Next Article in Journal
Altered Gene Response to Aflatoxin B1 in the Spleens of Susceptible and Resistant Turkeys
Next Article in Special Issue
Molecular Phylogenetic Relationships, Trichothecene Chemotype Diversity and Aggressiveness of Strains in a Global Collection of Fusarium graminearum Species
Previous Article in Journal
How Ricin Damages the Ribosome
Previous Article in Special Issue
Fluorescence Spectroscopic Investigation of Competitive Interactions between Quercetin and Aflatoxin B1 for Binding to Human Serum Albumin
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Monitoring of Fusarium Species and Trichothecene Genotypes Associated with Fusarium Head Blight on Wheat in Hebei Province, China

1
Plant Protection Institute, Hebei Academy of Agricultural and Forestry Sciences, Key Laboratory of Integrated Pest Management on Crops in Northern Region of North China, Ministry of Agriculture, Baoding 071000, China
2
School of Biological Sciences, Faculty of Science, University of Sydney, Sydney 2006, New South Wales, Australia
3
College of Plant Protection, Agricultural University of Hebei, Baoding 071001, China
*
Authors to whom correspondence should be addressed.
Toxins 2019, 11(5), 243; https://doi.org/10.3390/toxins11050243
Submission received: 30 March 2019 / Revised: 21 April 2019 / Accepted: 25 April 2019 / Published: 28 April 2019

Abstract

To clarify the changes in field populations of Fusarium head blight (FHB) pathogens over a decade, Fusarium species and trichothecene genotypes associated with FHB on wheat were monitored in Hebei province during the periods 2005–2006 and 2013–2016. Fusarium species determination was carried out by morphological identification, species-specific amplification and partial translation elongation factor (TEF-1α) gene sequencing. Trichothecene genotype prediction was carried out by primers 3CON/3NA/3D15A/3D3 or Tri13F/Tri13R, Tri303F/Tri303R and Tri315F/Tri315R. A total of 778 purified Fusarium isolates were recovered from 42 sampling sites in 17 counties during the period 2005–2006 and 1002 Fusarium isolates were recovered from 122 sampling sites in 65 counties during the period 2013–2016. F. graminearum was the predominant pathogen recovered during the periods 2005–2006 and 2013–2016. However, the pathogen composition differed slightly between the two periods. In 2005–2006, 752 out of 778 (96.7%) of the isolates belonged to F. graminearum. Two were identified as F. culmorum. Five other Fusarium species were also recovered, F. equiseti, F. verticillioides, F. proliferatum, F. subglutinans and F. chlamydosporum, with lower recoveries of 0.4%, 0.8%, 0.8%, 0.1% and 1.0%, respectively. Trichothecene genotype prediction showed that all the 752 F. graminearum isolates were of the 15-ADON genotype. Five Fusarium species were recovered from samples collected over the period 2013–2016. F. graminearum was again the predominant pathogen with an isolation frequency of 97.6%. F. pseudograminearum, F. asiaticum, F. culmorum and F. negundis were also isolated at a recovery of 1.4%, 0.7%, 0.2% and 0.1%, respectively. For the 2013–2016 isolates, 971 of the 978 F. graminearum strains were 15-ADON whereas seven isolates were of the 3-ADON type. All seven F. asiaticum isolates were of the NIV type and fourteen F. pseudograminearum isolates were classified as 3-ADON. F. pseudograminearum was first isolated from FHB in Hebei in 2013. Although the recovery of F. pseudograminearum is still low, it represents a small shift in the pathogen composition and trichothecene genotypes associated with FHB in Hebei province. As Fusarium crown rot of wheat caused by F. pseudograminearum is an increasing problem in Hebei province, it is appropriate to monitor the role of F. pseudograminearum in FHB in the future.
Key Contribution: Fusarium graminearum was the predominant pathogen of Fusarium head blight in Hebei province, China. However, the pathogen composition differed slightly between the periods 2005–2006 and 2013–2016.

