J.E.; Amiot, M.; Eldering, E. Exploiting the pro-apoptotic function of NOXA as a therapeutic modality in cancer. Expert Opin. Ther. Targets 2017, 21, 767–779. [Google Scholar] [CrossRef]
- Chen, H.C.; Kanai, M.; Inoue-Yamauchi, A.; Tu, H.C.; Huang, Y.; Ren, D.; Kim, H.; Takeda, S.; Reyna, D.E.; Chan, P.M.; et al. An interconnected hierarchical model of cell death regulation by the BCL-2 family. Nat. Cell Biol. 2015, 17, 1270–1281. [Google Scholar] [CrossRef]
- Comim, C.M.; Tatiana, B.; Denis, G.; Felipe, D.P.; Joao, Q.; Stephen, L. Caspase-3 mediates in part hippocampal apoptosis in sepsis. Mol. Neurobiol. 2013, 47, 394–398. [Google Scholar] [CrossRef]
- Larsen, B.D.; Sorensen, C.S. The caspase-activated DNase: Apoptosis and beyond. FEBS J. 2017, 284, 1160–1170. [Google Scholar] [CrossRef]
- D’Amelio, M.; Sheng, M.; Cecconi, F. Caspase-3 in the central nervous system: Beyond apoptosis. Trends Neurosci. 2012, 35, 700–709. [Google Scholar] [CrossRef]
- Gao, Y.N.; Wang, J.Q.; Li, S.L.; Zhang, Y.D.; Zheng, N. Aflatoxin M1 cytotoxicity against human intestinal Caco-2 cells is enhanced in the presence of other mycotoxins. Food Chem. Toxicol. 2016, 96, 79–89. [Google Scholar] [CrossRef]
- Gao, Y.; Li, S.L.; Bao, X.Y.; Luo, C.C.; Yang, H.G.; Wang, J.Q.; Zhao, S.G.; Zheng, N. Transcriptional and Proteomic Analysis Revealed a Synergistic Effect of Aflatoxin M1 and Ochratoxin A Mycotoxins on the Intestinal Epithelial Integrity of Differentiated Human Caco-2 Cells. J. Proteom. Res. 2018, 17, 3128–3142. [Google Scholar] [CrossRef] [PubMed]
- Trapnell, C.; Roberts, A.; Goff, L.; Pertea, G.; Kim, D.; Kelley, D.R.; Pimentel, H.; Salzberg, S.L.; Rinn, J.L.; Pachter, L. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat. Protoc. 2012, 7, 562–578. [Google Scholar] [CrossRef] [PubMed]
- Ernst, J.; Bar-Joseph, Z. STEM: A tool for the analysis of short time series gene expression data. BMC Bioinf. 2006, 7, 191. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2007, 36, 480–484. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta, C.(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]







| Pathway | Pathway ID | Key DEGs from the Pathway |
|---|---|---|
| Cell cycle | ko04110 | MDM2, CDK1, TP53, EP300, ATM, CDKN1B, TGFB1, CHEK1, CDC25B, CCNB1, PDPK1 |
| P53 signaling pathway | ko04115 | MDM2, PMAIP1, CASP3, TP53AIP, CDK1, TP53, ATM, CYCS, TSC2, CHEK1, CASP9, CCNB1, BAX |
| HIF-1 signaling pathway | ko04066 | HIF1A, NFKB1, CDKN1B, MTOR, EP300, AKT1, PIK3R, EGFR, NOX1, INSR, PIK3CA |
