S. boulardii Early Intervention Maintains Gut Microbiome Structure and Promotes Gut Mucosal Barrier Function in Early-Weaned Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Experimental Design
2.3. Growth Performance
2.4. Sample Collection
2.5. Fecal Microbiota Sequence
2.6. Co-Occurrence Network Diagram
2.7. Short-Chain Fatty Acids Determination
2.8. Hematoxylin and Eosin (HE) Staining
2.9. Periodic Acid Schiff (PAS) Staining
2.10. RNA Isolation and Quantitative Real-Time PCR
2.11. Western Blot Analysis
2.12. ELISA
2.13. Bacterial Load Assay
2.14. Statistical Analysis
3. Results
3.1. Effects of S. boulardii Early Intervention on the Growth Performance of Early-Weaned Rats
3.2. Effects of S. boulardii Early Intervention on the Gut Microbial Diversity
3.3. Effects of S. boulardii Early Intervention on the Composition and Structure of the Gut Microbiota
3.4. Effects of S. boulardii Early Intervention on Microbial Co-Occurrence Patterns
3.5. Effects of S. boulardii Early Intervention on Microbial Metabolites
3.6. Effects of S. boulardii Early Intervention on the Gut Morphology Integrity
3.7. Effects of S. boulardii Early Intervention on the Gut Mucosal Barrier Function
3.8. Effects of S. boulardii Early Intervention on the Translocation of Bacteria
3.9. Effects of S. boulardii Early Intervention on the Inflammatory Response
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Conflicts of Interest
Abbreviations
References
- Yap, Y.A.; Marino, E. An Insight into the Intestinal Web of Mucosal Immunity, Microbiota, and Diet in Inflammation. Front. Immunol. 2018, 9, 2617. [Google Scholar] [CrossRef] [PubMed]
- Smith, F.; Clark, J.E.; Overman, B.L.; Tozel, C.C.; Huang, J.H.; Rivier, J.E.F.; Blisklager, A.T.; Moeser, A.J. Early weaning stress impairs development of mucosal barrier function in the porcine intestine. Am. J. Physiol.-Gastrointest. Liver Physiol. 2010, 298, G352–G363. [Google Scholar] [CrossRef] [PubMed]
- Lutgendorff, F.; Akkermans, L.M.A.; Soderholm, J.D. The role of microbiota and probiotics in stress-induced gastrointestinal damage. Curr. Mol. Med. 2008, 8, 282–298. [Google Scholar] [CrossRef] [PubMed]
- Xia, B.; Zhong, R.; Meng, Q.; Wu, W.; Chen, L.; Zhao, X.; Zhang, H. Multi-omics unravel the compromised mucosal barrier function linked to aberrant mucin O-glycans in a pig model. Int. J. Biol. Macromol. 2022, 207, 952–964. [Google Scholar] [CrossRef] [PubMed]
- Tang, W.J.; Liu, J.L.; Ma, Y.F.; Wei, Y.S.; Liu, J.X.; Wang, H.F. Impairment of Intestinal Barrier Function Induced by Early Weaning via Autophagy and Apoptosis Associated with Gut Microbiome and Metabolites. Front. Immunol. 2021, 12, 804870. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, T.S.B.; Raes, J.; Bork, P. The Human Gut Microbiome: From Association to Modulation. Cell 2018, 172, 1198–1215. [Google Scholar] [CrossRef]
