Potential Effects of Nicotinamide on Serum HDL-Cholesterol Levels and Hepatic Oxidative Stress, ABCA1 Gene and Protein Expression in Rats Fed a High-Fat/Fructose Diet
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Model
2.2. Experimental Design
2.3. Sample Collection
2.4. Serum Lipid Measurements
2.5. Serum and Liver Lipid Peroxidation Measurements
2.6. Serum and Liver GSH/GSSG Measurements
2.7. Analysis of Hepatic Lxr-α/β and Abca1 Gene Expression by RT-qPCR
2.8. Analysis of Hepatic LXR and ABCA1 Protein by Western Blot
2.9. Data Analysis
3. Results
3.1. Body Weight and Energy Intake in Rats Fed a Hypercaloric Diet
3.2. Effect of Nicotinamide on Serum Lipid Profile in Rats Fed a Hypercaloric Diet
3.3. Effect of Nicotinamide on Lipid Peroxidation Level and Redox Balance (GSH/GSSG) in Serum and Liver Samples of Rats Fed a Hypercaloric Diet
3.4. Effect of Nicotinamide on the Gene Expression and Protein Levels of LXR and ABCA1 in Liver Samples of Rats Fed a Hypercaloric Diet
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ABCA1 | ATP-Binding Cassette Transporter A1 (protein) |
| Abca1 | ATP-Binding Cassette Transporter A1 (gene) |
| HDL | High-density lipoprotein |
| NAM | Nicotinamide |
| HFDF | High-fat, high-fructose diet |
| LXR | Liver X Receptor (protein) |
| Lxr | Liver X Receptor (gene) |
| IMSS | Instituto Mexicano del Seguro Social |
| TC | Total cholesterol |
| LDL-C | Low-density lipoprotein cholesterol |
| HDL-C | High-density lipoprotein cholesterol |
| VLDL | Very low-density lipoprotein cholesterol |
| TG | Triacylglycerols |
| TBARS | Thiobarbituric acid reactive substances |
| GSH | Reduced glutathione |
| GSSG | Oxidized glutathione |
| GSH/GSSG | Ratio reduced glutathione/oxidized glutathione |
| DGAT2 | Diacylglycerol acyltransferase 2 |
| NAD+ | Nicotinamide adenine dinucleotide |
References
- Alves-Costa, S.; Nascimento, G.G.; de Souza, B.F.; Hugo, F.N.; Leite, F.R.M.; Ribeiro, C.C.C. Global, regional, and national burden of high sugar-sweetened beverages consumption, 1990–2021, with projections up to 2050: A systematic analysis for the Global Burden of Disease Study 2021. Am. J. Clin. Nutr. 2025; in press. [CrossRef] [Scilit]
- Clemente-Suarez, V.J.; Beltran-Velasco, A.I.; Redondo-Florez, L.; Martin-Rodriguez, A.; Tornero-Aguilera, J.F. Global Impacts of Western Diet and Its Effects on Metabolism and Health: A Narrative Review. Nutrients 2023, 15, 2749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meléndez-Salcido, C.G.; Ramírez-Emiliano, J.; Pérez-Vázquez, V. Hypercaloric Diet Promotes Metabolic Disorders and Impaired Kidney Function. Curr. Pharm. Des. 2022, 28, 3127–3139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, Y.; Je, Y.; Giovannucci, E.L. Association between dietary fat intake and mortality from all-causes, cardiovascular disease, and cancer: A systematic review and meta-analysis of prospective cohort studies. Clin. Nutr. 2021, 40, 1060–1070. [Google Scholar] [CrossRef] [Scilit]
- Jiang, S.; Liu, H.; Li, C. Dietary Regulation of Oxidative Stress in Chronic Metabolic Diseases. Foods 2021, 10, 1854. [Google Scholar] [CrossRef] [Scilit]