1. Introduction

Fusarium head blight (FHB), caused by a complex of the Fusarium species, is a devastating disease affecting wheat and other small grains in many regions throughout the world [1]. In addition to direct yield losses, FHB reduces grain quality, and harvested grain is often contaminated with mycotoxins [2]. This disease affects wheat, barley and other small grains both in temperate and subtropical regions. It has the capacity to destroy a potentially high-yielding crop within a few weeks of harvest [1]. During the early years of the twentieth century, FHB was considered a major threat to wheat and barley worldwide. In China, FHB caused epidemics in the mid- to downstream regions of the Yangtze River, the northeast province of Heilongjiang, and parts of southern China in the 1950s to 1960s [3].
In recent decades, FHB has again become a major problem worldwide and epidemics have occurred in Asia, Australia, Europe, southern Africa and North America [4,5,6]. In the mid 1990s, wheat losses from FHB were estimated at $1–2.5 billion in the USA, $220–300 million in Canada and caused major socio-economic problems [1,7]. Similarly, in 1985, a major epidemic of FHB was also reported in Henan province on the North China Plain (the main wheat-growing region of China), affecting 3.7 Mha of wheat and causing about 0.9 Mt loss of wheat production [8]. Severe epidemics of FHB also occurred in 1998 and 2003 on the North China Plain [9].
Over 17 species have been reported to be associated with FHB, with Fusarium graminearum species complex (FGSC) being the most common causal agent in many countries of the world including the USA, Canada, Australia, and in parts of central Europe [10,11], whereas in cooler, maritime regions such as the UK and northern Europe, F. culmorum predominates [12,13]. In Australia, F. pseudograminearum was also found to cause FHB in wheat and triticale in the northern wheatbelt of New South Wales in some years at low levels [4]. Recently, it has been confirmed that FGSC comprises at least 16 phylogenetically distinct species, with F. graminearum being the most widely distributed species causing FHB around the world [14,15], while F. asiaticum is the main FHB pathogen present in Asia [16,17,18,19]. From 1975 to 1985, the national FHB cooperation group of China surveyed the species associated with FHB in 22 provinces. More than 20 Fusarium species and subspecies were found to be associated with FHB but F. graminearum (FGSC) was the most important species in most provinces. However, F. culmorum was common in Guizhou province and the Ningxia Hui autonomous region [20]. In recent years, studies associated with FHB have shown that F. graminearum is the predominant species in the north of China where the annual average temperature is 15 °C or lower, whereas F. asiaticum is predominant in the south where the annual average temperature is above 15 °C and FHB epidemics occur most frequently [16,21,22,23].
Hebei province is located in the north of the North China Plain, an important agricultural region with biannual crop rotation of wheat and maize. In the last two decades, there have been major changes in farming systems in Hebei province. These changes include the adoption of continuous wheat–maize cropping systems with residue retention, and the introduction of high-yielding cultivars which lack resistance to FHB [9,24]. The major Fusarium species causing FHB, F. graminearum, also causes stalk and cob rot of maize, and produces abundant perithecia on wheat and maize residues. Presumably, these changes were conducive to an increase in the inoculum levels of F. graminearum, and other species that also cause FHB such as F. culmorum [1]. Most importantly, the adoption of wheat conservation farming systems accompanied by stubble retention, and drought during the growing season, favored the occurrence of Fusarium crown rot (FCR) of wheat caused by F. pseudograminearum in Hebei. Thus, it is not surprising that five isolates of F. pseudograminearum have also been detected from FHB samples [25].
Considering the major changes in the status of FHB and farming systems over the last decade, we aimed to assess possible changes in the pathogen composition of FHB, including the chemotypes of each species and their geographical distribution in Hebei province during the years 2005–2006 and 2013–2016. It is important to clarify the nature and proportion of the Fusarium species associated with FHB in Hebei province, as management decisions need to be made on the basis of such information.

2. Results

2.1. Fusarium Species Determination

During the period 2005–2006, a total of 778 Fusarium isolates were recovered from rachis tissue affected by FHB collected from 42 sampling sites across 17 counties, and seven Fusarium species were identified after cultures were purified. F. graminearum was the most common species of the FHB complex recovered during the period 2005–2006. The percentage of isolates identified as F. graminearum ranged from 86.2% to 100% across the sampling sites, with an average of 96.7% (Table 1) and were recovered from all 42 sampling sites. F. culmorum, F. equiseti, F. verticillioides, F. proliferatum, F. subglutinans and F. chlamydosporum were also recovered from some of the samples with lower recoveries of 0.3%, 0.4%, 0.8%, 0.8%, 0.1% and 1.0%, respectively (Table 1). F. graminearum was the predominant pathogenic species recovered from all sampling sites during the period 2005–2006, and it was the only species isolated from samples from Hengshui and Tangshan regions. F. culmorum was only isolated from samples from Handan region with a recovery of 0.7%.
A total of 1002 purified Fusarium isolates were recovered from 122 sampling sites across 65 counties during the period 2013–2016. Five Fusarium species, F. graminearum, F. asiaticum, F. pseudograminearum, F. culmorum and F. negundis, were recovered and 978 out of 1002 (97.6%) isolates were identified as F. graminearum. The percentage of isolates identified as F. graminearum was 100% in Baoding and Langfang sampling sites (Table 2). F. asiaticum, F. pseudograminearum, F. culmorum and F. negundis were isolated at low recoveries of 0.7%, 1.4%, 0.2% and 0.1%, respectively (Table 2). Seven F. asiaticum isolates originated from Xingtai and Tangshan. Among them, six out of seven isolates were recovered from Tangshan, where wheat–maize and wheat–rice rotation systems coexisted. F. pseudograminearum was also recovered from most sampling sites except Baoding and Langfang. Isolates of F. pseudograminearum were mainly recovered from the mid-south of Hebei province, Handan, Xingtai, Hengshui, Cangzhou and Shijiazhuang where FCR had been found at high levels since 2013. Phylogenetic analysis of the TEF-1α gene sequence of F. pseudograminearum strains showed that there is no genetic difference between isolates from FHB and FCR (data not shown).

2.2. Prediction of Trichothecene Genotype

Seven hundred and fifty-two Fusarium isolates from 2005–2006 and 999 Fusarium isolates from 2013–2016 were chemotaxonomically classified into 15-ADON, 3-ADON and NIV types by primers 3CON/3NA/3D15A/3D3 or Tri13F/Tri13R, Tri303F/Tri303R, and Tri315F/Tri315R. All F. graminearum isolates from 2005–2006 were classified as 15-ADON type (Table 3). During the period 2013–2016, in the predominant species, F. graminearum, 15-ADON and 3-ADON types were both recovered. Among them, 971 out of 978 (99.3%) isolates were 15-ADON type, whereas only seven out of 978 (0.7%) isolates were classified as 3-ADON, which were isolated from the mid-south of Hebei province, Shijiazhuang, Xingtai and Handan. Moreover, all the isolates of F. asiaticum and of F. pseudograminearum were NIV and 3-ADON types, respectively.

