Alterations in Intestinal Brush Border Membrane Functionality and Bacterial Populations Following Intra-Amniotic Administration (Gallus gallus) of Nicotinamide Riboside and Its Derivatives
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Materials
2.2.1. Synthesis of Nicotinamide Riboside Tributyrate Chloride (NRTBCl)
2.2.2. Synthesis of Nicotinamide Riboside Trioleate Chloride (NRTOCl)
2.3. Characterization of NRTBCl and NRTOCl
2.3.1. Nuclear Magnetic Resonance (NMR) Spectroscopy
2.3.2. Attenuated Total Reflectance—Fourier-Transform Infrared (ATR-FTIR) Spectroscopy
2.3.3. UV-Vis Spectroscopy
2.3.4. Liquid Chromatography-Mass Spectrometry (LC-MS) Analysis
2.3.5. Particle Characterization
2.4. Intra-Amniotic Administration Solution Preparation
2.5. Intra-Amniotic Administration Procedure and Study Design
2.6. Tissue Collection
2.7. Isolation of Total RNA from Chicken Duodenum
2.8. Real-Time Polymerase Chain Reaction
2.9. Cecal Microbial DNA Isolation and Analysis
2.10. Cecal Short-Chain Fatty Acids (SCFA) Analysis and Cecal Content pH
2.11. PCR Amplification of Bacterial 16s rDNA
2.12. Statistical Analysis
3. Results
3.1. Fourier Transform Infrared (FTIR) of NRTBCl
3.2. 1H NMR of NRTBCl
3.3. 13C NMR of NRTBCl
3.4. LC-MS Analysis of NRTBCl
3.5. FTIR of NRTOCl
3.6. 1H NMR of NRTOCl
3.7. 13C NMR of NRTOCl
3.8. LC-MS of NRTOCl
3.9. Particle Size and Zeta Potential of NRTOCl
3.10. Gross Physiological Parameters
3.11. Ceca Bacterial Analysis
3.12. Short-Chain Fatty Acids and pH Concentrations in Cecal Contents
3.13. Duodenal Brush Border Membrane Gene Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Da Silva, B.P.; Martino, H.S.D.; Tako, E. Plant Origin Prebiotics Affect Duodenal Brush Border Membrane Functionality and Morphology, in Vivo (Gallus Gallus). Food Funct. 2021, 12, 6157–6166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kataoka, K. The Intestinal Microbiota and Its Role in Human Health and Disease. J. Med. Investig. 2016, 63, 27–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tanes, C.; Bittinger, K.; Gao, Y.; Friedman, E.S.; Nessel, L.; Paladhi, U.R.; Chau, L.; Panfen, E.; Fischbach, M.A.; Braun, J.; et al. Role of Dietary Fiber in the Recovery of the Human Gut Microbiome and Its Metabolome. Cell Host Microbe 2021, 29, 394–407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brisbin, J.T.; Gong, J.; Sharif, S. Interactions between Commensal Bacteria and the Gut-Associated Immune System of the Chicken. Anim. Health Res. Rev. 2008, 9, 101–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.-J.; Li, S.; Gan, R.-Y.; Zhou, T.; Xu, D.-P.; Li, H.-B. Impacts of Gut Bacteria on Human Health and Diseases. Int. J. Mol. Sci. 2015, 16, 7493–7519. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reed, S.; Neuman, H.; Glahn, R.P.; Koren, O.; Tako, E. Characterizing the Gut (Gallus Gallus) Microbiota Following the Consumption of an Iron Biofortified Rwandan Cream Seeded Carioca (Phaseolus Vulgaris L.) Bean-Based Diet. PLoS ONE 2017, 12, e0182431. [Google Scholar] [CrossRef] [Scilit]
- Bouis, H.E.; Hotz, C.; McClafferty, B.; Meenakshi, J.V.; Pfeiffer, W.H. Biofortification: A New Tool to Reduce Micronutrient Malnutrition. Food Nutr. Bull. 2011, 32, S31–S40. [Google Scholar] [CrossRef] [Scilit]
- Welch, R.M. Biotechnology, Biofortification, and Global Health. Food Nutr. Bull. 2005, 26, S304–S306. [Google Scholar] [CrossRef] [Scilit]
- Mayer, J.E.; Pfeiffer, W.H.; Beyer, P. Biofortified Crops to Alleviate Micronutrient Malnutrition. Curr. Opin. Plant Biol. 2008, 11, 166–170. [Google Scholar] [CrossRef] [Scilit]
- Juste Contin Gomes, M.; Stampini Duarte Martino, H.; Tako, E. Effects of Iron and Zinc Biofortified Foods on Gut Microbiota in Vivo (Gallus gallus): A Systematic Review. Nutrients 2021, 13, 189. [Google Scholar] [CrossRef] [Scilit]
- Tian, L.; Tan, Y.; Chen, G.; Wang, G.; Sun, J.; Ou, S.; Chen, W.; Bai, W. Metabolism of Anthocyanins and Consequent Effects on the Gut Microbiota. Crit. Rev. Food Sci. Nutr. 2019, 59, 982–991. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gibson, G.R.; Scott, K.P.; Rastall, R.A.; Tuohy, K.M.; Hotchkiss, A.; Dubert-Ferrandon, A.; Gareau, M.; Murphy, E.F.; Saulnier, D.; Loh, G. Dietary Prebiotics: Current Status and New Definition. Food Sci. Technol. Bull. Funct. Foods 2010, 7, 1–19. [Google Scholar] [CrossRef] [Scilit]