- Aleksandrova, K.; Koelman, L.; Rodrigues, C.E. Dietary patterns and biomarkers of oxidative stress and inflammation: A systematic review of observational and intervention studies. Redox Biol. 2021, 42, 101869. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Zhao, Z.W.; Zeng, P.H.; Zhou, Y.J.; Yin, W.J. Molecular mechanisms for ABCA1-mediated cholesterol efflux. Cell Cycle 2022, 21, 1121–1139. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Yeung, A.W.K.; Atanasov, A.G. A Review: Molecular Mechanism of Regulation of ABCA1 Expression. Curr. Protein Pept. Sci. 2022, 23, 170–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bilotta, M.T.; Petillo, S.; Santoni, A.; Cippitelli, M. Liver X Receptors: Regulators of Cholesterol Metabolism, Inflammation, Autoimmunity, and Cancer. Front. Immunol. 2020, 11, 584303. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.; Park, Y.; Koo, S.I. ATP-binding cassette transporter A1 and HDL metabolism: Effects of fatty acids. J. Nutr. Biochem. 2012, 23, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Dong, B.; Kan, C.F.; Singh, A.B.; Liu, J. High-fructose diet downregulates long-chain acyl-CoA synthetase 3 expression in liver of hamsters via impairing LXR/RXR signaling pathway. J. Lipid Res. 2013, 54, 1241–1254. [Google Scholar] [CrossRef] [Scilit]
- Mauerer, R.; Ebert, S.; Langmann, T. High glucose, unsaturated and saturated fatty acids differentially regulate expression of ATP-binding cassette transporters ABCA1 and ABCG1 in human macrophages. Exp. Mol. Med. 2009, 41, 126–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia-Berumen, C.I.; Ortiz-Avila, O.; Vargas-Vargas, M.A.; Del Rosario-Tamayo, B.A.; Guajardo-Lopez, C.; Saavedra-Molina, A.; Rodríguez-Orozco, A.R.; Cortés-Rojo, C. The severity of rat liver injury by fructose and high fat depends on the degree of respiratory dysfunction and oxidative stress induced in mitochondria. Lipids Health Dis. 2019, 18, 78. [Google Scholar] [CrossRef] [Scilit]
- Almenara, C.C.; Mill, J.G.; Vassallo, D.V.; Baldo, M.P.; Padilha, A.S. In vitro fructose exposure overactivates NADPH oxidase and causes oxidative stress in the isolated rat aorta. Toxicol. Vitr. 2015, 29, 2030–2037. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marcil, V.; Delvin, E.; Sane, A.T.; Tremblay, A.; Levy, E. Oxidative stress influences cholesterol efflux in THP-1 macrophages: Role of ATP-binding cassette A1 and nuclear factors. Cardiovasc. Res. 2006, 72, 473–482. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jacobo-Albavera, L.; Domínguez-Pérez, M.; Medina-Leyte, D.J.; González-Garrido, A.; Villarreal-Molina, T. The Role of the ATP-Binding Cassette A1 (ABCA1) in Human Disease. Int. J. Mol. Sci. 2021, 22, 1593. [Google Scholar] [CrossRef] [Scilit]
- Mejia, S.A.; Gutman, L.A.B.; Camarillo, C.O.; Navarro, R.M.; Becerra, M.C.S.; Santana, L.D.; Cruz, M.; Pérez, E.H.; Flores, M.D. Nicotinamide prevents sweet beverage-induced hepatic steatosis in rats by regulating the G6PD, NADPH/NADP(+) and GSH/GSSG ratios and reducing oxidative and inflammatory stress. Eur. J. Pharmacol. 2018, 818, 499–507. [Google Scholar] [CrossRef] [Scilit]
- Villeda-González, J.; Gómez-Olivares, J.; Baiza-Gutman, L.; Manuel-Apolinar, L.; Damasio-Santana, L.; Millán-Pacheco, C.; Ángeles-Mejía, S.; Cortés-Ginez, M.; Cruz-López, M.; Vidal-Moreno, C.; et al. Nicotinamide reduces inflammation and oxidative stress via the cholinergic system in fructose-induced metabolic syndrome in rats. Life Sci. 2020, 250, 117585. [Google Scholar] [CrossRef] [Scilit]
- Alegre, G.F.S.; Pastore, G.M. NAD+ Precursors Nicotinamide Mononucleotide (NMN) and Nicotinamide Riboside (NR): Potential Dietary Contribution to Health. Curr. Nutr. Rep. 2023, 12, 445–464. [Google Scholar] [CrossRef] [Scilit]
