Seabuckthorn Reverses High-Fat-Diet-Induced Obesity and Enhances Fat Browning via Activation of AMPK/SIRT1 Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Care and Use of Animals
2.2. Glucose and Insulin Tolerance Tests
2.3. Cold-Induced Thermogenesis Test
2.4. Hematoxylin and Eosin Staining
2.5. Immunohistochemistry
2.6. Enzyme-Linked Immunosorbent Assay
2.7. Western Blotting
2.8. Quantitative Real-Time PCR (qPCR) Analysis
2.9. Antibodies
2.10. Statistical Analysis
3. Results
3.1. Seabuckthorn Inhibits Weight Gain and Adiposity of Mice Fed with HFD
3.2. Seabuckthorn Intake Improved Insulin Sensitivity and Glucose Tolerance
3.3. Seabuckthorn Prevented Hepatic Steatosis Induced by HFD
3.4. Seabuckthorn Attenuates Inflammation in HFD-Fed Mice
3.5. Seabuckthorn Enhanced the BAT Function in HFD-Fed Mice
3.6. Dietary Seabuckthorn Supplementation Potentiated Beige Adipogenesis
3.7. Effects of Seabuckthorn on AMPK/SIRT1 Activity in Both BAT and iWAT
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Czech, M.P. Insulin action and resistance in obesity and type 2 diabetes. Nat. Med. 2017, 23, 804–814. [Google Scholar] [CrossRef] [PubMed]
- Van Marken Lichtenbelt, W.D.; Vanhommerig, J.W.; Smulders, N.M.; Drossaerts, J.M.; Kemerink, G.J.; Bouvy, N.D.; Schrauwen, P.; Teule, G.J. Cold-activated brown adipose tissue in healthy men. N. Engl. J. Med. 2009, 360, 1500–1508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, K.Y.; Brychta, R.J.; Sater, Z.A.; Cassimatis, T.M.; Cero, C.; Fletcher, L.A.; Israni, N.S.; Johnson, J.W.; Lea, H.J.; Linderman, J.D. Opportunities and challenges in the therapeutic activation of human energy expenditure and thermogenesis to manage obesity. J. Biol. Chem. 2020, 295, 1926–1942. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chung, K.-J.; Chatzigeorgiou, A.; Economopoulou, M.; Garcia-Martin, R.; Alexaki, V.I.; Mitroulis, I.; Nati, M.; Gebler, J.; Ziemssen, T.; Goelz, S.E. A self-sustained loop of inflammation-driven inhibition of beige adipogenesis in obesity. Nat. Immunol. 2017, 18, 654–664. [Google Scholar] [CrossRef] [Green Version]
- Mulya, A.; Kirwan, J.P. Brown and beige adipose tissue: Therapy for obesity and its comorbidities? Endocrinol. Metab. Clin. 2016, 45, 605–621. [Google Scholar] [CrossRef] [Green Version]
- Singh, I.P.; Ahmad, F.; Gore, D.D.; Tikoo, K.; Bansal, A.; Jachak, S.M.; Jena, G. Therapeutic potential of seabuckthorn: A patent review (2000–2018). Expert Opin. Ther. Pat. 2019, 29, 733–744. [Google Scholar] [CrossRef]
- Olas, B. The beneficial health aspects of sea buckthorn (Elaeagnus rhamnoides (L.) A. Nelson) oil. J. Ethnopharmacol. 2018, 213, 183–190. [Google Scholar] [CrossRef]
- Pichiah, P.B.; Moon, H.J.; Park, J.E.; Moon, Y.J.; Cha, Y.S. Ethanolic extract of seabuckthorn (Hippophae rhamnoides L.) prevents high-fat diet-induced obesity in mice through down-regulation of adipogenic and lipogenic gene expression. Nutr. Res. 2012, 32, 856–864. [Google Scholar] [CrossRef]
- Kwon, E.-Y.; Lee, J.; Kim, Y.J.; Do, A.; Choi, J.-Y.; Cho, S.-J.; Jung, U.J.; Lee, M.-K.; Park, Y.B.; Choi, M.-S. Seabuckthorn leaves extract and flavonoid glycosides extract from seabuckthorn leaves ameliorates adiposity, hepatic steatosis, insulin resistance, and inflammation in diet-induced obesity. Nutrients 2017, 9, 569. [Google Scholar] [CrossRef] [Green Version]
