Antitumor Activity of Warbugia ugandensis: Methanolic Extracts and Gene Regulation in Colorectal Cancer
Abstract
:1. Introduction
1.1. Etiology of Colorectal Cancer and Its Associated Carcinogenesis
1.2. Application of Warburgia Plant Species for Medical Purposes
1.3. Cytotoxic Effects of W. ugandensis on Cancer Cell Lines
2. Materials and Methods
2.1. Sourcing Caco-2 Cell Lines
2.2. Plant Extraction Processes and the Locations Where Plants Are Obtained
2.3. DMSO as a Tool for Biological Evaluation
2.4. Passaging Caco-2 Cell Lines for Extract Exposure
2.5. Caco-2 Cell Lines Treated with Solutions Containing Plant Extracts
2.6. RNA Extraction
2.7. RNA Concentration and Purity Assessment Using UV Spectroscopy
2.8. SYBR Green qRT-PCR Method: Equipment and Step-by-Step Protocol
- Incubation at 42 °C for 5 min.
- Denaturation at 95 °C for 3 min.
- Forty-five amplification cycles, each consisting of the following:
- A temperature of 95 °C for 5 s;
- A temperature of 56 °C for 15 s;
- A temperature of 72 °C for 5 s.
- A 5 μL mRNA template supplemented with sterile double-distilled water;
- A 10 μL Master Mix;
- A 0.4 μL RT Mix;
- A 0.4 μL dUTP;
- Primers of 0.4 μL.
2.9. Analysis of qRT-PCR Results
2.10. Data Analysis
3. Results
3.1. Regulation of COX-2 Gene Expression Following Administration of Methanolic Root and Stem Extracts at Increasing Dosage Concentrations
3.2. Regulation of CASP9 Gene Expression Following Administration of Methanolic Root and Stem Extracts at Increasing Dosage Concentrations
3.3. Regulation of Bcl-xL Gene Expression Following Administration of Methanolic Root and Stem Extracts at Increasing Dosage Concentrations
3.4. Regulation of Bcl2 Gene Expression Following Administration of Methanolic Root and Stem Extracts at Increasing Dosage Concentrations
3.5. Regulation of 5-LOX Gene Expression Following Administration of Methanolic Root and Stem Extracts at Varying Dosage Concentrations
4. Discussion
4.1. Modulation of COX-2 Expression by Root and Stem Extracts in Phytotherapy
4.2. Modulation of CASP9 Expression by Root and Stem Extracts in Phytotherapeutic Contexts
4.3. Modulation of Bcl-xL and Bcl2 Expression by Root and Stem Extracts
4.4. Modulation of 5-LOX Gene Expression by Root and Stem Extracts
5. Conclusions
6. Current and Potential Future Limitations of the Study
6.1. Current Limitations
- Cell line specificity and generalizability:The use of Caco-2 cell lines, which are derived from human colorectal carcinoma, may limit the generalizability of the results to other cell types or tissues. These findings might not fully reflect the plant’s effects in other types of cells or in vivo systems.
- Lack of in vivo validation:In vitro studies often do not account for the complex interactions present in whole organisms. Without in vivo validation, it is difficult to predict how the plant’s metabolites will behave in a living organism, especially considering factors like metabolism, bioavailability, and systemic effects.
- Metabolite identification and quantification:The active metabolites responsible for modulating gene expression may not be fully characterized or quantified. In vitro studies may lack precise information on the specific bioactive compounds, their concentrations, and their precise mechanisms of action.
- Dosing Challenges:The dosing used in in vitro studies may not directly correlate with the concentrations of the active compounds that would be achievable in human tissues or bloodstream after administration. This discrepancy can limit the relevance of findings to real-world therapeutic doses.
- Short-Term Exposure:In vitro studies typically involve relatively short-term exposure of cells to treatments, which may not capture long-term effects or potential delayed responses, such as alterations in cellular pathways over time.
- Absence of systemic interactions:The study may fail to account for interactions between the plant extracts and other compounds, such as drugs or endogenous molecules, that might alter or modulate the effects observed in vitro.
6.2. Potential Future Imitations
- Limited understanding of plant complexity:W. ugandensis contains a complex mixture of bioactive compounds, and future studies may face challenges in isolating and characterizing each compound’s contribution to the observed effects.Scaling up to human studies:
- Translating findings from Caco-2 cell lines and in vitro studies to human clinical trials poses significant challenges. Variability in human genetics, metabolism, and absorption can make it difficult to predict how the plant’s metabolites will behave in human populations.