- Zapata-Pérez, R.; Wanders, R.J.A.; van Karnebeek, C.D.M.; Houtkooper, R.H. NAD(+) homeostasis in human health and disease. EMBO Mol. Med. 2021, 13, e13943. [Google Scholar] [CrossRef] [Scilit]
- Ramírez-Cruz, A.; Gómez-González, B.; Baiza-Gutman, L.; Manuel-Apolinar, L.; Ángeles-Mejía, S.; López-Cervantes, S.; Ortega-Camarillo, C.; Cruz-López, M.; Gómez-Olivares, J.; Díaz-Flores, M. Nicotinamide, an acetylcholinesterase uncompetitive inhibitor, protects the blood—Brain barrier and improves cognitive function in rats fed a hypercaloric diet. Eur. J. Pharmacol. 2023, 959, 176068. [Google Scholar] [CrossRef] [Scilit]
- Friedewald, W.T.; Levy, R.I.; Fredrickson, D.S. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin. Chem. 1972, 18, 499–502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jentzsch, A.M.; Bachmann, H.; Furst, P.; Biesalski, H.K. Improved analysis of malondialdehyde in human body fluids. Free Radic. Biol. Med. 1996, 20, 251–256. [Google Scholar] [CrossRef] [Scilit]
- Tietze, F. Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: Applications to mammalian blood and other tissues. Anal. Biochem. 1969, 27, 502–522. [Google Scholar] [CrossRef] [Scilit]
- Szudzik, M.; Hutsch, T.; Chabowski, D.; Zajdel, M.; Ufnal, M. Normal caloric intake with high-fat diet induces metabolic dysfunction-associated steatotic liver disease and dyslipidemia without obesity in rats. Sci. Rep. 2024, 14, 22796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Wu, H.; Liu, Y.; Yang, L. High fat diet induced obesity model using four strainsof mice: Kunming, C57BL/6, BALB/c and ICR. Exp. Anim. 2020, 69, 326–335. [Google Scholar] [CrossRef] [Scilit]
- Cheng, H.S.; Ton, S.H.; Phang, S.C.W.; Tan, J.B.L.; Abdul Kadir, K. Increased susceptibility of post-weaning rats on high-fat diet to metabolic syndrome. J. Adv. Res. 2017, 8, 743–752. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leaf, A.; Antonio, J. The Effects of Overfeeding on Body Composition: The Role of Macronutrient Composition—A Narrative Review. Int. J. Exerc. Sci. 2017, 10, 1275–1296. [Google Scholar] [CrossRef] [Scilit]
- Ganji, S.H.; Tavintharan, S.; Zhu, D.; Xing, Y.; Kamanna, V.S.; Kashyap, M.L. Niacin noncompetitively inhibits DGAT2 but not DGAT1 activity in HepG2 cells. J. Lipid Res. 2004, 45, 1835–1845. [Google Scholar] [CrossRef] [Scilit]
- Jin, F.Y.; Kamanna, V.S.; Kashyap, M.L. Niacin accelerates intracellular ApoB degradation by inhibiting triacylglycerol synthesis in human hepatoblastoma (HepG2) cells. Arterioscler. Thromb. Vasc. Biol. 1999, 19, 1051–1059. [Google Scholar] [CrossRef] [Scilit]
- Ganji, S.H.; Kamanna, V.S.; Kashyap, M.L. Niacin and cholesterol: Role in cardiovascular disease (review). J. Nutr. Biochem. 2003, 14, 298–305. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, B.L.; Norhaizan, M.E. Effect of High-Fat Diets on Oxidative Stress, Cellular Inflammatory Response and Cognitive Function. Nutrients 2019, 11, 2579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamer, F.; Ulug, E.; Akyol, A.; Nergiz-Unal, R. The potential efficacy of dietary fatty acids and fructose induced inflammation and oxidative stress on the insulin signaling and fat accumulation in mice. Food Chem. Toxicol. 2020, 135, 110914. [Google Scholar] [CrossRef] [Scilit]