- Roslund, M.I.; Puhakka, R.; Grönroos, M.; Nurminen, N.; Oikarinen, S.; Gazali, A.M.; Cinek, O.; Kramná, L.; Siter, N.; Vari, H.K.; et al. Biodiversity intervention enhances immune regulation and health-associated commensal microbiota among daycare children. Sci. Adv. 2020, 6, eaba2578. [Google Scholar] [CrossRef]
- Miyoshi, J.; Miyoshi, S.; Delmont, T.O.; Cham, C.; Lee, S.T.M.; Sakatani, A.; Yang, K.; Shan, Y.; Kennedy, M.; Kiefl, E.; et al. Early-Life Microbial Restitution Reduces Colitis Risk Promoted by Antibiotic-Induced Gut Dysbiosis in Interleukin 10(−/−) Mice. Gastroenterology 2021, 161, 940–952.e15. [Google Scholar] [CrossRef]
- Guo, F.L.; Cai, D.M.; Li, Y.W.; Gu, H.T.; Qu, H.; Zong, Q.F.; Bao, W.B.; Chen, A.X.; Liu, H.Y. How Early-Life Gut Microbiota Alteration Sets Trajectories for Health and Inflammatory Bowel Disease? Front Nutr. 2021, 8, 690073. [Google Scholar] [CrossRef]
- Ansari, F.; Alian Samakkhah, S.; Bahadori, A.; Jafari, S.M.; Ziaee, M.; Khodayari, M.T.; Pourjafar, H. Health-promoting properties of Saccharomyces cerevisiae var. boulardii as a probiotic; characteristics, isolation, and applications in dairy products. Crit. Rev. Food Sci. Nutr. 2021, 61, 1–29. [Google Scholar] [CrossRef]
- Hancox, L.R.; Le Bon, M.; Richards, P.J.; Guillou, D.; Dodd, C.E.; Mellits, K.H. Effect of a single dose of Saccharomyces cerevisiae var. boulardii on the occurrence of porcine neonatal diarrhoea. Animal 2015, 9, 1756–1759. [Google Scholar] [CrossRef] [PubMed]
- Luise, D.; Spinelli, E.; Correa, F.; Nicodemo, A.; Bosi, P.; Trevisi, P. The effect of a single, early-life administration of a probiotic on piglet growth performance and faecal microbiota until weaning. Ital. J. Anim. Sci. 2021, 20, 1373–1385. [Google Scholar] [CrossRef]
- Xia, X.; Ni, J.J.; Yin, S.N.; Yang, Z.P.; Jiang, H.N.; Wang, C.; Peng, J.; Wei, H.K.; Wang, X.Y. Elevated Systemic and Intestinal Inflammatory Response Are Associated with Gut Microbiome Disorder after Cardiovascular Surgery. Front. Microbiol. 2021, 12, 686648. [Google Scholar] [CrossRef]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2021, 17, 10–12. [Google Scholar] [CrossRef]
- Bokulich, N.A.; Kaehler, B.D.; Rideout, J.R.; Dillon, M.; Bolyen, E.; Knight, R.; Huttley, G.A.; Caporaso, J.G. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2′s q2-feature-classifier plugin. Microbiome 2018, 6, 90. [Google Scholar] [CrossRef] [PubMed]
- McDonald, D.; Price, M.N.; Goodrich, J.; Nawrocki, E.P.; DeSantis, T.Z.; Probst, A.; Andersen, G.L.; Knight, R.; Hugenholtz, P. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. ISME J. 2012, 6, 610–618. [Google Scholar] [CrossRef]
- Wang, Y.; Yang, Z.; Zhou, Y.; Tan, J.; Sun, H.; Sun, D.; Mu, Y.; Peng, J.; Wei, H. Effects of different amino acid levels and a carvacrol-thymol blend on growth performance and intestinal health of weaned pigs. J. Anim. Sci. Biotechnol. 2022, 13, 22. [Google Scholar] [CrossRef]
- Dzidic, M.; Boix-Amoros, A.; Selma-Royo, M.; Mira, A.; Collado, M.C. Gut Microbiota and Mucosal Immunity in the Neonate. Med. Sci. 2018, 6, 56. [Google Scholar] [CrossRef]