- Toxicity and safety profiles:Future studies will need to address the potential toxicity and safety profiles of W. ugandensis extracts. While the current study may focus on gene regulation, potential adverse effects at higher doses, chronic exposure, or long-term use need to be investigated.
- Mechanism of action complexity:As more is understood about the interactions between metabolites and gene targets, new questions may arise regarding the broader pathways and networks involved. Understanding how W. ugandensis influences complex cellular processes beyond individual gene regulation will require advanced techniques and systems biology approaches.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Macharia, J.M.; Mwangi, R.W.; Rozmann, N.; Wagara, I.N.; Kaposztas, Z.; Varjas, T.; Mathenge, J.; Bence, R.L. A systematic review of selected plants and their metabolites with anticolorectal cancer effects. Phytomed. Plus 2022, 2, 100332. [Google Scholar] [CrossRef]
- Macharia, J.M.; Mwangi, R.W.; Rozmann, N.; Zsolt, K.; Varjas, T.; Uchechukwu, P.O.; Wagara, I.N.; Raposa, B.L. Biomedicine & Pharmacotherapy Medicinal plants with anti-colorectal cancer bioactive compounds: Potential game-changers in colorectal cancer management. Biomed. Pharmacother. 2022, 153, 113383. [Google Scholar] [CrossRef]
- Macharia, J.M.; Kaposztas, Z.; Varjas, T.; Budán, F.; Zand, A.; Bodnar, I.; Bence, R.L. Targeted lactate dehydrogenase genes silencing in probiotic lactic acid bacteria: A possible paradigm shift in colorectal cancer treatment? Biomed. Pharmacother. 2023, 160, 114371. [Google Scholar] [CrossRef]
- Hanahan, D.; Weinberg, R.A. Review Hallmarks of Cancer: The Next Generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef]
- Ferlay, J.; Colombet, M.; Soerjomataram, I.; Parkin, D.M.; Piñeros, M.; Znaor, A.; Bray, F. Cancer statistics for the year 2020: An overview. Int. J. Cancer 2021, 149, 778–789. [Google Scholar] [CrossRef]
- Flemming, H.C.; Wingender, J. The biofilm matrix. Nat. Rev. Microbiol. 2010, 8, 623–633. [Google Scholar] [CrossRef]
- Sawicki, T.; Ruszkowska, M.; Danielewicz, A.; Niedźwiedzka, E.; Arłukowicz, T.; Przybyłowicz, K.E. A Review of Colorectal Cancer in Terms of Epidemiology, Risk Factors, Development, Symptoms and Diagnosis. Cancers 2021, 13, 2025. [Google Scholar] [CrossRef]
- Dejea, C.M.; Wick, E.C.; Hechenbleikner, E.M.; White, J.R.; Welch, J.L.M.; Rossetti, B.J.; Peterson, S.N.; Snesrud, E.C.; Borisy, G.G.; Lazarev, M.; et al. Microbiota organization is a distinct feature of proximal colorectal cancers. Proc. Natl. Acad. Sci. USA 2014, 111, 18321–18326. [Google Scholar] [CrossRef]
- Xie, Y.; Chen, Y.; Fang, J. Comprehensive review of targeted therapy for colorectal cancer. Signal Transduct. Target. Ther. 2020, 5, 22. [Google Scholar] [CrossRef]
- Benson, A.B.; Venook, A.P.; Al-Hawary, M.M.; Arain, M.A.; Chen, Y.-J.; Ciombor, K.K.; Cohen, S.; Cooper, H.S.; Deming, D.; Farkas, L.; et al. Colon cancer, version 2.2021, NCCN clinical practice guidelines in oncology. J. Natl. Compr. Cancer Netw. 2021, 19, 329–359. [Google Scholar] [CrossRef]
- Surgery, C.C.; Ablation, R.C.; Cancer, C.; Therapy, R.; Systemic, C.C.; Cancer, C. Treating Colorectal Cancer n.d. pp. 1–58.