3. Discussion

FHB can be caused by a number of fungal species. The most common pathogens are F. graminearum, F. culmorum, F. avenaceum, and Microdochium nivale [12]. Other fungi associated with this disease include F. poae [26], F. pseudograminearum (=F. graminearum Group 1 (Francis and Burgess)) [4] and F. equiseti [27]. F. equiseti is generally considered a saprophyte that can colonize diseased or senescent tissue. The relative contribution of these species to FHB will depend upon a range of variables, particularly temperature, rainfall and humidity [28]. In the present study, ten Fusarium species were confirmed to be associated with FHB in Hebei province. However, F. graminearum was found to be the dominant pathogenic species associated with FHB in the surveys over two consecutive periods of time, seven years apart. This finding is consistent with reports from North America and parts of Europe as well as other provinces of the northern part of China [1,23] where maize is now commonly used in rotation with wheat. Consequently, this rotation can be considered a key factor contributing to the high incidence of FHB caused by F. graminearum in Hebei. F. graminearum persists in maize and wheat residues and produces abundant perithecia on these residues. The perithecia release ascospores under cool wet conditions which act as the primary inoculum causing initial infection of the wheat heads [29]. Ascospores can also drift in the air and infect crops remote from the location of the perithecia [30,31].
In contrast, F. culmorum was recovered at a low level but was found during the periods 2005–2006 and 2013–2016. This finding also agrees with earlier findings which indicated that the species is more common in cooler conditions in areas where maize is less common such as cooler, maritime climate regions of Europe as well as Ningxia Hui autonomous region and Guizhou province of China [12,20]. In Hebei province, the wheat–maize rotation system enables the homothallic F. graminearum to produce abundant perithecia on maize stubble and then release ascospores as the primary inoculum of FHB. Climatic conditions also favor F. graminearum over F. culmorum, F. avenaceum and F. poae, as the former species has a higher optimum temperature, whereas the latter species prefer cooler conditions [28]. Several other Fusarium species were recovered during the period 2005–2006. In 2005–2006, the samples were collected slightly later after the onset of FHB. Presumably, this enabled more secondary colonizers to invade the heads prior to sampling and led to relatively higher isolation of a wider range of secondary colonizers. The isolation of F. verticillioides, F. proliferatum and F. subglutinans at low levels is not surprising as these are commonly associated with maize, as endophytes and stress-related stalk and cob rot pathogens. The remaining two Fusarium species, F. equiseti and F. chlamydosporum, are commonly associated with cereals as saprophytic species [32,33]. These species can interfere with the recovery of the pathogenic species following very wet conditions, even when a selective isolation medium is used.
There were more pathogenic species detected during the period 2013–2016 than the period 2005–2006. F. asiaticum and F. pseudograminearum both emerged as causal agents of FHB in Hebei during the period 2013–2016. They were not recovered during the surveys in the period 2005–2006. F. asiaticum was isolated mainly from the regions with rice cultivation. This result is consistent with earlier findings from China, Korea and Brazil, in which F. asiaticum dominated in regions where rice is grown in rotation with wheat, whereas F. graminearum was more common in wheat–maize rotation systems [12,34,35,36]. Furthermore, F. pseudograminearum was also obtained from FHB-infected spikes in the mid-south part of Hebei province where FCR caused by F. pseudograminearum has emerged as a new destructive disease of wheat and the disease incidence and severity has been increasing year by year [37]. F. pseudograminearum has also been reported to cause FHB in Australia under favorable conditions, but usually at low levels [4,38]. Both F. pseudograminearum and F. graminearum caused FCR and FHB in surveys of wheat crops in Australia, though F. pseudograminearum was more frequently isolated from the crown, whereas F. graminearum was mostly recovered from the head [39]. In the wheat–maize biannual crop rotation system of Hebei province, 10–15 cm of standing wheat stubble is left on the field after harvest, then maize seed is sown directly. Subsequently, the maize and wheat stubbles are rotary-cultivated back into the upper 10 cm of soil after maize harvest. Wheat seeds are planted immediately, leaving no time for straw decomposition. This system provides more opportunity for the two pathogens, especially F. pseudograminearum, to infect the new host. Crop residues that favor persistence of Fusarium mycelia in infested residues also favor FCR [40], while the macroconidia of F. pseudograminearum produced on diseased wheat debris might also favor infection of wheat heads through water splash of macroconidia [41].
The composition of the pathogens causing FHB is believed to be determined, in part, by climatic factors such as temperature and moisture, as well as agronomic factors such as soil tillage and previous crops [42,43,44]. In the cooler, maritime climatic regions of Europe where F. culmorum has previously been reported to be the dominant pathogen of FHB, evidence shows that climatic and agricultural changes have favored the propagation of F. graminearum over F. culmorum, as the former species has a higher optimum temperature. Rising temperatures and an increase in minimum tillage and maize cropping have also favored F. graminearum. Similarly, there has been a decline in the presence of F. culmorum and an increase in F. graminearum in the UK [45], Netherlands [46], Denmark [47] and Poland [48] in the last two decades. Although the recovery of F. pseudograminearum from wheat heads has so far been identified in a limited amount in Hebei province, its potential development into a common pathogen of FHB is of concern in FCR and FHB co-existence regions. Thus, there is a need for ongoing monitoring of the incidence and distribution of F. pseudograminearum causing FHB in Hebei province. Studies need to span the entire FHB and FCR continuum to address key questions on pathogen biology and genetics in the local farming systems. Such information would be a valuable basis for clarifying the epidemiology and mycotoxin issues relating to FHB. It will also be important for the formulation of integrated disease management strategies for the management of the diseases caused by this fungus.