- Loza-Medrano, S.S.; Baiza-Gutman, L.A.; Manuel-Apolinar, L.; García-Macedo, R.; Damasio-Santana, L.; Martínez-Mar, O.A.; Sánchez-Becerra, M.C.; Cruz-López, M.; Ibáñez-Hernández, M.A.; Díaz-Flores, M. High fructose-containing drinking water-induced steatohepatitis in rats is prevented by the nicotinamide-mediated modulation of redox homeostasis and NADPH-producing enzymes. Mol. Biol. Rep. 2020, 47, 337–351. [Google Scholar] [CrossRef] [Scilit]
- Xiao, W.; Wang, R.S.; Handy, D.E.; Loscalzo, J. NAD(H) and NADP(H) Redox Couples and Cellular Energy Metabolism. Antioxid. Redox Signal 2018, 28, 251–272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pastore, A.; Federici, G.; Bertini, E.; Piemonte, F. Analysis of glutathione: Implication in redox and detoxification. Clin. Chim. Acta 2003, 333, 19–39. [Google Scholar] [CrossRef] [Scilit]
- Jones, D.P.; Carlson, J.L.; Mody, V.C.; Cai, J.; Lynn, M.J.; Sternberg, P. Redox state of glutathione in human plasma. Free Radic. Biol. Med. 2000, 28, 625–635. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.; Li, W.; Wang, N.; Zhu, Y.; Wang, X. ROS and NF-kappaB but not LXR mediate IL-1beta signaling for the downregulation of ATP-binding cassette transporter A1. Am. J. Physiol. Cell Physiol. 2007, 292, C1493–C1501. [Google Scholar] [CrossRef] [Scilit]
- Zhong, O.; Wang, J.; Tan, Y.; Lei, X.; Tang, Z. Effects of NAD+ precursor supplementation on glucose and lipid metabolism in humans: A meta-analysis. Nutr. Metab. 2022, 19, 20. [Google Scholar] [CrossRef] [Scilit]
- Wan, H.; Li, J.; Liao, H.; Liao, M.; Luo, L.; Xu, L.; Yuan, K.; Zeng, Y. Nicotinamide induces liver regeneration and improves liver function by activating SIRT1. Mol. Med. Rep. 2019, 19, 555–562. [Google Scholar] [CrossRef] [Scilit]
- Romani, M.; Hofer, D.C.; Katsyuba, E.; Auwerx, J. Niacin: An old lipid drug in a new NAD+ dress. J. Lipid Res. 2019, 60, 741–746. [Google Scholar] [CrossRef] [Scilit]
- Wellington, C.L.; Walker, E.K.Y.; Suarez, A.; Kwok, A.; Bissada, N.; Singaraja, R.; Yang, Y.-Z.; Zhang, L.-H.; James, E.; E Wilson, J.; et al. ABCA1 mRNA and Protein Distribution Patterns Predict Multiple Different Roles and Levels of Regulation. Lab. Investig. 2002, 82, 273–283. [Google Scholar] [CrossRef] [Scilit]
- Tate, M.; Wijeratne, H.R.S.; Kim, B.; Philtjens, S.; You, Y.; Lee, D.; Gutierrez, D.A.; Sharify, D.; Wells, M.; Perez-Cardelo, M.; et al. Deletion of miR-33, a regulator of the ABCA1-APOE pathway, ameliorates neuropathological phenotypes in APP/PS1 mice. Alzheimer’s Dement. J. Alzheimer’s Assoc. 2024, 20, 7805–7818. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pan, J.H.; Cha, H.; Tang, J.; Lee, S.; Lee, S.H.; Le, B.; Redding, M.C.; Kim, S.; Batish, M.; Kong, B.C.; et al. The role of microRNA-33 as a key regulator in hepatic lipogenesis signaling and a potential serological biomarker for NAFLD with excessive dietary fructose consumption in C57BL/6N mice. Food Funct. 2021, 12, 656–667. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mizuno, T.; Hayashi, H.; Kusuhara, H. Cellular Cholesterol Accumulation Facilitates Ubiquitination and Lysosomal Degradation of Cell Surface-Resident ABCA1. Arterioscler. Thromb. Vasc. Biol. 2015, 35, 1347–1356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Czuba, L.C.; Hillgren, K.M.; Swaan, P.W. Post-translational modifications of transporters. Pharmacol. Ther. 2018, 192, 88–99. [Google Scholar] [CrossRef] [Scilit]



| Genes | Gen ID | Forward Primer | Reverse Primer |
|---|---|---|---|