- National Cancer Institute. Colon Cancer Treatment (PDQ®). In PDQ Cancer Information Summaries; NCI: Rockville, MD, USA, 2024. [Google Scholar]
- Macharia, J.M.; Mwangi, R.W.; Szabó, I.; Zand, A.; Kaposztas, Z.; Varjas, T.; Rozmann, N.; Raposa, B.L. Regulatory activities of Warbugia ugandensis ethanolic extracts on colorectal cancer-specific genome expression dose-dependently. Biomed. Pharmacother. 2023, 166, 115325. [Google Scholar] [CrossRef] [PubMed]
- Maroyi, A. Warburgia salutaris (Bertol. f.) Chiov.: A multi-use ethnomedicinal plant species. J. Med. Plants Res. 2013, 7, 53–60. [Google Scholar]
- Maroyi, A. The genus Warburgia: A review of its traditional uses and pharmacology. Pharm. Biol. 2014, 52, 378–391. [Google Scholar] [CrossRef] [PubMed]
- Van Wyk, B.E. A broad review of commercially important southern African medicinal plants. J. Ethnopharmacol. 2008, 119, 342–355. [Google Scholar] [CrossRef]
- Frum, Y.; Viljoen, A.M.; Drewes, S.E. In vitro 5-lipoxygenase and anti-oxidant activities of Warburgia salutaris and drimane sesquiterpenoids. S. Afr. J. Bot. 2005, 71, 447–449. [Google Scholar] [CrossRef]
- Kitte, R.; Tretbar, M.; Dluczek, S.; Beckmann, L.; Marquardt, P.; Duenkel, A.; Schubert, A.; Fricke, S.; Tretbar, U.S. Results in Chemistry Chemical and Cytotoxic Activity of three main Sesquiterpenoids from Warburgia ugandensis. Results Chem. 2021, 3, 100242. [Google Scholar] [CrossRef]
- Zhuang, X.-C.; Zhang, Y.-L.; Chen, G.-L.; Liu, Y.; Hu, X.-L.; Li, N.; Wu, J.-L.; Guo, M.-Q. Identification of anti-inflammatory and anti-proliferative neolignanamides from Warburgia Ugandensis employing multi-target affinity ultrafiltration and LC-MS. Pharmaceuticals 2021, 14, 313. [Google Scholar] [CrossRef]
- Mbwambo, Z.; Erasto, P.; Innocent, E.; Masimba, P. Antimicrobial and cytotoxic activities of fresh leaf extracts of Warburgia ugandensis. Tanzan. J. Health Res. 2009, 11, 75–78. [Google Scholar] [CrossRef]
- Huang, M.; Lu, J.J.; Huang, M.Q.; Bao, J.L.; Chen, X.P.; Wang, Y.T. Terpenoids: Natural products for cancer therapy. Expert Opin. Investig. Drugs 2012, 21, 1801–1818. [Google Scholar] [CrossRef]
- Borges, A.; Jos, H.; Homem, V.; Sim, M. Comparison of Techniques and Solvents on the Antimicrobial and Antioxidant Potential of Extracts from Acacia dealbata and Olea europaea. Antibiotics 2020, 9, 48. [Google Scholar] [CrossRef]
- Gupta, J. Comparison of Different Solvents for Phytochemical Extraction Potential from Datura metel Plant Leaves. Int. J. Biol. Chem. 2018, 11, 17–22. [Google Scholar] [CrossRef]
- Felhi, S.; Daoud, A.; Hajlaoui, H.; Mnafgui, K.; Gharsallah, N.; Kadri, A. Solvent extraction effects on phytochemical constituents profiles, antioxidant and antimicrobial activities and functional group analysis of Ecballium elaterium seeds and peels fruits. Food Sci. Technol. 2017, 37, 483–492. [Google Scholar] [CrossRef]
- Tégaboué, D.D.; Pouaha, C.L.C.; Etame, R.M.E.; Sikam, K.G.; Hagbe, D.N.; Moussa, I.; Tchientcheu, R.; Mouokeu, R.S.; Ngane, R.A.N. Parts, Period, and Extraction Solvents as Parameters Influencing Harungana madagascariensis Lam. ex Poir. (Hypericaceae) Antibacterial Activity. Evid.-Based Complement. Altern. Med. 2021, 2021, 6615596. [Google Scholar] [CrossRef]
- Smith, W.L.; Garavito, R.M.; Dewitt, D.L. Prostaglandin Endoperoxide H Synthases (Cyclooxygenases)-1 and -2. J. Biol. Chem. 1991, 271, 33157–33160. [Google Scholar] [CrossRef]