- van der Beek, C.M.; Canfora, E.E.; Kip, A.M.; Gorissen, S.H.; Damink, S.W.O.; van Eijk, H.M.; Holst, J.J.; Blaak, E.E.; Dejong, C.H.; Lenaerts, K. The Prebiotic Inulin Improves Substrate Metabolism and Promotes Short-Chain Fatty Acid Production in Overweight to Obese Men. Metabolism 2018, 87, 25–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McLoughlin, R.F.; Berthon, B.S.; Jensen, M.E.; Baines, K.J.; Wood, L.G. Short-Chain Fatty Acids, Prebiotics, Synbiotics, and Systemic Inflammation: A Systematic Review and Meta-Analysis. Am. J. Clin. Nutr. 2017, 106, 930–945. [Google Scholar] [CrossRef] [Scilit]
- Preidis, G.A.; Versalovic, J. Targeting the Human Microbiome with Antibiotics, Probiotics, and Prebiotics: Gastroenterology Enters the Metagenomics Era. Gastroenterology 2009, 136, 2015–2031. [Google Scholar] [CrossRef] [Scilit]
- Verediano, T.A.; Stampini Duarte Martino, H.; Dias Paes, M.C.; Tako, E. Effects of Anthocyanin on Intestinal Health: A Systematic Review. Nutrients 2021, 13, 1331. [Google Scholar] [CrossRef] [Scilit]
- Hou, T.; Tako, E. The in Ovo Feeding Administration (Gallus Gallus)—An Emerging in Vivo Approach to Assess Bioactive Compounds with Potential Nutritional Benefits. Nutrients 2018, 10, 418. [Google Scholar] [CrossRef] [Scilit]
- Wiesinger, J.A.; Glahn, R.P.; Cichy, K.A.; Kolba, N.; Hart, J.J.; Tako, E. An in Vivo (Gallus gallus) Feeding Trial Demonstrating the Enhanced Iron Bioavailability Properties of the Fast Cooking Manteca Yellow Bean (Phaseolus vulgaris L.). Nutrients 2019, 11, 1768. [Google Scholar] [CrossRef] [Scilit]
- Knez, M.; Tako, E.; Glahn, R.P.; Kolba, N.; de Courcy-Ireland, E.; Stangoulis, J.C. Linoleic Acid: Dihomo-γ-Linolenic Acid Ratio Predicts the Efficacy of Zn-Biofortified Wheat in Chicken (Gallus gallus). J. Agric. Food Chem. 2018, 66, 1394–1400. [Google Scholar] [CrossRef] [Scilit]
- Dias, D.M.; Kolba, N.; Binyamin, D.; Ziv, O.; Regini Nutti, M.; Martino, H.S.D.; Glahn, R.P.; Koren, O.; Tako, E. Iron Biofortified Carioca Bean (Phaseolus vulgaris L.)—Based Brazilian Diet Delivers More Absorbable Iron and Affects the Gut Microbiota in Vivo (Gallus gallus). Nutrients 2018, 10, 1970. [Google Scholar] [CrossRef] [Scilit]
- Tako, E.; Bar, H.; Glahn, R.P. The Combined Application of the Caco-2 Cell Bioassay Coupled with in Vivo (Gallus Gallus) Feeding Trial Represents an Effective Approach to Predicting Fe Bioavailability in Humans. Nutrients 2016, 8, 732. [Google Scholar] [CrossRef] [Scilit]
- Agrizzi Verediano, T.; Stampini Duarte Martino, H.; Kolba, N.; Fu, Y.; Cristina Dias Paes, M.; Tako, E. Black Corn (Zea mays L.) Soluble Extract Showed Anti-Inflammatory Effects and Improved the Intestinal Barrier Integrity in Vivo (Gallus gallus). Food Res. Int. 2022, 157, 111227. [Google Scholar] [CrossRef] [Scilit]
- Agrizzi Verediano, T.; Agarwal, N.; Gomes, M.J.C.; Duarte Martino, H.S.; Tako, E. Effects of Dietary Fiber on Intestinal Iron Absorption, and Physiological Status: A Systematic Review of in Vivo and Clinical Studies. Crit. Rev. Food Sci. Nutr. 2022, 1, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Gomes, M.J.C.; Martino, H.S.D.; Kolba, N.; Cheng, J.; Agarwal, N.; De Moura Rocha, M.; Tako, E. Zinc Biofortified Cowpea (Vigna unguiculata L. Walp.) Soluble Extracts Modulate Assessed Cecal Bacterial Populations and Gut Morphology in Vivo (Gallus gallus). Front. BioScience Landmark 2022, 27, 140–153. [Google Scholar] [CrossRef] [Scilit]
- Uni, Z.; Ferket, P.R.; Tako, E.; Kedar, O. In Ovo Feeding Improves Energy Status of Late-Term Chicken Embryos. Poult. Sci. 2005, 84, 764–770. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.H.; Wang, J.W.; Chen, X.; Zhang, R.P.; Yu, H.Y.; Jin, H.B.; Li, L.; Han, C.C. In Ovo Administration of RhIGF-1 to Duck Eggs Affects the Expression of Myogenic Transcription Factors and Muscle Mass during Late Embryo Development. J. Appl. Physiol. 2011, 111, 1789–1797. [Google Scholar] [CrossRef] [Scilit]
- Selim, S.A.; Gaafar, K.M.; El-ballal, S.S. Influence of In-Ovo Administration with Vitamin E and Ascorbic Acid on Theperformance of Muscovy Ducks. Emir. J. Food Agric. 2012, 24, 264–271. [Google Scholar]
- Beasley, J.T.; Johnson, A.A.; Kolba, N.; Bonneau, J.P.; Glahn, R.P.; Ozeri, L.; Koren, O.; Tako, E. Nicotianamine-Chelated Iron Positively Affects Iron Status, Intestinal Morphology and Microbial Populations in Vivo (Gallus gallus). Sci. Rep. 2020, 10, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Carboni, J.; Reed, S.; Kolba, N.; Eshel, A.; Koren, O.; Tako, E. Alterations in the Intestinal Morphology, Gut Microbiota, and Trace Mineral Status Following Intra-Amniotic Administration (Gallus gallus) of Teff (Eragrostis tef) Seed Extracts. Nutrients 2020, 12, 3020. [Google Scholar] [CrossRef] [Scilit]