4. Materials and Methods

4.1. Sampling

Diseased wheat spikes with characteristic symptoms of FHB were collected from farmers’ fields (42 sampling sites in 17 counties during the period 2005–2006 and 122 sampling sites in 65 counties during the period 2013–2016) in Hebei province. The sampling sites represented the different latitudes from the north to the south of Hebei and were recorded by a Global Positioning System (GPS) locator eTrex (Garmin Corporation, Xinbei City, Taiwan). The map indicating the sample sites was generated by the software ArcGIS10 (Esri, Redlands, CA, USA) (Figure 1). Each sample consisted of 10–20 spikes collected on an ad hoc basis across each field.

4.2. Isolation and Morphological Identification

Discolored segments of floral rachis were surface sterilized with 70% ethanol and plated onto Peptone PCNB Agar (PPA), a selective medium for Fusarium species [49], and incubated at 22–25 °C under fluorescent and long-wavelength ultraviolet lights with a 12-h photoperiod [50]. All Fusarium isolates which developed from the rachis segments were sub-cultured to carnation leaf-piece agar (CLA) [51], and incubated as above for 10 d. Fusarium isolates were purified by single-spore isolation. Single-spore isolates were cultured on potato dextrose agar (PDA) and CLA. Isolates producing purple pigment and microconidia on PDA were also cultured on Spezieller Nahrstoffarmer Agar (SNA) [52]. Isolates were identified to species level on the basis of morphological criteria according to the descriptions in Burgess et al. [50] and Leslie & Summerell [52].

4.3. DNA Extraction

DNA of purified isolates was extracted using the commercial Fast-DNA® Spin Kit (Qbiogene, Carlsbad, CA, USA). The mycelium of 5- to 7-day old cultures grown on PDA was scraped and added to Lysis Matrix A tubes and run in a FastPrep® Cell Disrupter (Qbiogene, Carlsbad, CA, USA) for 20 s at speed level 5.5. The extraction was then carried out according to the manufacturer’s instructions.

4.4. Species Determination and Trichothecene Genotype Prediction

Fusarium species-specific PCR was performed using primers Fg16F/Fg16R, Fp1-1/Fp1-2 and Fc01F/Fc01R for the detection of FGSC, F. pseudograminearum and F. culmorum (Table 4). Fg16F/Fg16R produces a monomorphic product of 420 bp DNA fragment specific to F. graminearum and about 500 bp DNA fragment suspect to F. asiaticum [53,54]. Amplification reactions were carried out in 20 µL volumes containing 5–20 ng fungal DNA. The reaction mixture consisted of 0.2 mM concentrations of each deoxynucleoside triphosphate, 0.2 µm of each primer, and 1 unit Taq DNA polymerase in 1x PCR buffer with 1.5 mm MgCl2. A negative control, containing all reagents but no DNA, was used in every set of reactions. The cycling conditions consisted of denaturation (94 °C) for 30 s, annealing (Table 4) for 30 s and extension (72 °C) for 60 s followed by a final extension of 72 °C for 5 min. Isolates of other species and some of F. graminearum were amplified by primers EF-1α F/EF-1α R originated from partial translation elongation factor (TEF-1α) gene sequences (Table 4). The sequences of these strains were blasted in Fusarium-ID database [55] and the strains were confirmed to species level.
For trichothecene genotype prediction, Tri3 multiplex amplification was performed in 20 µL volumes using primers 3CON/3NA/3D15A/3D3 for FGSC and Tri13F/Tri13R, Tri303F/Tri303R, and Tri315F/Tri315R for F. pseudograminearum, respectively (Table 4). The reaction mixture and the cycling conditions were the same as described above with the annealing temperatures listed in the table.

Author Contributions

Conceptualization, L.W.B.; Data curation, L.J.; Funding acquisition, K.C. and L.K.; Investigation, Q.L. and M.S.; Methodology, L.J.; Supervision, K.C. and L.K.; Visualization, Y.W.; Writing—original draft, L.J.; Writing—review & editing, L.W.B. and L.K.

Funding

This work was supported by the National Key R&D Program of China (2016YFD0300705, 2017YFD0201707), and the National Crop Improvement Science and Technology Project of China (2006BAD02A08).

Conflicts of Interest

The authors declare no conflict of interest. The founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.