- Ma, X.; Zhang, Y.; Xu, T.; Qian, M.; Yang, Z.; Zhan, X.; Han, X. Early-Life Intervention Using Exogenous Fecal Microbiota Alleviates Gut Injury and Reduce Inflammation Caused by Weaning Stress in Piglets. Front. Microbiol. 2021, 12, 1524. [Google Scholar] [CrossRef]
- Xiang, Q.; Peng, J. Effects of early intervention by fecal microbiota transplantation combined probiotics on the growth performance, in-testinal barrier and immunity function, and gut microbiota in sucking piglets. J. Anim. Sci. 2019, 97, 305–306. [Google Scholar] [CrossRef]
- Pais, P.; Almeida, V.; Yılmaz, M.; Teixeira, M.C. Saccharomyces boulardii: What Makes It Tick as Successful Probiotic? J. Fungi 2020, 6, 78. [Google Scholar] [CrossRef]
- Xiang, Q.; Wu, X.; Pan, Y.; Wang, L.; Cui, C.; Guo, Y.; Zhu, L.; Peng, J.; Wei, H. Early-life intervention using fecal microbiota combined with probiotics promotes gut microbiota maturation, regulates immune system development, and alleviates weaning stress in piglets. Int. J. Mol. Sci. 2020, 21, 503. [Google Scholar] [CrossRef]
- Xiang, Q.; Wu, X.; Pan, Y.; Wang, L.; Guo, Y.; Cui, C.; Hu, L.; Zhu, L.; Peng, J.; Wei, H. Early intervention using fecal microbiota transplantation combined with probiotics influence the growth performance, diarrhea, and intestinal barrier function of piglets. Appl. Sci. 2020, 10, 568. [Google Scholar] [CrossRef]
- Bielik, V.; Kolisek, M. Bioaccessibility and Bioavailability of Minerals in Relation to a Healthy Gut Microbiome. Int. J. Mol. Sci. 2021, 22, 6803. [Google Scholar] [CrossRef]
- Zheng, D.; Liwinski, T.; Elinav, E. Interaction between microbiota and immunity in health and disease. Cell Res. 2020, 30, 492–506. [Google Scholar] [CrossRef]
- Pral, L.P.; Fachi, J.L.; Corrêa, R.O.; Colonna, M.; Vinolo, M.A.R. Hypoxia and HIF-1 as key regulators of gut microbiota and host interactions. Trends Immunol. 2021, 42, 604–621. [Google Scholar] [CrossRef]
- Guevarra, R.B.; Hong, S.H.; Cho, J.H.; Kim, B.-R.; Shin, J.; Lee, J.H.; Kang, B.N.; Kim, Y.H.; Wattanaphansak, S.; Isaacson, R.E.; et al. The dynamics of the piglet gut microbiome during the weaning transition in association with health and nutrition. J. Anim. Sci. Biotechnol. 2018, 9, 54. [Google Scholar] [CrossRef]
- Lozupone, C.A.; Stombaugh, J.I.; Gordon, J.I.; Jansson, J.K.; Knight, R. Diversity, stability and resilience of the human gut microbiota. Nature 2012, 489, 220–230. [Google Scholar] [CrossRef]
- Brousseau, J.P.; Talbot, G.; Beaudoin, F.; Lauzon, K.; Roy, D.; Lessard, M. Effects of probiotics Pediococcus acidilactici strain MA18/5M and Saccharomyces cerevisiae subsp. boulardii strain SB-CNCM I-1079 on fecal and intestinal microbiota of nursing and weanling piglets. J. Anim. Sci. 2015, 93, 5313–5326. [Google Scholar] [CrossRef]