- Pereira da Silva, B.; Kolba, N.; Duarte Martino, H.S.; Hart, J.J.; Tako, E. Soluble Extracts from Chia Seed (Salvia hispanica L.) Affect Brush Border Membrane Functionality, Morphology and Intestinal Bacterial Populations In Vivo (Gallus gallus). Nutrients 2019, 11, 2457. [Google Scholar] [CrossRef] [Scilit]
- Martens, C.R.; Denman, B.A.; Mazzo, M.R.; Armstrong, M.L.; Reisdorph, N.; McQueen, M.B.; Chonchol, M.; Seals, D.R. Chronic Nicotinamide Riboside Supplementation Is Well-Tolerated and Elevates NAD+ in Healthy Middle-Aged and Older Adults. Nat. Commun. 2018, 9, 1286. [Google Scholar] [CrossRef] [Scilit]
- Yang, T.; Chan, N.Y.-K.; Sauve, A.A. Syntheses of Nicotinamide Riboside and Derivatives: Effective Agents for Increasing Nicotinamide Adenine Dinucleotide Concentrations in Mammalian Cells. J. Med. Chem. 2007, 50, 6458–6461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Braidy, N.; Berg, J.; Clement, J.; Khorshidi, F.; Poljak, A.; Jayasena, T.; Grant, R.; Sachdev, P. Role of Nicotinamide Adenine Dinucleotide and Related Precursors as Therapeutic Targets for Age-Related Degenerative Diseases: Rationale, Biochemistry, Pharmacokinetics, and Outcomes. Antioxid. Redox Signal. 2019, 30, 251–294. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez, J.M.; Jackson, A.R. In Ovo Feeding of Nicotinamide Riboside Affects Broiler Pectoralis Major Muscle Development. Transl. Anim. Sci. 2020, 4, txaa126. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Ryu, D.; Wu, Y.; Gariani, K.; Wang, X.; Luan, P.; D’Amico, D.; Ropelle, E.R.; Lutolf, M.P.; Aebersold, R. NAD+ Repletion Improves Mitochondrial and Stem Cell Function and Enhances Life Span in Mice. Science 2016, 352, 1436–1443. [Google Scholar] [CrossRef] [Scilit]
- Cerutti, R.; Pirinen, E.; Lamperti, C.; Marchet, S.; Sauve, A.A.; Li, W.; Leoni, V.; Schon, E.A.; Dantzer, F.; Auwerx, J. NAD+-Dependent Activation of Sirt1 Corrects the Phenotype in a Mouse Model of Mitochondrial Disease. Cell Metab. 2014, 19, 1042–1049. [Google Scholar] [CrossRef] [Scilit]
- Gong, B.; Pan, Y.; Vempati, P.; Zhao, W.; Knable, L.; Ho, L.; Wang, J.; Sastre, M.; Ono, K.; Sauve, A.A. Nicotinamide Riboside Restores Cognition through an Upregulation of Proliferator-Activated Receptor-γ Coactivator 1α Regulated β-Secretase 1 Degradation and Mitochondrial Gene Expression in Alzheimer’s Mouse Models. Neurobiol. Aging 2013, 34, 1581–1588. [Google Scholar] [CrossRef] [Scilit]
- Cantó, C.; Houtkooper, R.H.; Pirinen, E.; Youn, D.Y.; Oosterveer, M.H.; Cen, Y.; Fernandez-Marcos, P.J.; Yamamoto, H.; Andreux, P.A.; Cettour-Rose, P. The NAD+ Precursor Nicotinamide Riboside Enhances Oxidative Metabolism and Protects against High-Fat Diet-Induced Obesity. Cell Metab. 2012, 15, 838–847. [Google Scholar] [CrossRef] [Scilit]
- Dollerup, O.L.; Christensen, B.; Svart, M.; Schmidt, M.S.; Sulek, K.; Ringgaard, S.; Stødkilde-Jørgensen, H.; Møller, N.; Brenner, C.; Treebak, J.T. A Randomized Placebo-Controlled Clinical Trial of Nicotinamide Riboside in Obese Men: Safety, Insulin-Sensitivity, and Lipid-Mobilizing Effects. Am. J. Clin. Nutr. 2018, 108, 343–353. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.J.; Hong, Y.-S.; Jun, W.; Yang, S.J. Nicotinamide Riboside Ameliorates Hepatic Metaflammation by Modulating NLRP3 Inflammasome in a Rodent Model of Type 2 Diabetes. J. Med. Food 2015, 18, 1207–1213. [Google Scholar] [CrossRef] [Scilit]
- Mehmel, M.; Jovanović, N.; Spitz, U. Nicotinamide Riboside—the Current State of Research and Therapeutic Uses. Nutrients 2020, 12, 1616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Y.; Fu, B.; Zheng, X.; Wang, D.; Zhao, C.; Qi, Y.; Sun, R.; Tian, Z.; Xu, X.; Wei, H. Pathogenic T-Cells and Inflammatory Monocytes Incite Inflammatory Storms in Severe COVID-19 Patients. Natl. Sci. Rev. 2020, 7, 998–1002. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campbell, M.T.; Jones, D.S.; Andrews, G.P.; Li, S. Understanding the Physicochemical Properties and Degradation Kinetics of Nicotinamide Riboside, a Promising Vitamin B3nutritional Supplement. Food Nutr. Res. 2019, 63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, X.; Jackson, A.R.; Gonzalez, J.M. The Effects of in Ovo Nicotinamide Riboside Dose on Broiler Myogenesis. Poult. Sci. 2021, 100, 100926. [Google Scholar] [CrossRef] [Scilit]
- Pacifici, S.; Song, J.; Zhang, C.; Wang, Q.; Glahn, R.; Kolba, N.; Tako, E. Intra Amniotic Administration of Raffinose and Stachyose Affects the Intestinal Brush Border Functionality and Alters Gut Microflora Populations. Nutrients 2017, 9, 304. [Google Scholar] [CrossRef] [Scilit]