| PI3k-Akt signaling pathway | ko04151 | CDKN1B, NFKB1, CCND1, BCL2L1, MYC, PIK3CA, EGFR, MDM2, TP53, IKBKB, AKT1, HRAS, TSC2, IL3RA, MAPK1, SOS1, CASP3, MTOR, INSR, BAD, CASP9, PDPK1 |
| mTOR signaling pathway | ko04150 | MTOR, TNF, IKBKB, PRKAA, PIK3CA, HRAS, TSC2, MAPK1, AKT1, SOS1, INSR, PDPK1 |
| Apoptosis | ko04210 | XIAP, BCL2L1, NFKB1, PIK3CA, CASP3, CYC, BAX, BAD, IL3RA, CASP9, CFLAR, TP53, ATM, HRAS, TRADD, MAPK1, RIPK1, CDKN1B, PMAIP1, TP53AIP, AKT1, TNF, IKBKB |
| Foxo signaling pathway | ko04068 | CDKN1B, PIK3CA, MDM2, PDPK1, EGFR1, FOXO1, AKT1, IRS1, INSR, MDM2, TGFB1, IKBKB, ATM, HRAS, MAPK1, SOS1, EGFR, EP300, CCNB1, TGFB1 |
| Insulin signaling pathway | ko04910 | MAPK1, SOS1, PIK3CA, AKT1, MTOR, IRS1, INSR, HRAS, TSC2, TRADD, MAPK1, CALM1, IKBKB, FOXO1 |
| MAPK signaling pathway | ko04010 | TNF, CASP3, NFKB1, TP53, MAPK14, TGFB1, PIK3CA, HRAS, SOS1, EGFR, MAPK1, TRAF2, CDC25B, AKT1, TNF, IKBKB |
| TNF signaling pathway | ko04668 | XIAP, TNF, NFKB1, CASP3, IKBKB, MAPK1, MAPK14, CASP8, TRADD, FADD, MAPK1, RIPK1, TRAF2, AKT1, PIK3CA |
| Genes | Product Length (bp) | Forward Primer Sequence (5′–3′) | Reverse Primer Sequence (5′–3′) |
|---|---|---|---|
| GAPDH | 235 | GGAGTCCACTGGCGTCTT | GAGTCCTTCCACGATACCAAA |
| CASP3 | 109 | TCCTGAGATGGGTTTATGT | TGTTTCCCTGAGGTTTGC |
| CXCL2 | 150 | CCAAACCGAAGTCATAGC | GAACAGCCACCAATAAGC |
| CDC25B | 296 | GTAGACGGAAAGCACCAAGA | TCCCTGATGAAACGGCAC |
| EGR1 | 229 | CACGAACGCCCTTACGCT | CATCGCTCCTGGCAAACT |
| H2BFS | 119 | TGCTCGTCTCAGGCTCGTAG | CTTCCTGCCGTCCTTCTTCT |
| SHPK | 58 | AGTAGATGCGGCAATGGT | TTGGTAGGGATGGCTGTG |
| TEFC | 94 | GCACTGGAGGGATAAATG | TAAAGACACCCGAAGGAT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, X.; Gao, Y.; Yan, Q.; Bao, X.; Zhao, S.; Wang, J.; Zheng, N. Transcriptome Analysis of Ochratoxin A-Induced Apoptosis in Differentiated Caco-2 Cells. Toxins 2020, 12, 23. https://doi.org/10.3390/toxins12010023
Yang X, Gao Y, Yan Q, Bao X, Zhao S, Wang J, Zheng N. Transcriptome Analysis of Ochratoxin A-Induced Apoptosis in Differentiated Caco-2 Cells. Toxins. 2020; 12(1):23. https://doi.org/10.3390/toxins12010023
Chicago/Turabian StyleYang, Xue, Yanan Gao, Qiaoyan Yan, Xiaoyu Bao, Shengguo Zhao, Jiaqi Wang, and Nan Zheng. 2020. "Transcriptome Analysis of Ochratoxin A-Induced Apoptosis in Differentiated Caco-2 Cells" Toxins 12, no. 1: 23. https://doi.org/10.3390/toxins12010023
APA StyleYang, X., Gao, Y., Yan, Q., Bao, X., Zhao, S., Wang, J., & Zheng, N. (2020). Transcriptome Analysis of Ochratoxin A-Induced Apoptosis in Differentiated Caco-2 Cells. Toxins, 12(1), 23. https://doi.org/10.3390/toxins12010023