- Rogawski McQuade, E.T.; Shaheen, F.; Kabir, F.; Rizvi, A.; Platts-Mills, J.A.; Aziz, F.; Kalam, A.; Qureshi, S.; Elwood, S.; Liu, J.; et al. Epidemiology of Shigella infections and diarrhea in the first two years of life using culture-independent diagnostics in 8 low-resource settings. PLoS Negl. Trop. Dis. 2020, 14, e0008536. [Google Scholar] [CrossRef]
- Janda, J.M.; Abbott, L.S. The Changing Face of the Family Enterobacteriaceae (Order: “Enterobacterales”): New Members, Taxonomic Issues, Geographic Expansion, and New Diseases and Disease. Clin. Microbiol. Rev. 2021, 34, 45. [Google Scholar] [CrossRef]
- Pereira, F.C.; Wasmund, K.; Cobankovic, I.; Jehmlich, N.; Herbold, C.W.; Lee, K.S.; Sziranyi, B.; Vesely, C.; Decker, T.; Stocker, R.; et al. Rational design of a microbial consortium of mucosal sugar utilizers reduces Clostridiodes difficile colonization. Nat. Commun. 2020, 11, 5104. [Google Scholar] [CrossRef]
- Stadlbauer, V.; Engertsberger, L.; Komarova, I.; Feldbacher, N.; Leber, B.; Pichler, G.; Fink, N.; Scarpatetti, M.; Schippinger, W.; Schmidt, R.; et al. Dysbiosis, gut barrier dysfunction and inflammation in dementia: A pilot study. BMC Geriatr. 2020, 20, 248. [Google Scholar] [CrossRef]
- Jing, L.; Tao, W.; Na, L.; Xuening, W.; Guiyun, C.; Xiaoling, L. Bilberry anthocyanin extract promotes intestinal barrier function and inhibits digestive enzyme activity by regulating the gut microbiota in aging rats. Food Funct. 2019, 10, 333–343. [Google Scholar] [CrossRef]
- Coyte, K.Z.; Schluter, J.; Foster, K.R. The ecology of the microbiome: Networks, competition, and stability. Science 2015, 350, 663–666. [Google Scholar] [CrossRef]
- Nan, Z.; Yanan, G.; Weishu, Z.; Di, M.; Walker, W.A. Short chain fatty acids produced by colonizing intestinal commensal bacterial interaction with expressed breast milk are anti-inflammatory in human immature enterocytes. PLoS ONE 2020, 15, e0229283. [Google Scholar] [CrossRef]
- Gao, Y.A.; Davis, B.; Zhu, W.S.; Zheng, N.; Meng, D.; Walker, W.A. Short-chain fatty acid butyrate, a breast milk metabolite, enhances immature intestinal barrier function genes in response to inflammation in vitro and in vivo. Am. J. Physiol.-Gastrointest. Liver Physiol. 2021, 320, G521–G530. [Google Scholar] [CrossRef]
- Venegas, D.P.; De la Fuente, M.K.; Landskron, G.; Gonzalez, M.J.; Quera, R.; Dijkstra, G.; Harmsen, H.J.M.; Faber, K.N.; Hermoso, M.A. Short Chain Fatty Acids (SCFAs)-Mediated Gut Epithelial and Immune Regulation and Its Relevance for Inflammatory Bowel Diseases. Front. Immunol. 2019, 10, 16. [Google Scholar] [CrossRef]
- Erben, U.; Loddenkemper, C.; Doerfel, K.; Spieckermann, S.; Haller, D.; Heimesaat, M.M.; Zeitz, M.; Siegmund, B.; Kühl, A.A. A guide to histomorphological evaluation of intestinal inflammation in mouse models. Int. J. Clin. Exp. Pathol. 2014, 7, 4557–4576. [Google Scholar]