- Tako, E. Dietary Plant-Origin Bio-Active Compounds, Intestinal Functionality, and Microbiome. Nutrients 2020, 12, 3223. [Google Scholar] [CrossRef] [Scilit]
- Martino, H.S.D.; Kolba, N.; Tako, E. Yacon (Smallanthus Sonchifolius) Flour Soluble Extract Improve Intestinal Bacterial Populations, Brush Border Membrane Functionality and Morphology in Vivo (Gallus gallus). Food Res. Int. 2020, 137, 109705. [Google Scholar] [CrossRef] [Scilit]
- Tako, E.; Ferket, P.R.; Uni, Z. Effects of in Ovo Feeding of Carbohydrates and Beta-Hydroxy-Beta-Methylbutyrate on the Development of Chicken Intestine. Poult. Sci. 2004, 83, 2023–2028. [Google Scholar] [CrossRef] [Scilit]
- Tako, E.; Glahn, R.P.; Knez, M.; Stangoulis, J.C. The Effect of Wheat Prebiotics on the Gut Bacterial Population and Iron Status of Iron Deficient Broiler Chickens. Nutr. J. 2014, 13, 1. [Google Scholar] [CrossRef] [Scilit]
- Gomes, M.J.C.; Kolba, N.; Agarwal, N.; Kim, D.; Eshel, A.; Koren, O.; Tako, E. Modifications in the Intestinal Functionality, Morphology and Microbiome Following Intra-Amniotic Administration (Gallus gallus) of Grape (Vitis vinifera) Stilbenes (Resveratrol and Pterostilbene). Nutrients 2021, 13, 3247. [Google Scholar] [CrossRef] [Scilit]
- Zhu, X.Y.; Zhong, T.; Pandya, Y.; Joerger, R.D. 16S RRNA-Based Analysis of Microbiota from the Cecum of Broiler Chickens. Appl. Environ. Microbiol. 2002, 68, 124–137. [Google Scholar] [CrossRef] [Scilit]
- Kourtzidis, I.A.; Dolopikou, C.F.; Tsiftsis, A.N.; Margaritelis, N.V.; Theodorou, A.A.; Zervos, I.A.; Tsantarliotou, M.P.; Veskoukis, A.S.; Vrabas, I.S.; Paschalis, V.; et al. Nicotinamide Riboside Supplementation Dysregulates Redox and Energy Metabolism in Rats: Implications for Exercise Performance. Exp. Physiol. 2018, 103, 1357–1366. [Google Scholar] [CrossRef] [Scilit]
- Bieganowski, P.; Brenner, C. Discoveries of Nicotinamide Riboside as a Nutrient and Conserved NRK Genes Establish a Preiss-Handler Independent Route to NAD+ in Fungi and Humans. Cell 2004, 117, 495–502. [Google Scholar] [CrossRef] [Scilit]
- Bürkle, A. Physiology and Pathophysiology of Poly(ADP-Ribosyl)Ation *: Review Articles. Bioessays 2001, 23, 795–806. [Google Scholar] [CrossRef] [Scilit]
- Chen, R.; Xu, Y.; Wu, P.; Zhou, H.; Lasanajak, Y.; Fang, Y.; Tang, L.; Ye, L.; Li, X.; Cai, Z.; et al. Transplantation of Fecal Microbiota Rich in Short Chain Fatty Acids and Butyric Acid Treat Cerebral Ischemic Stroke by Regulating Gut Microbiota. Pharmacol. Res. 2019, 148, 104403. [Google Scholar] [CrossRef] [Scilit]
- Aghazadeh, A.; TahaYazdi, M. Effect of Butyric Acid Supplementation and Whole Wheat Inclusion on the Performance and Carcass Traits of Broilers. SA J. An. Sci. 2012, 42, 241–248. [Google Scholar] [CrossRef] [Scilit]
- Panda, A.K.; Rao, S.V.R.; Raju, M.V.L.N.; Sunder, G.S. Effect of Butyric Acid on Performance, Gastrointestinal Tract Health and Carcass Characteristics in Broiler Chickens. Asian Australas. J. Anim. Sci 2009, 22, 1026–1031. [Google Scholar] [CrossRef] [Scilit]
- Guo, P.; Zhang, K.; Ma, X.; He, P. Clostridium Species as Probiotics: Potentials and Challenges. J. Anim. Sci. Biotechnol. 2020, 11, 24. [Google Scholar] [CrossRef] [Scilit]
- Van den Abbeele, P.; Belzer, C.; Goossens, M.; Kleerebezem, M.; De Vos, W.M.; Thas, O.; De Weirdt, R.; Kerckhof, F.-M.; Van de Wiele, T. Butyrate-Producing Clostridium Cluster XIVa Species Specifically Colonize Mucins in an in Vitro Gut Model. ISME J 2013, 7, 949–961. [Google Scholar] [CrossRef] [Scilit]
- Lopetuso, L.R.; Scaldaferri, F.; Petito, V.; Gasbarrini, A. Commensal Clostridia: Leading Players in the Maintenance of Gut Homeostasis. Gut Pathog. 2013, 5, 23. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.-S.; Muthyala, S.D.V.; Klemashevich, C.; Ufondu, A.U.; Menon, R.; Chen, Z.; Devaraj, S.; Jayaraman, A.; Sun, Y. Age-Dependent Remodeling of Gut Microbiome and Host Serum Metabolome in Mice. Aging 2021, 13, 6330–6345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaczmarek, S.A.; Barri, A.; Hejdysz, M.; Rutkowski, A. Effect of Different Doses of Coated Butyric Acid on Growth Performance and Energy Utilization in Broilers. Poult. Sci. 2016, 95, 851–859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, X.; Ji, J.; Qu, H.; Wang, J.; Shu, D.M.; Wang, Y.; Liu, T.F.; Li, Y.; Luo, C.L. Effects of Sodium Butyrate on Intestinal Health and Gut Microbiota Composition during Intestinal Inflammation Progression in Broilers. Poult. Sci. 2019, 98, 4449–4456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aalamifar, H.; Soltanian, S.; Vazirzadeh, A.; Akhlaghi, M.; Morshedi, V.; Gholamhosseini, A.; Torfi Mozanzadeh, M. Dietary Butyric Acid Improved Growth, Digestive Enzyme Activities and Humoral Immune Parameters in Barramundi (Lates Calcarifer). Aquacult. Nutr. 2020, 26, 156–164. [Google Scholar] [CrossRef] [Scilit]