- Macharia, J.M.; Ngure, V.; Emődy, B.; Király, B.; Káposztás, Z.; Rozmann, N.; Erdélyi, A.; Raposa, B. Pharmacotherapeutic Potential of Aloe secundiflora against Colorectal Cancer Growth and Proliferation. Pharmaceutics 2023, 15, 1558. [Google Scholar] [CrossRef]
- Macharia, J.M.; Káposztás, Z.; Bence, R.L. Medicinal Characteristics of Withania somnifera L. in Colorectal Cancer Management. Pharmaceuticals 2023, 16, 915. [Google Scholar] [CrossRef]
- Ogwuru, N.; Adamczeski, M. Bioactive natural products derived from polygonum species of plants: Their structures and mechanisms of action. Stud. Nat. Prod. Chem. 2000, 22, 607–642. [Google Scholar] [CrossRef]
- Zhang, M.Z.; Harris, R.C.; McKanna, J.A. Regulation of cyclooxygenase-2 (COX-2) in rat renal cortex by adrenal glucocorticoids and mineralocorticoids. Proc. Natl. Acad. Sci. USA 1999, 96, 15280–15285. [Google Scholar] [CrossRef]
- Schultz, F.; Osuji, O.F.; Wack, B.; Anywar, G.; Garbe, L.A. Antiinflammatory medicinal plants from the ugandan greater mpigi region act as potent inhibitors in the cox-2/pgh2 pathway. Plants 2021, 10, 351. [Google Scholar] [CrossRef]
- Termer, M.; Carola, C.; Salazar, A.; Keck, C.M.; Hemberger, J.; von Hagen, J. Activity-guided characterization of COX-2 inhibitory compounds in Waltheria indica L. extracts. Molecules 2021, 26, 7240. [Google Scholar] [CrossRef]
- Jing, W.; Xiaolan, C.; Yu, C.; Feng, Q.; Haifeng, Y. Pharmacological effects and mechanisms of tannic acid. Biomed. Pharmacother. 2022, 154, 113561. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, D.; Freitas, M.; Tomé, S.M.; Silva, A.M.S.; Laufer, S.; Lima, J.L.F.C.; Fernandes, E. Flavonoids Inhibit COX-1 and COX-2 Enzymes and Cytokine/Chemokine Production in Human Whole Blood. Inflammation 2015, 38, 858–870. [Google Scholar] [CrossRef] [PubMed]
- Souza, M.T.d.S.; Almeida, J.R.G.d.S.; Araujo, A.A.d.S.; Duarte, M.C.; Gelain, D.P.; Moreira, J.C.F.; dos Santos, M.R.V.; Quintans-Júnior, L.J. Structure-activity relationship of terpenes with anti-inflammatory profile—A systematic review. Basic Clin. Pharmacol. Toxicol. 2014, 115, 244–256. [Google Scholar] [CrossRef]
- Ezziyyani, M. Advances in Intelligent Systems and Computing. In Proceedings of the International Conference on Advanced Intelligent Systems for Sustainable Development (AI2SD’2019), Marrakech, Morocco, 8–11 July 2019; Volume 2—Advanced Intelligent Systems for Sustainable Development Applied to Agriculture and Health. Springer: Berlin/Heidelberg, Germany, 2019; Volume 1103. [Google Scholar]
- Montenegro, I.; Tomasoni, G.; Bosio, C.; Quiñones, N.; Madrid, A.; Carrasco, H.; Olea, A.; Martinez, R.; Cuellar, M.; Villena, J. Study on the cytotoxic activity of drimane sesquiterpenes and nordrimane compounds against cancer cell lines. Molecules 2014, 19, 18993–19006. [Google Scholar] [CrossRef]
- Tsujimoto, K.; Ono, T.; Sato, M.; Nishida, T.; Oguma, T.; Tadakuma, T. Regulation of the Expression of Caspase-9 by the Transcription Factor Activator Protein-4 in Glucocorticoid-induced Apoptosis. J. Biol. Chem. 2005, 280, 27638–27644. [Google Scholar] [CrossRef]
- Zhou, F.; Li, Y.; Huang, Y.; Wu, J.; Wu, Q.; Zhu, H.; Wang, J. Upregulation of CASP9 through NF-κB and Its Target MiR-1276 Contributed to TNF α -Promoted Apoptosis of Cancer Cells Induced by Doxorubicin. Int. J. Mol. Sci. 2020, 21, 2290. [Google Scholar] [CrossRef]
- Ye, Y.N.; Wu, W.K.K.; Shin, V.Y.; Bruce, I.C.; Wong, B.C.Y.; Cho, C.H. Dual inhibition of 5-LOX and COX-2 suppresses colon cancer formation promoted by cigarette smoke. Carcinogenesis 2005, 26, 827–834. [Google Scholar] [CrossRef]