- Capaldo, C.T.; Powell, D.N.; Kalman, D. Layered defense: How mucus and tight junctions seal the intestinal barrier. J. Mol. Med. 2017, 95, 927–934. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, Y.S.; Kim, T.Y.; Kim, Y.; Lee, S.H.; Kim, S.; Kang, S.W.; Yang, J.Y.; Baek, I.J.; Sung, Y.H.; Park, Y.Y.; et al. Microbiota-Derived Lactate Accelerates Intestinal Stem-Cell-Mediated Epithelial Development. Cell Host Microbe 2018, 24, 833–846.e6. [Google Scholar] [CrossRef]
- Kelly, C.J.; Zheng, L.; Campbell, E.L.; Saeedi, B.; Scholz, C.C.; Bayless, A.J.; Wilson, K.E.; Glover, L.E.; Kominsky, D.J.; Magnuson, A.; et al. Crosstalk between Microbiota-Derived Short-Chain Fatty Acids and Intestinal Epithelial HIF Augments Tissue Barrier Function. Cell Host Microbe 2015, 17, 662–671. [Google Scholar] [CrossRef]
- Song, B.; Zheng, C.; Zha, C.; Hu, S.; Yang, X.; Wang, L.; Xiao, H. Dietary leucine supplementation improves intestinal health of mice through intestinal SIgA secretion. J. Appl. Microbiol. 2020, 128, 574–583. [Google Scholar] [CrossRef] [PubMed]
- Guo, C.J.; Allen, B.M.; Hiam, K.J.; Dodd, D.; Van Treuren, W.; Higginbottom, S.; Nagashima, K.; Fischer, C.R.; Sonnenburg, J.L.; Spitzer, M.H.; et al. Depletion of microbiome-derived molecules in the host using Clostridium genetics. Science 2019, 366, eaav1282. [Google Scholar] [CrossRef] [PubMed]
- Allen, J.M.; Mackos, A.R.; Jaggers, R.M.; Brewster, P.C.; Webb, M.; Lin, C.H.; Ladaika, C.; Davies, R.; White, P.; Loman, B.R.; et al. Psychological stress disrupts intestinal epithelial cell function and mucosal integrity through microbe and host-directed processes. Gut Microbes 2022, 14, 2035661. [Google Scholar] [CrossRef]
- Lessard, M.; Dupuis, M.; Gagnon, N.; Nadeau, E.; Matte, J.J.; Goulet, J.; Fairbrother, J.M. Administration of Pediococcus acidilactici or Saccharomyces cerevisiae boulardii modulates development of porcine mucosal immunity and reduces intestinal bacterial translocation after Escherichia coli challenge. J. Anim. Sci. 2009, 87, 922–934. [Google Scholar] [CrossRef]
- Moeser, A.J.; Pohl, C.S.; Rajput, M. Weaning stress and gastrointestinal barrier development: Implications for lifelong gut health in pigs. Anim. Nutr. 2017, 3, 313–321. [Google Scholar] [CrossRef]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal Transduct. Target 2017, 2, 17023. [Google Scholar] [CrossRef]
- Zamyatina, A.; Heine, H. Lipopolysaccharide Recognition in the Crossroads of TLR4 and Caspase-4/11 Mediated Inflammatory Pathways. Front. Immunol. 2020, 11, 585146. [Google Scholar] [CrossRef]
- Jarry, A.; Bossard, C.; Bou-Hanna, C.; Masson, D.; Espaze, E.; Denis, M.G.; Laboisse, C.L. Mucosal IL-10 and TGF-beta play crucial roles in preventing LPS-driven, IFN-gamma-mediated epithelial damage in human colon explants. J. Clin. Investig. 2008, 118, 1132–1142. [Google Scholar] [CrossRef] [PubMed]
Gene | Primers Sequence (5′-3′) | Size (bp) | Accession No. |
---|---|---|---|
β-actin | F: GCAGGAGTACGATGAGTCCG R: ACGCAGCTCAGTAACAGTCC | 74 | NM_031144.3 |
MUC2 | F: GCTGACGAGTGGTTGGTGAATG R: GATGAGGTGGCAGACAGGAGAC | 135 | XM_039101270.1 |