- Lage, R.; Diéguez, C.; Vidal-Puig, A.; López, M. AMPK: A metabolic gauge regulating whole-body energy homeostasis. Trends Mol. Med. 2008, 14, 539–549. [Google Scholar] [CrossRef]
- Garcia, D.; Hellberg, K.; Chaix, A.; Wallace, M.; Herzig, S.; Badur, M.G.; Lin, T.; Shokhirev, M.N.; Pinto, A.F.; Ross, D.S. Genetic liver-specific AMPK activation protects against diet-induced obesity and NAFLD. Cell Rep. 2019, 26, 192–208.e6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, S.; Hu, G.; Li, D.; Sun, M.; Mou, D. Anti-hyperlipidemia effect of sea buckthorn fruit oil extract through the AMPK and Akt signaling pathway in hamsters. J. Funct. Foods 2020, 66, 103837. [Google Scholar] [CrossRef]
- Desjardins, E.M.; Steinberg, G.R. Emerging role of AMPK in brown and beige adipose tissue (BAT): Implications for obesity, insulin resistance, and type 2 diabetes. Curr. Diab. Rep. 2018, 18, 80. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Liu, X.; Li, K.; Liu, W.; Ren, Y.; Zhang, J. Different dietary energy intake affects skeletal muscle development through an Akt-dependent pathway in Dorper× Small Thin-Tailed crossbred ewe lambs. Domest. Anim. Endocrinol. 2016, 57, 63–70. [Google Scholar] [CrossRef]
- Gao, X.; Deng, B.; Li, X.; Wang, Y.; Zhang, J.; Hao, X.; Zhao, J. Melatonin Regulates Differentiation of Sheep Brown Adipocyte Precursor Cells Via AMP-Activated Protein Kinase. Front. Vet. Sci. 2021, 8, 661773. [Google Scholar] [CrossRef]
- Wolfenden, L.; Ezzati, M.; Larijani, B.; Dietz, W. The challenge for global health systems in preventing and managing obesity. Obes. Rev. 2019, 20, 185–193. [Google Scholar] [CrossRef]
- Perng, W.; Cantoral, A.; Soria-Contreras, D.C.; Betanzos-Robledo, L.; Kordas, K.; Liu, Y.; Mora, A.M.; Corvalan, C.; Pereira, A.; Cardoso, M.A. Exposure to obesogenic endocrine disrupting chemicals and obesity among youth of Latino or Hispanic origin in the United States and Latin America: A lifecourse perspective. Obes. Rev. 2021, 22, e13245. [Google Scholar] [CrossRef]
- Wang, Y.; Zhao, L.; Gao, L.; Pan, A.; Xue, H. Health policy and public health implications of obesity in China. Lancet Diabetes Endocrinol. 2021, 9, 446–461. [Google Scholar] [CrossRef]
- Liu, J.; Lee, J.; Hernandez, M.A.S.; Mazitschek, R.; Ozcan, U. Treatment of obesity with celastrol. Cell 2015, 161, 999–1011. [Google Scholar] [CrossRef] [Green Version]
- Hasani-Ranjbar, S.; Nayebi, N.; Larijani, B.; Abdollahi, M. A systematic review of the efficacy and safety of herbal medicines used in the treatment of obesity. World J. Gastroenterol. 2009, 15, 3073. [Google Scholar] [CrossRef]
- Shende, P.; Narvenker, R. Herbal nanotherapy: A new paradigm over conventional obesity treatment. J. Drug Deliv. Sci. Technol. 2021, 61, 102291. [Google Scholar] [CrossRef]
- Wang, K.; Xu, Z.; Liao, X. Bioactive compounds, health benefits and functional food products of sea buckthorn: A review. Crit. Rev. Food Sci. Nutr. 2021, 1–22. [Google Scholar] [CrossRef] [PubMed]
- Lan, Y.; Sun, Q.; Ma, Z.; Peng, J.; Zhang, M.; Wang, C.; Zhang, X.; Yan, X.; Chang, L.; Hou, X. Seabuckthorn polysaccharide ameliorates high-fat diet-induced obesity by gut microbiota-SCFAs-liver axis. Food Funct. 2022, 13, 2925–2937. [Google Scholar] [CrossRef] [PubMed]
- Vermaak, I.; Viljoen, A.M.; Hamman, J.H. Natural products in anti-obesity therapy. Nat. Prod. Rep. 2011, 28, 1493–1533. [Google Scholar] [CrossRef]