- Ding, X.; Zhu, C.; Qiang, H.; Zhou, X.; Zhou, G. Enhancing antitumor effects in pancreatic cancer cells by combined use of COX-2 and 5-LOX inhibitors. Biomed. Pharmacother. 2011, 65, 486–490. [Google Scholar] [CrossRef]
- Rådmark, O.; Shimizu, T.; Jörnvall, H.; Samuelsson, B. Leukotriene A4 hydrolase in human leukocytes. Purification and properties. J. Biol. Chem. 1984, 259, 12339–12345. [Google Scholar] [CrossRef]
- Denis, O.; Richarh, K.; Motlalepula, G.M.; Youngmin, K. A review on the botanical aspects, phytochemical contents and pharmacological activities of Warburgia ugandensis. J. Med. Plants Res. 2018, 12, 448–455. [Google Scholar] [CrossRef]
- Thornberry, N.A.; Lazebnik, Y. Caspases: Enemies within. Science 1998, 281, 1312–1316. [Google Scholar] [CrossRef] [PubMed]
- Morimoto, Y.; Takada, K.; Takeuchi, O.; Watanabe, K.; Hirohara, M.; Hamamoto, T.; Masuda, Y. Bcl-2/Bcl-xL inhibitor navitoclax increases the antitumor effect of Chk1 inhibitor prexasertib by inducing apoptosis in pancreatic cancer cells via inhibition of Bcl-xL but not Bcl-2. Mol Cell. Biochem. 2020, 472, 187–198. [Google Scholar] [CrossRef] [PubMed]
- Sjöström, J.; Bergh, J. How apoptosis is regulated, and what goes wrong in cancer. Br. Med. J. 2001, 322, 1538–1539. [Google Scholar] [CrossRef]
- Wong, B.C.Y.; Zhu, G.H.; Lam, S.K. Aspirin induced apoptosis in gastric cancer cells. Biomed. Pharmacother. 1999, 53, 315–318. [Google Scholar] [CrossRef]
- Martin, C.; Connelly, A.; Keku, T.O.; Mountcastle, S.B.; Galanko, J.; Woosley, J.T.; Schliebe, B.; Lund, P.K.; Sandler, R.S. Nonsteroidal anti-inflammatory drugs, apoptosis, and colorectal adenomas. Gastroenterology 2002, 123, 1770–1777. [Google Scholar] [CrossRef]
Primer ID | Reverse Primer | Forward Primer |
---|---|---|
COX-2 | GCAAACCGTAGATGCTCAGGGA | CGGTGAAACTCTGGCTAGACAG |
5-LOX | CAGGTCTTCCTGCCAGTGATTC | GGAGAACCTGTTCATCAACCGC |
Bcl2 | GCCAGGAGAAATCAAACAGAGGC | ATCGCCCTGTGGATGACTGAGT |
Bcl-xL | AACCAGCGGTTGAAGCGTTCCT | GCCACTTACCTGAATGACCACC |
Casp9 | CAACGTACCAGGAGCCACTCTT | GTTTGAGGACCTTCGACCAGCT |
HPRT1 | CTCAGGAGGAGGAAGCC | TGCTTCTCCTCAGCTTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Macharia, J.M.; Maina, J.K.; Zand, A.; Rono Cheriro, B.; Varjas, T.; Sipos, D.; Káposztás, Z.; Budán, F.; Kövesdi, O.L.; Raposa, B.L. Antitumor Activity of Warbugia ugandensis: Methanolic Extracts and Gene Regulation in Colorectal Cancer. Nutrients 2025, 17, 471. https://doi.org/10.3390/nu17030471
Macharia JM, Maina JK, Zand A, Rono Cheriro B, Varjas T, Sipos D, Káposztás Z, Budán F, Kövesdi OL, Raposa BL. Antitumor Activity of Warbugia ugandensis: Methanolic Extracts and Gene Regulation in Colorectal Cancer. Nutrients. 2025; 17(3):471. https://doi.org/10.3390/nu17030471
Chicago/Turabian StyleMacharia, John M., John K. Maina, Afshin Zand, Betsy Rono Cheriro, Tímea Varjas, Dávid Sipos, Zsolt Káposztás, Ferenc Budán, Orsolya Liza Kövesdi, and Bence L. Raposa. 2025. "Antitumor Activity of Warbugia ugandensis: Methanolic Extracts and Gene Regulation in Colorectal Cancer" Nutrients 17, no. 3: 471. https://doi.org/10.3390/nu17030471
APA StyleMacharia, J. M., Maina, J. K., Zand, A., Rono Cheriro, B., Varjas, T., Sipos, D., Káposztás, Z., Budán, F., Kövesdi, O. L., & Raposa, B. L. (2025). Antitumor Activity of Warbugia ugandensis: Methanolic Extracts and Gene Regulation in Colorectal Cancer. Nutrients, 17(3), 471. https://doi.org/10.3390/nu17030471