- Lozada-Fernández, V.V.; de Leon, O.; Kellogg, S.L.; Saravia, F.L.; Hadiono, M.A.; Atkinson, S.N.; Grobe, J.L.; Kirby, J.R. Nicotinamide Riboside-Conditioned Microbiota Deflects High-Fat Diet-Induced Weight Gain in Mice. mSystems 2022, 7, e00230-21. [Google Scholar] [CrossRef] [Scilit]
- Schein, P.S.; Loftus, S. Streptozotocin: Depression of Mouse Liver Pyridine Nucleotides. Cancer Res. 1968, 28, 1501–1506. [Google Scholar]
- Nagai, A.; Matsumiya, H.; Hayashi, M.; Yasui, S.; Okamoto, H.; Konno, K. Effects of Nicotinamide and Niacin on Bleomycin-Induced Acute Injury and Subsequent Fibrosis in Hamster Lungs. Exp. Lung Res. 1994, 20, 263–281. [Google Scholar] [CrossRef] [Scilit]
- LeClaire, R.D.; Kell, W.; Bavari, S.; Smith, T.J.; Hunt, R.E. Protective Effects of Niacinamide in Staphylococcal Enterotoxin-B-Induced Toxicity. Toxicology 1996, 107, 69–81. [Google Scholar] [CrossRef] [Scilit]
- Hiromatsu, Y.; Sato, M.; Yamada, K.; Nonaka, K. Inhibitory Effects of Nicotinamide on Recombinant Human Interferon-Gamma-Induced Intercellular Adhesion Molecule-1 (ICAM-1) and HLA-DR Antigen Expression on Cultured Human Endothelial Cells. Immunol. Lett. 1992, 31, 35–39. [Google Scholar] [CrossRef] [Scilit]
- Otsuka, A.; Hanafusa, T.; Miyagawa, J.-I.; Kono, N.; Tarui, S. Nicotinamide and 3-Aminobenzamide Reduce Interferon-γ -Induced Class II MHC (HLA-DR and -DP) Molecule Expression on Cultured Human Endothelial Cells and Fibroblasts. Immunopharmacol. Immunotoxicol. 1991, 13, 263–280. [Google Scholar] [CrossRef] [Scilit]
- Murray, M.F. Nicotinamide: An Oral Antimicrobial Agent with Activity against Both Mycobacterium Tuberculosis and Human Immunodeficiency Virus. Clin. Infect. Dis. 2003, 36, 453–460. [Google Scholar] [CrossRef] [Scilit]
- Yang, D.; Chertov, O.; Oppenheim, J.J. Participation of Mammalian Defensins and Cathelicidins in Anti-Microbial Immunity: Receptors and Activities of Humandefensins and Cathelicidin (LL-37). J. Leukoc. Biol. 2001, 69, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Baquero, F.; Nombela, C. The Microbiome as a Human Organ. Clin. Microbiol. Infect. 2012, 18, 2–4. [Google Scholar] [CrossRef] [Scilit]
- Biesalski, H.K. Nutrition Meets the Microbiome: Micronutrients and the Microbiota: Nutrition Meets the Microbiome. Ann. N. Y. Acad. Sci. 2016, 1372, 53–64. [Google Scholar] [CrossRef] [Scilit]
- Takakuwa, A.; Nakamura, K.; Kikuchi, M.; Sugimoto, R.; Ohira, S.; Yokoi, Y.; Ayabe, T. Butyric Acid and Leucine Induce α-Defensin Secretion from Small Intestinal Paneth Cells. Nutrients 2019, 11, 2817. [Google Scholar] [CrossRef] [Scilit]
- Regueiro, L.; Carballa, M.; Lema, J.M. Microbiome Response to Controlled Shifts in Ammonium and LCFA Levels in Co-Digestion Systems. J. Biotechnol. 2016, 220, 35–44. [Google Scholar] [CrossRef] [Scilit]
- Limage, R.; Tako, E.; Kolba, N.; Guo, Z.; García-Rodríguez, A.; Marques, C.N.H.; Mahler, G.J. TiO2 Nanoparticles and Commensal Bacteria Alter Mucus Layer Thickness and Composition in a Gastrointestinal Tract Model. Small 2020, 2000601. [Google Scholar] [CrossRef] [Scilit]
- Kolba, N.; Guo, Z.; Olivas, F.M.; Mahler, G.J.; Tako, E. Intra-Amniotic Administration (Gallus gallus) of TiO2, SiO2, and ZnO Nanoparticles Affect Brush Border Membrane Functionality and Alters Gut Microflora Populations. Food Chem. Toxicol. 2019, 110896. [Google Scholar] [CrossRef] [Scilit]
- Allen, A.; Hutton, D.A.; Pearson, J.P. The MUC2 Gene Product: A Human Intestinal Mucin. Int. J. Biochem. Cell Biol. 1998, 30, 797–801. [Google Scholar] [CrossRef] [Scilit]
- Bergstrom, K.S.B.; Kissoon-Singh, V.; Gibson, D.L.; Ma, C.; Montero, M.; Sham, H.P.; Ryz, N.; Huang, T.; Velcich, A.; Finlay, B.B.; et al. Muc2 Protects against Lethal Infectious Colitis by Disassociating Pathogenic and Commensal Bacteria from the Colonic Mucosa. PLoS Pathog 2010, 6, e1000902. [Google Scholar] [CrossRef] [Scilit]