- Fatima, T.; Snyder, C.L.; Schroeder, W.R.; Cram, D.; Datla, R.; Wishart, D.; Weselake, R.J.; Krishna, P. Fatty acid composition of developing sea buckthorn (Hippophae rhamnoides L.) berry and the transcriptome of the mature seed. PLoS ONE 2012, 7, e34099. [Google Scholar] [CrossRef] [Green Version]
- Gao, S.; Guo, Q.; Qin, C.; Shang, R.; Zhang, Z. Sea buckthorn fruit oil extract alleviates insulin resistance through the PI3K/Akt signaling pathway in type 2 diabetes mellitus cells and rats. J. Agric. Food Chem. 2017, 65, 1328–1336. [Google Scholar] [CrossRef]
- Watt, M.J.; Miotto, P.M.; De Nardo, W.; Montgomery, M.K. The liver as an endocrine organ-linking NAFLD and insulin resistance. Endocr. Rev. 2019, 40, 1367–1393. [Google Scholar] [CrossRef]
- Rupasinghe, H.V.; Sekhon-Loodu, S.; Mantso, T.; Panayiotidis, M.I. Phytochemicals in regulating fatty acid β-oxidation: Potential underlying mechanisms and their involvement in obesity and weight loss. Pharmacol. Ther. 2016, 165, 153–163. [Google Scholar] [CrossRef]
- Li, V.L.; Kim, J.T.; Long, J.Z. Adipose tissue lipokines: Recent progress and future directions. Diabetes 2020, 69, 2541–2548. [Google Scholar] [CrossRef]
- Zatterale, F.; Longo, M.; Naderi, J.; Raciti, G.A.; Desiderio, A.; Miele, C.; Beguinot, F. Chronic Adipose Tissue Inflammation Linking Obesity to Insulin Resistance and Type 2 Diabetes. Front. Physiol. 2020, 10, 1607. [Google Scholar] [CrossRef]
- Herz, C.T.; Kiefer, F.W. Adipose tissue browning in mice and humans. J. Endocrinol. 2019, 241, R97–R109. [Google Scholar] [CrossRef] [PubMed]
- Vargas-Castillo, A.; Fuentes-Romero, R.; Rodriguez-Lopez, L.A.; Torres, N.; Tovar, A.R. Understanding the Biology of Thermogenic Fat: Is Browning A New Approach to the Treatment of Obesity? Arch. Med. Res. 2017, 48, 401–413. [Google Scholar] [CrossRef] [PubMed]
- Harms, M.; Seale, P. Brown and beige fat: Development, function and therapeutic potential. Nat. Med. 2013, 19, 1252–1263. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dasgupta, B.; Chhipa, R.R. Evolving lessons on the complex role of AMPK in normal physiology and cancer. Trends Pharmacol. Sci. 2016, 37, 192–206. [Google Scholar] [CrossRef] [Green Version]
- Yang, Q.; Liang, X.; Sun, X.; Zhang, L.; Fu, X.; Rogers, C.J.; Berim, A.; Zhang, S.; Wang, S.; Wang, B. AMPK/α-ketoglutarate axis dynamically mediates DNA demethylation in the Prdm16 promoter and brown adipogenesis. Cell Metab. 2016, 24, 542–554. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mottillo, E.P.; Desjardins, E.M.; Crane, J.D.; Smith, B.K.; Green, A.E.; Ducommun, S.; Henriksen, T.I.; Rebalka, I.A.; Razi, A.; Sakamoto, K.; et al. Lack of Adipocyte AMPK Exacerbates Insulin Resistance and Hepatic Steatosis through Brown and Beige Adipose Tissue Function. Cell Metab. 2016, 24, 118–129. [Google Scholar] [CrossRef] [Green Version]
- Liang, F.; Kume, S.; Koya, D. SIRT1 and insulin resistance. Nat. Rev. Endocrinol. 2009, 5, 367–373. [Google Scholar] [CrossRef]
- Boutant, M.; Joffraud, M.; Kulkarni, S.S.; García-Casarrubios, E.; García-Roves, P.M.; Ratajczak, J.; Fernández-Marcos, P.J.; Valverde, A.M.; Serrano, M.; Cantó, C. SIRT1 enhances glucose tolerance by potentiating brown adipose tissue function. Mol. Metab. 2015, 4, 118–131. [Google Scholar] [CrossRef] [Green Version]