References

  1. McMullen, M.P.; Jones, R.; Gallenberg, D. Scab of wheat and barley: A re-emerging disease of devastating impact. Plant Dis. 1997, 81, 1340–1348. [Google Scholar] [CrossRef] [PubMed]
  2. Seitz, L.M.; Eustace, W.D.; Mohr, H.E.; Shogren, M.D.; Yamazaki, W.T. Cleaning, milling, and baking tests with hard red winter wheat containing deoxynivalenol. Cereal Chem. 1986, 63, 146–150. [Google Scholar]
  3. Yao, J.B.; Lu, W.Z. Research advances in wheat breeding for scab resistance in China. Jiangsu J. Agric. Sci. 2000, 16, 242–248. [Google Scholar]
  4. Burgess, L.W.; Klein, T.A.; Bryden, W.L.; Tobin, N.F. Head blight of wheat caused by Fusarium graminearum Group1 in New South Wales in 1983. Australas. Plant Path. 1987, 16, 72–78. [Google Scholar] [CrossRef]
  5. Boshof, W.H.P.; Swart, W.J.; Pretorius, Z.A. Isozyme characterisation of Fusarium graminearum isolates associated with head blight of irrigated wheat in South Africa. S. Afr. J. Bot. 1999, 65, 281–286. [Google Scholar] [CrossRef]
  6. Stack, R.W. Return of an Old Problem: Fusarium Head Blight of Small Grains. APSnet Feature. APSnet Plant Pathology Online. 1999. Available online: https://www.apsnet.org/publications/apsnetfeatures/Pages/headblight.aspx (accessed on 28 January 2019).
  7. Windels, C.E. Economic and social impacts of Fusarium head blight: Changing farms and rural communities in the Northern Great Plains. Phytopathology 2000, 90, 17–21. [Google Scholar] [CrossRef]
  8. Song, Y.L.; He, W.L.; Yang, G.Q.; Liu, H.Y. The prevalence of Fusarium head blight in Henan Province and the counter measures. J. Henan Agric. Sci. 2000, 4, 14. [Google Scholar]
  9. Wang, H.J.; Gou, J.J.; Xue, Y.; Lu, S.Z.; Li, J.X.; Hu, X.Z.; Wu, C.L.; Chen, H.Y. Discuss the integrated control strategy of wheat pests according to the occurrence of Fusarium head blight in Hebei province in 2003. Res. Plant Pathol. Hebei 2003, 1, 7–9. [Google Scholar]
  10. Goswami, R.S.; Kistler, H.C. Heading for disaster: Fusarium graminearum on cereal crops. Mol. Plant Pathol. 2004, 5, 515–525. [Google Scholar] [CrossRef]
  11. Osborne, L.E.; Stein, J.M. Epidemiology of Fusarium head blight on small-grain cereals. Int. J. Food Microbiol. 2007, 119, 103–108. [Google Scholar] [CrossRef] [PubMed]
  12. Parry, D.W.; Jenkinson, P.; McLeod, L. Fusarium ear blight (scab) in small grain cereals-a review. Plant Pathol. 1995, 44, 207–238. [Google Scholar] [CrossRef]
  13. Jennings, P.; Coates, M.E.; Walsh, K.; Turner, J.A.; Nicholson, P. Determination of deoxynivalenol-and nivalenol-producing chemotypes of Fusarium graminearum isolated from wheat crops in England and Wales. Plant Pathol. 2004, 53, 643–652. [Google Scholar] [CrossRef]
  14. Sarver, B.A.; Ward, T.J.; Gale, L.R.; Broz, K.; Corby Kistler, H.; Aoki, T.; Nicholson, P.; Carter, J.; O’Donnell, K. Novel Fusarium head blight pathogens from Nepal and Louisiana revealed by multilocus genealogical concordance. Fungal Genet. Biol. 2011, 48, 1096–1107. [Google Scholar] [CrossRef] [PubMed]
  15. O’Donnell, K.; Ward, T.J.; Aberra, D.; Kistler, H.C.; Aoki, T.; Orwig, N.; Kimura, M.; Bjornstad, S.; Klemsdal, S.S. Multilocus genotyping and molecular phylogenetics resolve a novel head blight pathogen within the Fusarium graminearum species complex from Ethiopia. Fungal Genet. Biol. 2008, 45, 1514–1522. [Google Scholar] [CrossRef] [PubMed]
  16. Zhang, H.; Van der Lee, T.; Waalwijk, C.; Chen, W.Q.; Xu, J.; Xu, J.S.; Zhang, Y.; Feng, J. Population analysis of the Fusarium graminearum species complex from wheat in China show a shift to more aggressive isolates. PLoS ONE 2012, 7, e31722. [Google Scholar] [CrossRef]
  17. Suga, H.; Karugia, G.W.; Ward, T.; Gale, L.R.; Tomimura, K.; Nakajima, T.; Miyasaka, A.; Koizumi, S.; Kageyama, K.; Hyakumachi, M. Molecular characterization of the Fusarium graminearum species complex in Japan. Phytopathology 2008, 98, 159–166. [Google Scholar] [CrossRef]
  18. Karugia, G.W.; Suga, H.; Gzle, L.R.; Nakajima, T.; Ueda, A.; Hyakumachi, M. Population structure of Fusarium asiaticum from two Japanese regions and eastern China. J. Gen. Plant Pathol. 2009, 75, 110–118. [Google Scholar] [CrossRef]
  19. Ueda, A.; Nishimoto, H.; Kato, N.; Hirano, T.; Fukaya, M. Lineages and trichothecene mycotoxin types of Fusarium head blight pathogens of wheat and barley in Todai district. Res. Bull. Aichi. Agric. Res. Ctr. 2007, 39, 17–23. [Google Scholar]
  20. Lu, W.Z.; Cheng, S.H.; Wang, Y.Z. Fusarium Head Blight Research; Science Press: Beijing, China, 2001. [Google Scholar]
  21. Zhang, J.B.; Li, H.P.; Dang, F.J.; Qu, B.; Xu, Y.B.; Zhao, C.S.; Liao, Y.C. Determination of the trichothecene mycotoxin chemotypes and associated geographical distribution and phylogenetic species of the Fusarium graminearum clade from China. Mycol. Res. 2007, 111, 967–975. [Google Scholar] [CrossRef]
  22. Qu, B.; Li, H.P.; Zhang, J.B.; Xu, Y.B.; Huang, T.; Wu, A.B.; Zhao, C.S.; Carter, J.; Nicholson, P.; Liao, Y.C. Geographic distribution and genetic diversity of Fusarium graminearum and F. asiaticum on wheat spikes throughout China. Plant Pathol. 2008, 57, 15–24. [Google Scholar] [CrossRef]
  23. Hao, J.J.; Xie, S.N.; Sun, J.; Yang, G.Q.; Liu, J.Z.; Xu, F.; Ru, Y.Y.; Song, Y.L. Analysis of Fusarium graminearum species complex from wheat-maize rotation regions in Henan (China). Plant Dis. 2017, 101, 720–725. [Google Scholar] [CrossRef]
  24. Hu, L.F.; Zhang, L.F. Analysis and comparison of livestock breeding in the north with straws from the south with straw return to field. J. Agric. Univ. Hebei 2003, 26, 12–14. [Google Scholar]
  25. Ji, L.J.; Kong, L.X.; Li, Q.S.; Wang, L.S.; Chen, D.; Ma, P. First report of Fusarium pseudograminearum causing Fusarium head blight of wheat in Hebei Province, China. Plant Dis. 2016, 100, 220. [Google Scholar] [CrossRef]