- Zarepour, M.; Bhullar, K.; Montero, M.; Ma, C.; Huang, T.; Velcich, A.; Xia, L.; Vallance, B.A. The Mucin Muc2 Limits Pathogen Burdens and Epithelial Barrier Dysfunction during Salmonella Enterica Serovar Typhimurium Colitis. Infect. Immun. 2013, 81, 3672–3683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elhassan, Y.S.; Kluckova, K.; Fletcher, R.S.; Schmidt, M.S.; Garten, A.; Doig, C.L.; Cartwright, D.M.; Oakey, L.; Burley, C.V.; Jenkinson, N.; et al. Nicotinamide Riboside Augments the Aged Human Skeletal Muscle NAD+ Metabolome and Induces Transcriptomic and Anti-Inflammatory Signatures. Cell Rep. 2019, 28, 1717–1728. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dolopikou, C.F.; Kourtzidis, I.A.; Margaritelis, N.V.; Vrabas, I.S.; Koidou, I.; Kyparos, A.; Theodorou, A.A.; Paschalis, V.; Nikolaidis, M.G. Acute Nicotinamide Riboside Supplementation Improves Redox Homeostasis and Exercise Performance in Old Individuals: A Double-Blind Cross-over Study. Eur. J. Nutr. 2020, 11, 505–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carrera-Juliá, S.; Moreno, M.L.; Barrios, C.; de la Rubia Ortí, J.E.; Drehmer, E. Antioxidant Alternatives in the Treatment of Amyotrophic Lateral Sclerosis: A Comprehensive Review. Front. Physiol. 2020, 11, 63. [Google Scholar] [CrossRef] [Scilit]
- Andrews, G.K.; Wang, H.; Dey, S.K.; Palmiter, R.D. Mouse Zinc Transporter 1 Gene Provides an Essential Function during Early Embryonic Development. genesis 2004, 40, 74–81. [Google Scholar] [CrossRef] [Scilit]
- Segal, D.; Ohana, E.; Besser, L.; Hershfinkel, M.; Moran, A.; Sekler, I. A Role for ZnT-1 in Regulating Cellular Cation Influx. Biochem. Biophys. Res. Commun. 2004, 323, 1145–1150. [Google Scholar] [CrossRef] [Scilit]
- Tako, E.; Ferket, P.; Uni, Z. Changes in Chicken Intestinal Zinc Exporter MRNA Expression and Small Intestinal Functionality Following Intra-Amniotic Zinc-Methionine Administration. J. Nutr. Biochem. 2005, 16, 339–346. [Google Scholar] [CrossRef] [Scilit]
- Ghashut, R.A.; McMillan, D.C.; Kinsella, J.; Vasilaki, A.T.; Talwar, D.; Duncan, A. The Effect of the Systemic Inflammatory Response on Plasma Zinc and Selenium Adjusted for Albumin. Clin. Nutr. 2016, 35, 381–387. [Google Scholar] [CrossRef] [Scilit]
- Vasto, S.; Mocchegiani, E.; Candore, G.; Listì, F.; Colonna-Romano, G.; Lio, D.; Malavolta, M.; Giacconi, R.; Cipriano, C.; Caruso, C. Inflammation, Genes and Zinc in Ageing and Age-Related Diseases. Biogerontology 2006, 7, 315–327. [Google Scholar] [CrossRef] [Scilit]
- Vasto, S.; Mocchegiani, E.; Malavolta, M.; Cuppari, I.; Listi, F.; Nuzzo, D.; Ditta, V.; Candore, G.; Caruso, C. Zinc and Inflammatory/Immune Response in Aging. Ann. N. Y. Acad. Sci. 2007, 1100, 111–122. [Google Scholar] [CrossRef] [Scilit]
- Mburu, A.S.W.; Thurnham, D.I.; Mwaniki, D.L.; Muniu, E.M.; Alumasa, F.M. The Influence of Inflammation on Plasma Zinc Concentration in Apparently Healthy, HIV+ Kenyan Adults and Zinc Responses after a Multi-Micronutrient Supplement. Eur. J. Clin. Nutr. 2010, 64, 510–517. [Google Scholar] [CrossRef] [Scilit]
- McDonald, C.M.; Suchdev, P.S.; Krebs, N.F.; Hess, S.Y.; Wessells, K.R.; Ismaily, S.; Rahman, S.; Wieringa, F.T.; Williams, A.M.; Brown, K.H.; et al. Adjusting Plasma or Serum Zinc Concentrations for Inflammation: Biomarkers Reflecting Inflammation and Nutritional Determinants of Anemia (BRINDA) Project. Am. J. Clin. Nutr. 2020, 111, 927–937. [Google Scholar] [CrossRef] [Scilit]
- Agarwal, N.; Kolba, N.; Jung, Y.; Cheng, J.; Tako, E. Saffron (Crocus Sativus L.) Flower Water Extract Disrupts the Cecal Microbiome, Brush Border Membrane Functionality, and Morphology In Vivo (Gallus Gallus). Nutrients 2022, 14, 220. [Google Scholar] [CrossRef] [Scilit]
- Agarwal, N.; Kolba, N.; Khen, N.; Even, C.; Turjeman, S.; Koren, O.; Tako, E. Quinoa Soluble Fiber and Quercetin Alter the Composition of the Gut Microbiome and Improve Brush Border Membrane Morphology In Vivo (Gallus Gallus). Nutrients 2022, 14, 448. [Google Scholar] [CrossRef] [Scilit]
- Salam, S.; Iqbal, Z.; Khan, A.A.; Mahmood, R. Oral Administration of Thiram Inhibits Brush Border Membrane Enzymes, Oxidizes Proteins and Thiols, Impairs Redox System and Causes Histological Changes in Rat Intestine: A Dose Dependent Study. Pestic. Biochem. Physiol. 2021, 178, 104915. [Google Scholar] [CrossRef] [Scilit]
- Lucea, S.; Guillén, N.; Sosa, C.; Sorribas, V. Inhibition of Phosphate Transport by NAD+/NADH in Brush Border Membrane Vesicles. Am. J. Physiol.-Cell Physiol. 2022, 322, C803–C813. [Google Scholar] [CrossRef] [Scilit]