MUC3 | F: ACTGCTTGTCCACGGATACTCA R: GACGGAGAACACAGCGAGGAT | 140 | XM_039090116.1 |
TFF3 | F: GATAACCCTGCTGCTGGTCCTG R: CCACGGTTGTTACACTGCTCTG | 150 | NM_013042.2 |
ZO-1 | F: GGCGTTCTAGAAGATAGCC R: GAAATCTACATTGTTCACCCTG | 81 | NM_001106266.1 |
Occludin | F: ACTATGAAACCGACTACACGA R: TGATAGGTGGATATTCCCTGAG | 80 | NM_031329.3 |
Claudin-1 | F: GCTGTCATCGGGGGCATAAT R: CCTGGCCAAATTCATACCTGG | 136 | NM_031699.3 |
TGF-β | F: TGAGTGGCTGTCTTTTGACG R: CAGGAAGGGTCGGTTCATGT | 196 | NM_021578.2 |
IL-10 | F: GCTCTTACTGGCTGGAGTGAG R: CTCAGCTCTCGGAGCATGTG | 105 | NM_012854.2 |
TLR4 | F: TCCACAAGAGCCGGAAAGTT R: TGAAGATGATGCCAGAGCGG | 126 | NM_019178.2 |
NFκB | F: TTCAACATGGCAGACGACGA R: AGGTATGGGCCATCTGTTGAC | 131 | NM_001276711.1 |
Items | PBS | SB | p-Value |
---|---|---|---|
1 day BW, g | 36.66 ± 3.13 | 36.91 ± 2.77 | 0.84 |
3 day BW, g | 42.35 ± 2.1 | 42.7 ± 2.82 | 0.73 |
7 day BW, g | 57.95 ± 2.56 | 60.18 ± 3.05 | 0.07 |
1~3 d | |||
ADG, g/day | 1.90 ± 0.91 | 1.93 ± 0.85 | 0.93 |
ADFI, g/day | 2.82 ± 0.80 | 2.93 ± 0.94 | 0.82 |
FCR | 0.62 ± 0.15 | 0.67 ± 0.19 | 0.64 |
3~7 day | |||
ADG, g/day | 3.9 ± 0.37 | 4.37 ± 0.52 | 0.02 |
ADFI, g/day | 9.26 ± 1.03 | 9.03 ± 0.71 | 0.66 |
FCR | 0.43 ± 0.06 | 0.49 ± 0.05 | 0.09 |
1~7 day | |||
ADG, g/day | 3.04 ± 0.49 | 3.32 ± 0.52 | 0.19 |
ADFI, g/day | 6.5 ± 0.55 | 6.42 ± 0.55 | 0.84 |
FCR | 0.47 ± 0.05 | 0.52 ± 0.06 | 0.15 |
Parameters | PBS_W3 | SB_W3 | PBS_7day | SB_7day |
---|---|---|---|---|
Number of nodes | 57 | 65 | 47 | 54 |
Number of edges | 142 | 294 | 102 | 128 |
Average number of neighbors | 4.912 | 8.730 | 4.489 | 4.741 |
Network density | 0.088 | 0.138 | 0.102 | 0.089 |
Characteristic path length | 4.360 | 2.963 | 3.545 | 3.997 |
Clustering coefficient | 0.439 | 0.534 | 0.466 | 0.582 |
Network centralization | 0.168 | 0.202 | 0.202 | 0.083 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Z.; Wu, Y.; Liu, X.; Zhang, M.; Peng, J.; Wei, H. S. boulardii Early Intervention Maintains Gut Microbiome Structure and Promotes Gut Mucosal Barrier Function in Early-Weaned Rats. Nutrients 2022, 14, 3485. https://doi.org/10.3390/nu14173485
Yang Z, Wu Y, Liu X, Zhang M, Peng J, Wei H. S. boulardii Early Intervention Maintains Gut Microbiome Structure and Promotes Gut Mucosal Barrier Function in Early-Weaned Rats. Nutrients. 2022; 14(17):3485. https://doi.org/10.3390/nu14173485
Chicago/Turabian StyleYang, Zhipeng, Yanting Wu, Xiangchen Liu, Mei Zhang, Jian Peng, and Hongkui Wei. 2022. "S. boulardii Early Intervention Maintains Gut Microbiome Structure and Promotes Gut Mucosal Barrier Function in Early-Weaned Rats" Nutrients 14, no. 17: 3485. https://doi.org/10.3390/nu14173485
APA StyleYang, Z., Wu, Y., Liu, X., Zhang, M., Peng, J., & Wei, H. (2022). S. boulardii Early Intervention Maintains Gut Microbiome Structure and Promotes Gut Mucosal Barrier Function in Early-Weaned Rats. Nutrients, 14(17), 3485. https://doi.org/10.3390/nu14173485