- Qiang, L.; Wang, L.; Kon, N.; Zhao, W.; Lee, S.; Zhang, Y.; Rosenbaum, M.; Zhao, Y.; Gu, W.; Farmer, S.R.; et al. Brown Remodeling of White Adipose Tissue by SirT1-Dependent Deacetylation of Pparγ. Cell 2012, 150, 620–632. [Google Scholar] [CrossRef] [Green Version]
- Yuan, H.; Meng, L.; Wang, W.; Zhu, X. The effects of Sea buckthorn seed protein on glucose metabolism in streptozotocin-induced diabetic ICR mice. Pak. J. Pharm. Sci. 2019, 32, 2011–2017. [Google Scholar]
- Vancura, A.; Nagar, S.; Kaur, P.; Bu, P.; Bhagwat, M.; Vancurova, I. Reciprocal Regulation of AMPK/SNF1 and Protein Acetylation. Int. J. Mol. Sci. 2018, 19, 3314. [Google Scholar] [CrossRef] [PubMed] [Green Version]







| Gene | Forward | Reverse |
|---|---|---|
| Ucp1 | ACTGCCACACCTCCAGTCATT | CTTTGCCTCACTCAGGATTGG |
| Prdm16 | CTCGAATGGACAAACGGCCT | GGTACCCTGGCTTTGGACTC |
| Cox7α | CAGCGTCATGGTCAGTCTGT | AGAAAACCGTGTGGCAGAGA |
| Cidea | ATCACAACTGGCCTGGTTACG | TACTACCCGGTGTCCATTTCT |
| Pgc-1α | TGCAGCGGTCTTAGCACTC | GAGGAGTTAGGCCTGCAGTT |
| CD68 | TGTCTGATCTTGCTAGGACCG | GAGAGTAACGGCCTTTTTGTGA |
| TNF-α | GCCAACGGCATGGATCTCAA | TAGCAAATCGGCTGACGGTG |
| IL-1β | TCGCAGCAGCACATCAACAA | TCCACGGGAAAGACACAGGT |
| IL-6 | CCACTTCACAAGTCGGAGGC | TCTGCAAGTGCATCATCGTTGT |
| IL-4 | AGTGAGCTCGTCTGTAGGGC | CAGGCATCGAAAAGCCCGAA |
| IL-10 | TGGGTTGCCAAGCCTTATCG | TCAGCTTCTCACCCAGGGAA |
| IFN-γ | CTTCAGCAACAGCAAGGCGA | CATTGAATGCTTGGCGCTGG |
| MCP-1 | CCCCAAGAAGGAATGGGTCC | GGTTGTGGAAAAGGTAGTGG |
| β-tubulin | TGCCAGGATTAGCACCCTTG | TCGAACACCTGTTGGGTCAG |
| Catalog | Parameter | Chow | HFD | HFDSB |
|---|---|---|---|---|
| Serum | TG (mM)/L | 1.06 ± 0.12 | 1.26 ± 0.10 # | 0.59 ± 0.05 ** |
| TC (mM)/L | 5.32 ± 0.62 | 6.97 ± 1.10 # | 4.46 ± 0.29 ** | |
| HDL (mM)/L | 3.22 ± 0.24 | 2.87 ± 0.08 # | 3.30 ± 0.03 * | |
| LDL (mM)/L | 0.94 ± 0.13 | 1.95 ± 0.63 # | 1.04 ± 0.29 ** | |
| Liver | TG (mM/g) | 1.00 ± 0.11 | 2.90 ± 0.17 # | 1.33 ± 0.17 * |
| TC (mM/g) | 1.00 ± 0.02 | 1.58 ± 0.06 # | 0.65 ± 0.03 ** | |
| HDL (mM/g) | 1.92 ± 0.14 | 1.26 ± 0.02 # | 1.00 ± 0.10 * | |
| LDL (mM/g) | 1.00 ± 0.01 | 1.27 ± 0.11 # | 0.63 ± 0.01 * |
| Parameter | Chow | HFD | HFDSB |
|---|---|---|---|
| IL-6 (pg/mL) | 9.82 ± 2.31 | 48.82 ± 4.72 ## | 12.45 ± 3.08 ** |
| IL-10 (pg/mL) | 35.33 ± 3.03 | 48.25 ± 4.68 ## | 19.29 ± 2.53 ** |
| TNF-α (pg/mL) | 18.31 ± 2.56 | 60.19 ± 5.48 ## | 37.88 ± 2.75 ** |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Gao, X.; Chen, X.; Li, Q.; Li, X.; Zhao, J. Seabuckthorn Reverses High-Fat-Diet-Induced Obesity and Enhances Fat Browning via Activation of AMPK/SIRT1 Pathway. Nutrients 2022, 14, 2903. https://doi.org/10.3390/nu14142903
Wang Y, Gao X, Chen X, Li Q, Li X, Zhao J. Seabuckthorn Reverses High-Fat-Diet-Induced Obesity and Enhances Fat Browning via Activation of AMPK/SIRT1 Pathway. Nutrients. 2022; 14(14):2903. https://doi.org/10.3390/nu14142903
Chicago/Turabian StyleWang, Yu, Xuyang Gao, Xiaoyou Chen, Qiang Li, Xinrui Li, and Junxing Zhao. 2022. "Seabuckthorn Reverses High-Fat-Diet-Induced Obesity and Enhances Fat Browning via Activation of AMPK/SIRT1 Pathway" Nutrients 14, no. 14: 2903. https://doi.org/10.3390/nu14142903
APA StyleWang, Y., Gao, X., Chen, X., Li, Q., Li, X., & Zhao, J. (2022). Seabuckthorn Reverses High-Fat-Diet-Induced Obesity and Enhances Fat Browning via Activation of AMPK/SIRT1 Pathway. Nutrients, 14(14), 2903. https://doi.org/10.3390/nu14142903