- Shahid, F.; Farooqui, Z.; Khan, A.A.; Khan, F. Oral Nigella Sativa Oil and Thymoquinone Administration Ameliorates the Effect of Long-Term Cisplatin Treatment on the Enzymes of Carbohydrate Metabolism, Brush Border Membrane, and Antioxidant Defense in Rat Intestine. Naunyn-Schmiedeberg’s Arch Pharm. 2018, 391, 145–157. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Cheng, J.; Yuan, Y.; Luo, R.; Zhu, Z. Age-related Intestinal Monosaccharides Transporters Expression and Villus Surface Area Increase in Broiler and Layer Chickens. J. Anim. Physiol. Anim. Nutr. 2020, 104, 144–155. [Google Scholar] [CrossRef] [Scilit]
- Coméra, C.; Cartier, C.; Gaultier, E.; Catrice, O.; Panouille, Q.; El Hamdi, S.; Tirez, K.; Nelissen, I.; Théodorou, V.; Houdeau, E. Jejunal Villus Absorption and Paracellular Tight Junction Permeability Are Major Routes for Early Intestinal Uptake of Food-Grade TiO2 Particles: An in Vivo and Ex Vivo Study in Mice. Part Fibre Toxicol. 2020, 17, 26. [Google Scholar] [CrossRef] [Scilit]
- Tysoe, O. Dietary Fructose Acts on Gut to Increase Nutrient Uptake. Nat. Rev. Endocrinol. 2021, 17, 639. [Google Scholar] [CrossRef] [Scilit]
- De Vadder, F.; Kovatcheva-Datchary, P.; Goncalves, D.; Vinera, J.; Zitoun, C.; Duchampt, A.; Bäckhed, F.; Mithieux, G. Microbiota-Generated Metabolites Promote Metabolic Benefits via Gut-Brain Neural Circuits. Cell 2014, 156, 84–96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kelly, D. Regulation of Gut Function and Immunity. In Formula for the Future: Nutrition or Pathology? Evaluating Performance and Health in Pigs and Poultry; Nottingham University Press: Nottingham, UK, 2008; Volume 151, p. 131. ISBN 978-90-8686-088-3. [Google Scholar]
- Snel, J.; Harmsen, H.; van der Wielen, P.; Williams, B. Dietary Strategies to Influence the Gastrointestinal Microflora of Young Animals, and Its Potential to Improve Intestinal Health. In Nutrition and Health in the Gastrointestinal Tract; Wageningen Academic Publishers: Wageningen, The Netherlands, 2002; pp. 37–69. [Google Scholar]
- Lewis, A.J.; Southern, L.L. Intestinal Bacteria and Their Influence on Swine Growth. In Swine Nutrition; CRC Press: Boca Raton, FL, USA, 2000; pp. 585–611. ISBN 978-0-429-11507-3. [Google Scholar]
- Apajalahti, J.; Kettunen, A.; Graham, H. Characteristics of the Gastrointestinal Microbial Communities, with Special Reference to the Chicken. World’s Poult. Sci. J. 2004, 60, 223–232. [Google Scholar] [CrossRef]
- He, W.; Wu, G. Oxidation of Amino Acids, Glucose, and Fatty Acids as Metabolic Fuels in Enterocytes of Developing Pigs. Amino Acids 2022, 54, 1025–1039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Litvak, Y.; Byndloss, M.X.; Bäumler, A.J. Colonocyte Metabolism Shapes the Gut Microbiota. Science 2018, 362, eaat9076. [Google Scholar] [CrossRef] [Scilit]
- Salvi, P.S.; Cowles, R.A. Butyrate and the Intestinal Epithelium: Modulation of Proliferation and Inflammation in Homeostasis and Disease. Cells 2021, 10, 1775. [Google Scholar] [CrossRef] [Scilit]
- Borthakur, A.; Saksena, S.; Gill, R.K.; Alrefai, W.A.; Ramaswamy, K.; Dudeja, P.K. Regulation of Monocarboxylate Transporter 1 (MCT1) Promoter by Butyrate in Human Intestinal Epithelial Cells: Involvement of NF-ΚB Pathway. J. Cell. Biochem. 2008, 103, 1452–1463. [Google Scholar] [CrossRef] [Scilit]
- Gonçalves, P.; Araújo, J.R.; Martel, F. Characterization of Butyrate Uptake by Nontransformed Intestinal Epithelial Cell Lines. J Membr. Biol 2011, 240, 35–46. [Google Scholar] [CrossRef] [Scilit]
- Kim, M.H.; Kang, S.G.; Park, J.H.; Yanagisawa, M.; Kim, C.H. Short-Chain Fatty Acids Activate GPR41 and GPR43 on Intestinal Epithelial Cells to Promote Inflammatory Responses in Mice. Gastroenterology 2013, 145, 396–406.e10. [Google Scholar] [CrossRef] [Scilit]
- Tazoe, H.; Otomo, Y.; Kaji, I.; Tanaka, R.; Karaki, S.-I.; Kuwahara, A. Roles of Short-Chain Fatty Acids Receptors, GPR41 and GPR43 on Colonic Functions. J. Physiol. Pharm. 2008, 59 (Suppl. 2), 251–262. [Google Scholar]
- Zhao, Y.; Chen, F.; Wu, W.; Sun, M.; Bilotta, A.J.; Yao, S.; Xiao, Y.; Huang, X.; Eaves-Pyles, T.D.; Golovko, G.; et al. GPR43 Mediates Microbiota Metabolite SCFA Regulation of Antimicrobial Peptide Expression in Intestinal Epithelial Cells via Activation of MTOR and STAT3. Mucosal. Immunol. 2018, 11, 752–762. [Google Scholar] [CrossRef] [Scilit]
- Fujiwara, H.; Docampo, M.D.; Riwes, M.; Peltier, D.; Toubai, T.; Henig, I.; Wu, S.J.; Kim, S.; Taylor, A.; Brabbs, S.; et al. Microbial Metabolite Sensor GPR43 Controls Severity of Experimental GVHD. Nat. Commun. 2018, 9, 3674. [Google Scholar] [CrossRef] [Scilit]