| Lxr-α | 58852 | AGTCACGCCTTGGCCCATTGC | CGGACACGATGGCCAGCTCA |
| Lxr-β | 58851 | GGCCGGGAGGACCAGAT | GCGTCTGGCTGTCTCTAGCAA |
| Abca1 | 313210 | ACCGACAAGGCCGCACCATT | GCCCACACAACACAGCTTCCCA |
| Rplp0 | 64205 | AGCCAAGGTCGAAGCAAA | GCTTAGTCGAAGAGACCGAATC |
| Group | Control | HFDF | NAM 5 | NAM 10 | NAM 15 |
|---|---|---|---|---|---|
| (n = 8) | (n = 8) | (n = 8) | (n = 8) | (n = 8) | |
| Food | 24.470 ± 0.476 | 16.490 ± 0.415 &&& | 16.920 ± 0.640 | 16.530 ± 0.482 | 15.100 ± 0.554 |
| (g/day/rat) | |||||
| Liquid | 32.480 ± 1.637 | 35.400 ± 1.934 | 29.960 ± 1.227 | 30.140 ± 1.583 | 30.540 ± 1.624 |
| (mL/day/rat) | |||||
| Fructose | - | 8.922 ± 0.951 | 7.903 ± 0.684 | 9.070 ± 0.647 | 9.264 ± 0.657 |
| (g/day/rat) | |||||
| Energy | 91.640 ± 1.783 | 114.500 ± 4.126 && | 110.500 ± 4.629 | 112.900 ± 4.754 | 106.900 ± 5.027 |
| (Kcal/day/rat) | |||||
| Body Weight Gain (g) | 238.000 ± 10.090 | 210.800 ± 6.346 | 202.300 ± 7.365 | 212.100 ± 8.346 | 215.100 ± 6.634 |
| Group | Control | HFDF | NAM 5 | NAM 10 | NAM 15 |
|---|---|---|---|---|---|
| (n = 8) | (n = 8) | (n = 8) | (n = 8) | (n = 8) | |
| TG | 105.805 ± 11.236 | 225.816 ± 21.322 && | 121.211 ± 21.114 ** | 121.152 ± 19.024 * | 159.510 ± 20.355 |
| (mg/dL) | |||||
| TC | 63.751 ± 0.818 | 75.886 ± 1.469 &&& | 66.002 ± 1.500 * | 68.883 ± 1.246 * | 62.002 ± 1.964 *** |
| (mg/dL) | |||||
| LDL-C | 12.451 ± 0.457 | 17.863 ± 1.085 & | 13.995 ± 1.645 | 16.281 ± 1.430 | 8.950 ± 0.580 ** |
| mg/dL | |||||
| VLDL-C | 17.248 ± 1.333 | 38.153 ± 3.123 && | 20.801 ± 3.261 ** | 18.281 ± 2.506 ** | 30.207 ± 3.493 |
| mg/dL | |||||
| HDL-C | 33.254 ± 2.206 | 25.651 ± 1.346 & | 31.195 ± 2.416 | 34.534 ± 1.668 * | 31.982 ± 1.823 |
| mg/dL |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Serafín-Fabián, J.I.; Ramírez-Cruz, A.; Villeda-González, J.D.; Gómez-Zamudio, J.; Hernández-Díazcouder, A.; Ortega-Camarillo, C.; Flores-Alfaro, E.; Cruz, M.; Vazquez-Moreno, M. Potential Effects of Nicotinamide on Serum HDL-Cholesterol Levels and Hepatic Oxidative Stress, ABCA1 Gene and Protein Expression in Rats Fed a High-Fat/Fructose Diet. Nutrients 2025, 17, 3458. https://doi.org/10.3390/nu17213458
Serafín-Fabián JI, Ramírez-Cruz A, Villeda-González JD, Gómez-Zamudio J, Hernández-Díazcouder A, Ortega-Camarillo C, Flores-Alfaro E, Cruz M, Vazquez-Moreno M. Potential Effects of Nicotinamide on Serum HDL-Cholesterol Levels and Hepatic Oxidative Stress, ABCA1 Gene and Protein Expression in Rats Fed a High-Fat/Fructose Diet. Nutrients. 2025; 17(21):3458. https://doi.org/10.3390/nu17213458
Chicago/Turabian StyleSerafín-Fabián, Jesús I., Armando Ramírez-Cruz, J. D. Villeda-González, Jaime Gómez-Zamudio, Adrián Hernández-Díazcouder, Clara Ortega-Camarillo, Eugenia Flores-Alfaro, Miguel Cruz, and Miguel Vazquez-Moreno. 2025. "Potential Effects of Nicotinamide on Serum HDL-Cholesterol Levels and Hepatic Oxidative Stress, ABCA1 Gene and Protein Expression in Rats Fed a High-Fat/Fructose Diet" Nutrients 17, no. 21: 3458. https://doi.org/10.3390/nu17213458
APA StyleSerafín-Fabián, J. I., Ramírez-Cruz, A., Villeda-González, J. D., Gómez-Zamudio, J., Hernández-Díazcouder, A., Ortega-Camarillo, C., Flores-Alfaro, E., Cruz, M., & Vazquez-Moreno, M. (2025). Potential Effects of Nicotinamide on Serum HDL-Cholesterol Levels and Hepatic Oxidative Stress, ABCA1 Gene and Protein Expression in Rats Fed a High-Fat/Fructose Diet. Nutrients, 17(21), 3458. https://doi.org/10.3390/nu17213458