  26. Nicholson, P.; Simpson, D.R.; Wilson, A.H.; Chandler, E.; Thomsett, M. Detection and differentiation of trichothecene and enniatin-producing Fusarium species on small-grain cereals. Eur. J. Plant Pathol. 2004, 110, 503–514. [Google Scholar] [CrossRef]
  27. Langseth, W.; Bernhoft, A.; Rundberget, T.; Kosiak, B.; Gareis, M. Mycotoxin production and cytotoxicity of Fusarium strains isolated from Norwegian cereals. Mycopathologia 1999, 144, 103–113. [Google Scholar] [CrossRef]
  28. Doohan, F.M.; Brennan, J.; Cooke, B.M. Influence of climatic factors on Fusarium species pathogenic to cereals. Eur. J. Plant Pathol. 2003, 109, 755–768. [Google Scholar] [CrossRef]
  29. Obst, A.; Günther, B.; Beck, R.; Lepschy, J.; Tischner, H. Weather conditions conductive to Gibberella zeae and Fusarium graminearum head blight of wheat. J. Appl. Genet. A 2002, 43, 185–192. [Google Scholar]
  30. Maldonado-Ramirez, S.L.; Schmale III, D.G.; Shields, E.J.; Bergstrom, G.C. The relative abundance of viable spores of Gibberella zeae in the planetary boundary layer suggests the role of long-distance transport in regional epidemics of Fusarium head blight. Agric. For. Meteorol. 2005, 132, 20–27. [Google Scholar] [CrossRef]
  31. Schmale, D.G.; Leslie, J.F.; Zeller, K.A.; Saleh, A.A.; Shields, E.J.; Bergstrom, G.C. Genetic structure of atmospheric populations of Gibberella zeae. Phytopathology 2006, 96, 1021–1026. [Google Scholar] [CrossRef]
  32. De Galich, M.T.V. Fusarium head blight in Argentina. In Fusarium Head Scab: Global Status and Future Prospects, Proceedings of a Workshop Held at CIMMYT, EI Batan, Mexico, 13–17 October 1996; Dubin, H.J., Gilchrist, L., Reeves, J., McNab, A., Eds.; D.F.: EI Batan, Mexico, 1997; pp. 19–28. [Google Scholar]
  33. Muthomi, J.W.; Ndung’u, J.K.; Gathumbi, J.K.; Mutitu, E.W.; Wagacha, J.M. The occurrence of Fusarium species and mycotoxins in Kenyan wheat. Crop Prot. 2008, 27, 1215–1219. [Google Scholar] [CrossRef]
  34. Lee, J.; Chang, I.Y.; Kim, H.; Yun, S.H.; Leslie, J.F.; Lee, Y.W. Genetic diversity and fitness of Fusarium graminearum populations from rice in Korea. Appl. Environ. Microbiol. 2009, 75, 3289–3295. [Google Scholar] [CrossRef] [PubMed]
  35. Del Ponte, E.M.; Spolti, P.; Ward, T.J.; Gomes, L.B.; Nicolli, C.P.; Kuhnem, P.R.; Silva, C.N.; Tessmann, D.J. Regional and field-specific factors affect the composition of Fusarium head blight pathogens in subtropical no-till wheat agro ecosystem of Brazil. Phytopathology 2015, 105, 246–254. [Google Scholar] [CrossRef]
  36. Gomes, L.B.; Ward, T.J.; Badiale-Furlong, E.; Del Ponte, E.M. Species composition, toxigenic potential and pathogenicity of Fusarium graminearum species complex isolates from southern Brazilian rice. Plant Pathol. 2015, 64, 980–987. [Google Scholar] [CrossRef]
  37. Ji, L.J.; Kong, L.X.; Wang, Y.J.; Li, Q.S. Occurrence and development of wheat crown rot in Hebei province, China. In Paddock to Plates. In Proceedings of the 10th Australasian Soilborne Disease Symposium, Adelaide, Australia, 4–8 September 2018; p. 00136. [Google Scholar]
  38. Southwell, R.J.; Moore, K.J.; Manning, W.; Hayman, P.T. An outbreak of Fusarium head blight of durum wheat on the Liverpool Plains in northern New South Wales in 1999. Australas. Plant Path. 2003, 32, 465–471. [Google Scholar] [CrossRef]
  39. Akinsanmi, O.A.; Mitter, V.; Simpfendorfer, S.; Backhouse, D.; Chakraborty, S. Identity and pathogenicity of Fusarium spp. isolated from wheat fields in Queensland and northern New South Wales. Aust. J. Agric. Res. 2004, 55, 97–107. [Google Scholar] [CrossRef]
  40. Clement, J.A.; Parry, D.W. Stem-base disease and fungal colonization of winter wheat grown in compost inoculated with Fusarium culmorum, F. graminearum and Microdochium nivale. Eur. J. Plant Pathol. 1998, 104, 323–330. [Google Scholar] [CrossRef]
  41. Tan, M.K.; Simpfendorfer, S.; Backhouse, D.; Murray, G.M. Occurrence of Fusarium head blight (FHB) in southern NSW in 2000: Identification of causal fungi and determination of putative chemotype of Fusarium graminearum isolates by PCR. Australas. Plant Path. 2004, 33, 385–392. [Google Scholar] [CrossRef]
  42. Xu, X.M.; Nicholson, P. Community ecology of fungal pathogens causing wheat head blight. Annu. Rev. Phytopathol. 2009, 47, 83–103. [Google Scholar] [CrossRef]
  43. Champeil, A.; Dore, T.; Fourbet, J.F. Fusarium head blight: Epidemiological origin of the effects of cultural practices on head blight attacks and the production of mycotoxins by Fusarium in wheat grains. Plant Sci. 2004, 166, 1389–1415. [Google Scholar] [CrossRef]
  44. Dill-Macky, R.; Jones, R.K. The effect of previous crop residues and tillage in Fusarium head blight of wheat. Plant Dis. 2000, 84, 71–76. [Google Scholar] [CrossRef]
  45. Jennings, P.; Coates, M.E.; Turner, J.A.; Chandler, E.A.; Nicholson, P. Determination of deoxynivalenol and nivalenol chemotypes of Fusarium culmorum isolates from England and Wales by PCR assays. Plant Pathol. 2004, 53, 182–190. [Google Scholar] [CrossRef]
  46. Waalwijk, C.; Kastelein, P.; Vries, I.; Kerényi, Z.; van der Lee, T.; Hesselink, T.; Köhl, J.; Kema, G. Major changes in Fusarium spp. in wheat in the Netherlands. Eur. J. Plant Pathol. 2003, 109, 743–754. [Google Scholar] [CrossRef]
  47. Nielsen, L.K.; Jensen, J.D.; Nielsen, G.C.; Jensen, J.E.; Spliid, N.H.; Thomsen, I.K.; Justesen, A.F.; Collinge, D.B.; Jørgensen, L.N. Fusarium head blight of cereals in Denmark: Species complex and related mycotoxins. Phytopathology 2011, 101, 960–969. [Google Scholar] [CrossRef]
  48. Stępień, L.; Chełkowski, J. Fusarium head blight of wheat: Pathogenic species and their mycotoxins. World Mycotoxin J. 2010, 3, 107–119. [Google Scholar] [CrossRef]