- Brown, A.J.; Goldsworthy, S.M.; Barnes, A.A.; Eilert, M.M.; Tcheang, L.; Daniels, D.; Muir, A.I.; Wigglesworth, M.J.; Kinghorn, I.; Fraser, N.J.; et al. The Orphan G Protein-Coupled Receptors GPR41 and GPR43 Are Activated by Propionate and Other Short Chain Carboxylic Acids. J. Biol. Chem. 2003, 278, 11312–11319. [Google Scholar] [CrossRef] [Scilit]
- Barker, N.; van Es, J.H.; Kuipers, J.; Kujala, P.; van den Born, M.; Cozijnsen, M.; Haegebarth, A.; Korving, J.; Begthel, H.; Peters, P.J.; et al. Identification of Stem Cells in Small Intestine and Colon by Marker Gene Lgr5. Nature 2007, 449, 1003–1007. [Google Scholar] [CrossRef] [Scilit]
- Kaiko, G.E.; Ryu, S.H.; Koues, O.I.; Collins, P.L.; Solnica-Krezel, L.; Pearce, E.J.; Pearce, E.L.; Oltz, E.M.; Stappenbeck, T.S. The Colonic Crypt Protects Stem Cells from Microbiota-Derived Metabolites. Cell 2016, 165, 1708–1720. [Google Scholar] [CrossRef] [Scilit]
- Neelis, E.; Koning, B.; Rings, E.; Wijnen, R.; Nichols, B.; Hulst, J.; Gerasimidis, K. The Gut Microbiome in Patients with Intestinal Failure: Current Evidence and Implications for Clinical Practice. J. Parenter. Enter. Nutr. 2019, 43, 194–205. [Google Scholar] [CrossRef] [Scilit]
- Kien, C.L.; Blauwiekel, R.; Bunn, J.Y.; Jetton, T.L.; Frankel, W.L.; Holst, J.J. Cecal Infusion of Butyrate Increases Intestinal Cell Proliferation in Piglets. J. Nutr. 2007, 137, 916–922. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Chen, H.; Zhu, W.; Yu, K. Cecal Infusion of Sodium Propionate Promotes Intestinal Development and Jejunal Barrier Function in Growing Pigs. Animals 2019, 9, 284. [Google Scholar] [CrossRef] [Scilit]









| Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) | Base Pair | GI Identifier |
|---|---|---|---|---|
| Iron Metabolism | ||||
| DMT1 | TTGATTCAGAGCCTCCCATTAG | GCGAGGAGTAGGCTTGTATTT | 101 | 206597489 |
| Zinc Metabolism | ||||
| ZIP1 | TGCCTCAGTTTCCCTCAC | GGCTCTTAAGGGCACTTCT | 144 | 107055139 |
| ZnT1 | GGTAACAGAGCTGCCTTAACT | GGTAACAGAGCTGCCTTAACT | 105 | 54109718 |
| Inflammatory Response | ||||
| TNF-α | GACAGCCTATGCCAACAAGTA | TTACAGGAAGGGCAACTCATC | 109 | 53854909 |
| IL-8 | TCATCCATCCCAAGTTCATTCA | GACACACTTCTCTGCCATCTT | 105 | 395872 |
| IL-6 | ACCTCATCCTCCGAGACTTTA | GCACTGAAACTCCTGGTCTT | 105 | 302315692 |
| IL-1β | CTCACAGTCCTTCGACATCTTC | TGTTGAGCCTCACTTTCTGG | 119 | 88702685 |
| BBM functionality | ||||
| SGLT-1 | GCATCCTTACTCTGTGGTACTG | TATCCGCACATCACACATCC | 106 | 8346783 |
| SI | CCAGCAATGCCAGCATATTG | CGGTTTCTCCTTACCACTTCTT | 95 | 2246388 |
| MUC2 | CCTGCTGCAAGGAAGTAGAA | GGAAGATCAGAGTGGTGCATAG | 155 | 423101 |
| 18S | GCAAGACGAACTAAAGCGAAAG | TCGGAACTACGACGGTATCT | 100 | 7262899 |
| Group Name | Average Body Weight (g) | Average Cecum Weight (g) | CW: BW |
|---|---|---|---|
| NI | 42.06 ± 1.35 a | 0.45 ± 0.05 a | 0.011 ± 0.002 a |
| H2O | 42.16 ± 1.28 a | 0.29 ± 0.04 bc | 0.007 ± 0.001 ab |
| NRCl | 42.74 ± 1.30 a | 0.23 ± 0.05 c | 0.005 ± 0.001 b |
| NRTBCl | 43.80 ± 0.74 a | 0.38 ± 0.06 ab | 0.009 ± 0.001 ab |
| NRTOCl | 43.17 ± 0.85 a | 0.35 ± 0.04 abc | 0.008 ± 0.001 ab |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kolba, N.; Zarei, A.; Cheng, J.; Agarwal, N.; Dadmohammadi, Y.; Khazdooz, L.; Abbaspourrad, A.; Tako, E. Alterations in Intestinal Brush Border Membrane Functionality and Bacterial Populations Following Intra-Amniotic Administration (Gallus gallus) of Nicotinamide Riboside and Its Derivatives. Nutrients 2022, 14, 3130. https://doi.org/10.3390/nu14153130
Kolba N, Zarei A, Cheng J, Agarwal N, Dadmohammadi Y, Khazdooz L, Abbaspourrad A, Tako E. Alterations in Intestinal Brush Border Membrane Functionality and Bacterial Populations Following Intra-Amniotic Administration (Gallus gallus) of Nicotinamide Riboside and Its Derivatives. Nutrients. 2022; 14(15):3130. https://doi.org/10.3390/nu14153130
Chicago/Turabian StyleKolba, Nikolai, Amin Zarei, Jacquelyn Cheng, Nikita Agarwal, Younas Dadmohammadi, Leila Khazdooz, Alireza Abbaspourrad, and Elad Tako. 2022. "Alterations in Intestinal Brush Border Membrane Functionality and Bacterial Populations Following Intra-Amniotic Administration (Gallus gallus) of Nicotinamide Riboside and Its Derivatives" Nutrients 14, no. 15: 3130. https://doi.org/10.3390/nu14153130
APA StyleKolba, N., Zarei, A., Cheng, J., Agarwal, N., Dadmohammadi, Y., Khazdooz, L., Abbaspourrad, A., & Tako, E. (2022). Alterations in Intestinal Brush Border Membrane Functionality and Bacterial Populations Following Intra-Amniotic Administration (Gallus gallus) of Nicotinamide Riboside and Its Derivatives. Nutrients, 14(15), 3130. https://doi.org/10.3390/nu14153130