  49. Nash, S.M.; Snyder, W.C. Quantitative estimations by plate counts of propagules of the bean root rot Fusarium in field soils. Phytopathology 1962, 52, 567–572. [Google Scholar]
  50. Burgess, L.W.; Summerell, B.A.; Bullock, S.; Gott, K.P.; Backhouse, D. Laboratory manual for Fusarium research, 3rd ed.; University of Sydney/Royal Botanic Gardens: Sydney, Australia, 1994. [Google Scholar]
  51. Fisher, N.L.; Burgess, L.W.; Toussoun, T.A.; Nelson, P.E. Carnation leaves as a substrate and for preserving cultures of Fusarium species. Phytopathology 1982, 72, 151–153. [Google Scholar] [CrossRef]
  52. Leslie, J.F.; Summerell, B.A. The Fusarium Laboratory Manual; Blackwell Publishing Ltd.: Oxford, UK, 2006. [Google Scholar]
  53. Carter, J.P.; Rezanoor, H.N.; Holden, D.; Desjardins, A.E.; Plattner, R.D.; Nicholson, P. Variation in pathogenicity associated with the genetic diversity of Fusarium graminearum. Eur. J. Plant Pathol. 2002, 108, 573–583. [Google Scholar] [CrossRef]
  54. O’Donnell, K.; Ward, T.J.; Geiser, D.M.; Kistler, H.C.; Aoki, T. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet. Biol. 2004, 41, 600–623. [Google Scholar] [CrossRef]
  55. Geiser, D.M.; del Mar Jiménez-Gasco, M.; Kang, S.; Makalowska, I.; Veeraraghavan, N.; Ward, T.J.; Zhang, N.; Kuldau, G.A.; O’Donnell, K. FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium. Eur. J. Plant Pathol. 2004, 110, 473–479. [Google Scholar] [CrossRef]
  56. Nicholson, P.; Simpson, D.R.; Weston, G.; Rezanoor, H.N.; Lees, A.K.; Parry, D.W.; Joyce, D. Detection and quantification of Fusarium culmorum and Fusarium graminearum in cereals using PCR assays. Physiol. Mol. Plant Pathol. 1998, 53, 17–37. [Google Scholar] [CrossRef]
  57. Demeke, T.; Clear, R.M.; Patrick, S.K.; Gaba, D. Species-specific PCR-based assays for the detection of Fusarium species and a comparison with the whole seed agar plate method and trichothecene analysis. Int. J. Food Microbiol. 2005, 103, 271–284. [Google Scholar] [CrossRef]
  58. O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [PubMed]
  59. Ward, T.J.; Clear, R.M.; Rooney, A.P.; O’Donnell, K.; Gaba, D.; Patrick, S.; Starkey, D.E.; Gilbert, J.; Geiser, D.M.; Nowicki, T.W. An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genet. Biol. 2008, 45, 473–484. [Google Scholar] [CrossRef] [PubMed]
  60. Audenaert, K.; Van Broeck, R.; Bekaert, B.; De Witte, F.; Heremans, B.; Messens, K.; Höfte, M.; Haesaert, G. Fusarium head blight (FHB) in Flanders: Population diversity, inter-species associations and DON contamination in commercial winter wheat varieties. Eur. J. Plant Pathol. 2009, 125, 445–458. [Google Scholar] [CrossRef]
Figure 1. Map of Hebei province indicating the sampling sites during the periods 2005–2006 and 2013–2016.
Figure 1. Map of Hebei province indicating the sampling sites during the periods 2005–2006 and 2013–2016.
Toxins 11 00243 g001
Table 1. Fusarium species recovered from rachis tissue affected by Fusarium head blight in Hebei province during the period 2005–2006.
Table 1. Fusarium species recovered from rachis tissue affected by Fusarium head blight in Hebei province during the period 2005–2006.
Sampling SitesIsolates ObtainedFg aFc aFe aFv aFp aFs aFch a
Handan280274(97.9%) b2(0.7%)2(0.7%)0002(0.7%)
Xingtai8775(86.2%)005(5.7%)3(3.4%)04(4.6%)
Hengshui1515(100.0%)000000
Shijiazhuang3635(97.2%)01(2.8%)0000
Baoding349342(98.0%)001(0.3%)3(0.9%)1(0.3%)2(0.6%)
Tangshan1111(100.0%)000000
Total778752(96.7%)2(0.3%)3(0.4%)6(0.8%)6(0.8%)1(0.1%)8(1.0%)
a Fg: F. graminearum, Fc: F. culmorum, Fe: F. equiseti, Fv: F. verticillioides, Fp: F. proliferatum, Fs: F. subglutinans, Fch: F. chlamydosporum. b Number of isolates (isolation frequency).
Table 2. Fusarium species recovered from wheat rachis tissue affected by Fusarium head blight in Hebei province during the period 2013–2016.
Table 2. Fusarium species recovered from wheat rachis tissue affected by Fusarium head blight in Hebei province during the period 2013–2016.
Sampling SitesIsolates ObtainedFg aFa aFp aFc aFn a
Handan175172(98.3%) b01(0.6%)2(1.1%)0
Xingtai156153(98.1%)1(0.6%)2(1.3%)00
Hengshui132129(97.7%)03(2.3%)00
Cangzhou1816(88.9%)02(11.1%)00
Shijiazhuang153148(96.7%)05(3.3%)00
Baoding157157(100.0%)0000
Langfang7777(100.0%)0000
Tangshan134126(94.0%)6(4.5%)1(0.7%)01(0.7%)
Total1002978(97.6%)7(0.7%)14(1.4%)2(0.2%)1(0.1%)
a Fg: F. graminearum, Fa: F. asiaticum, Fp: F. pseudograminearum, Fc: F. culmorum, Fn: F. negundis. b Number of isolates (isolation frequency).
Table 3. Trichothecene genotype prediction of Fusarium isolates.
Table 3. Trichothecene genotype prediction of Fusarium isolates.
Sampling Sites2005–20062013–2016
Fg aTotalFg aFg aFa aFp aTotal
15-ADON15-ADON3-ADONNIV3-ADON
Handan274274171101173
Xingtai7575150312156
Hengshui1515129003132
Cangzhou--1600218
Shijiazhuang3535145305153
Baoding342342157000157
Langfang--7700077
Tangshan1111126061133
Total7527529717714999
a Fg: F. graminearum, Fa: F. asiaticum, Fp: F. pseudograminearum.
Table 4. List of primers used for the species determination and trichothecene genotype prediction.
Table 4. List of primers used for the species determination and trichothecene genotype prediction.
PrimersSequenceSize (bp)Annealing Temperature °CReference
Fg16FCTCCGGATATGTTGCGTCAA400–50057[56]
Fg16RGGTAGGTATCCGACATGGCAA
Fp1-1CGGGGTAGTTTCACATTTCYG52357[57]
Fp1-2GAGAATGTGATGASGACAATA
Fc01FATGGTGAACTCGTCGTGGC57062[56]
Fc01RCCCTTCTTACGCCAATCTCG
EF-1α FATGGGTAAGGA(AG)GACAAGAC70056[58]
EF-1α RGGA(GA)GTACCAGT(GC)ATCATGTT
3CONTGGCAAAGACTGGTTCAC840 or 610 or 24352[59]
3NAGTGCACAGAATATACGAGC
3D15AACTGACCCAAGCTGCCATC
3D3ACGCATTGGCTAACACATG
Tri13FTACGTGAAACATTGTTGGC234 or 41557[60]
Tri13RGGTGTCCCAGGATCTGCG
Tri303FGATGGCCGCAAGTGGA58352[60]
Tri303RGCCGGACTGCCCTATTG
Tri315FCTCGCTGAAGTTGGACGTAA86361[60]
Tri315RGTCTATGCTCTCAACGGACAAC

Share and Cite

MDPI and ACS Style

Ji, L.; Li, Q.; Wang, Y.; Burgess, L.W.; Sun, M.; Cao, K.; Kong, L. Monitoring of Fusarium Species and Trichothecene Genotypes Associated with Fusarium Head Blight on Wheat in Hebei Province, China. Toxins 2019, 11, 243. https://doi.org/10.3390/toxins11050243

AMA Style

Ji L, Li Q, Wang Y, Burgess LW, Sun M, Cao K, Kong L. Monitoring of Fusarium Species and Trichothecene Genotypes Associated with Fusarium Head Blight on Wheat in Hebei Province, China. Toxins. 2019; 11(5):243. https://doi.org/10.3390/toxins11050243

Chicago/Turabian Style

Ji, Lijing, Qiusheng Li, Yajiao Wang, Lester W Burgess, Mengwei Sun, Keqiang Cao, and Lingxiao Kong. 2019. "Monitoring of Fusarium Species and Trichothecene Genotypes Associated with Fusarium Head Blight on Wheat in Hebei Province, China" Toxins 11, no. 5: 243. https://doi.org/10.3390/toxins11050243

APA Style

Ji, L., Li, Q., Wang, Y., Burgess, L. W., Sun, M., Cao, K., & Kong, L. (2019). Monitoring of Fusarium Species and Trichothecene Genotypes Associated with Fusarium Head Blight on Wheat in Hebei Province, China. Toxins, 11(5), 243. https://doi.org/10.3390/toxins11050243

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop