Differential Effects of Short-Chain Fatty Acids on L6 Myotube Inflammatory Mediator Production in Response to Lipopolysaccharide- or Palmitic Acid-Stimulation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Differentiation
2.2. L6 Myotube Experimental Conditions
2.3. RNA Isolation and PCR Analysis
2.4. Intracellular and Secreted Protein Analysis
2.5. Statistical Analysis
3. Results
3.1. Effect of SCFA on Inflammatory Mediator Expression and Secretion in LPS-Stimulated L6 Myotubes
3.2. Effect of SCFA on Inflammatory Mediator Expression and Secretion in PA-Stimulated L6 Myotubes
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Tremaroli, V.; Bäckhed, F. Functional interactions between the gut microbiota and host metabolism. Nature 2012, 489, 242–249. [Google Scholar] [CrossRef] [PubMed]
- Morrison, D.J.; Preston, T. Formation of short chain fatty acids by the gut microbiota and their impact on human metabolism. Gut Microbes 2016, 7, 189–200. [Google Scholar] [CrossRef] [Green Version]
- Roy, C.C.; Kien, C.L.; Bouthillier, L.; Levy, E. Short-chain fatty acids: Ready for prime time? Nutr. Clin. Pract. 2006, 21, 351–366. [Google Scholar] [CrossRef] [PubMed]
- Ganapathy, V.; Thangaraju, M.; Prasad, P.D.; Martin, P.M.; Singh, N. Transporters and receptors for short-chain fatty acids as the molecular link between colonic bacteria and the host. Curr. Opin. Pharmacol. 2013, 13, 869–874. [Google Scholar] [CrossRef] [PubMed]
- Louis, P.; Flint, H.J. Diversity, metabolism and microbial ecology of butyrate-producing bacteria from the human large intestine. FEMS Microbiol. Lett. 2009, 294, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Wong, J.M.; de Souza, R.; Kendall, C.W.; Emam, A.; Jenkins, D.J. Colonic health: Fermentation and short chain fatty acids. J. Clin. Gastroenterol. 2006, 40, 235–243. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Wichienchot, S.; He, X.; Fu, X.; Huang, Q. In vitro colonic fermentation of dietary fibers: Fermentation rate, short-chain fatty acid production and changes in microbiota. Trends Food Sci. Technol. 2019, 88, 1–9. [Google Scholar] [CrossRef]
- Chen, T.; Kim, C.Y.; Kaur, A.; Lamothe, L.; Shaikh, M.; Keshavarzian, A.; Hamaker, B.R. Dietary fibre-based SCFA mixtures promote both protection and repair of intestinal epithelial barrier function in a Caco-2 cell model. Food Funct. 2017, 8, 1166–1173. [Google Scholar] [CrossRef]
- Kaur, A.; Rose, D.J.; Rumpagaporn, P.; Patterson, J.A.; Hamaker, B.R. In vitro batch fecal fermentation comparison of gas and short-chain fatty acid production using “slowly fermentable” dietary fibers. J. Food Sci. 2011, 76, H137–H142. [Google Scholar] [CrossRef]
- Karimi, R.; Azizi, A.H.; Sahari, M.A.; Kazem, A.E. In vitro fermentation profile of soluble dietary fibers obtained by different enzymatic extractions from barley bran. Bioact. Carbohydr. Diet. Fibre 2020, 21, 100205. [Google Scholar] [CrossRef]
- Neis, E.P.; van Eijk, H.M.; Lenaerts, K.; Olde Damink, S.W.; Blaak, E.E.; Dejong, C.H.; Rensen, S.S. Distal versus proximal intestinal short-chain fatty acid release in man. Gut 2019, 68, 764–765. [Google Scholar] [CrossRef] [PubMed]
- Sowah, S.A.; Hirche, F.; Milanese, A.; Johnson, T.S.; Grafetstätter, M.; Schübel, R.; Kirsten, R.; Ulrich, C.M.; Kaaks, R.; Zeller, G.; et al. Changes in Plasma Short-Chain Fatty Acid Levels after Dietary Weight Loss Among Overweight and Obese Adults over 50 Weeks. Nutrients 2020, 12, 452. [Google Scholar] [CrossRef] [Green Version]
- Cummings, J.H.; Pomare, E.W.; Branch, W.J.; Naylor, C.P.; Macfarlane, G.T. Short chain fatty acids in human large intestine, portal, hepatic and venous blood. Gut 1987, 28, 1221–1227. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rahat-Rozenbloom, S.; Fernandes, J.; Cheng, J.; Gloor, G.B.; Wolever, T.M. The acute effects of inulin and resistant starch on postprandial serum short-chain fatty acids and second-meal glycemic response in lean and overweight humans. Eur. J. Clin. Nutr. 2017, 71, 227–233. [Google Scholar] [CrossRef] [Green Version]
- Mueller, N.T.; Zhang, M.; Juraschek, S.P.; Miller, E.R.; Appel, L.J. Effects of high-fiber diets enriched with carbohydrate, protein, or unsaturated fat on circulating short chain fatty acids: Results from the OmniHeart randomized trial. Am. J. Clin. Nutr. 2020, 111, 545–554. [Google Scholar] [CrossRef] [PubMed]
- Bloemen, J.G.; Venema, K.; van de Poll, M.C.; Olde Damink, S.W.; Buurman, W.A.; Dejong, C.H. Short chain fatty acids exchange across the gut and liver in humans measured at surgery. Clin. Nutr. 2009, 28, 657–661. [Google Scholar] [CrossRef]
- Canfora, E.E.; Jocken, J.W.; Blaak, E.E. Short-chain fatty acids in control of body weight and insulin sensitivity. Nat. Rev. Endocrinol. 2015, 11, 577–591. [Google Scholar] [CrossRef]
- Mandaliya, D.K.; Seshadri, S. Short Chain Fatty Acids, pancreatic dysfunction and type 2 diabetes. Pancreatology 2019, 19, 280–284. [Google Scholar] [CrossRef]
- Frampton, J.; Murphy, K.G.; Frost, G.; Chambers, E.S. Short-chain fatty acids as potential regulators of skeletal muscle metabolism and function. Nat. Metab. 2020, 2, 840–848. [Google Scholar] [CrossRef]
- Zurlo, F.; Larson, K.; Bogardus, C.; Ravussin, E. Skeletal muscle metabolism is a major determinant of resting energy expenditure. J. Clin. Investig. 1990, 86, 1423–1427. [Google Scholar] [CrossRef] [Green Version]
- Frontera, W.R.; Ochala, J. Skeletal muscle: A brief review of structure and function. Calcif. Tissue Int. 2015, 96, 183–195. [Google Scholar] [CrossRef]
- Yamashita, H.; Fujisawa, K.; Ito, E.; Idei, S.; Kawaguchi, N.; Kimoto, M.; Hiemori, M.; Tsuji, H. Improvement of obesity and glucose tolerance by acetate in Type 2 diabetic Otsuka Long-Evans Tokushima Fatty (OLETF) rats. Biosci. Biotechnol. Biochem. 2007, 71, 1236–1243. [Google Scholar] [CrossRef] [PubMed]
- Yamashita, H.; Maruta, H.; Jozuka, M.; Kimura, R.; Iwabuchi, H.; Yamato, M.; Saito, T.; Fujisawa, K.; Takahashi, Y.; Kimoto, M.; et al. Effects of acetate on lipid metabolism in muscles and adipose tissues of type 2 diabetic Otsuka Long-Evans Tokushima Fatty (OLETF) rats. Biosci. Biotechnol. Biochem. 2009, 73, 570–576. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maruta, H.; Yoshimura, Y.; Araki, A.; Kimoto, M.; Takahashi, Y.; Yamashita, H. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells. PLoS ONE 2016, 11, e0158055. [Google Scholar] [CrossRef] [Green Version]
- Maruta, H.; Yamashita, H. Acetic acid stimulates G-protein-coupled receptor GPR43 and induces intracellular calcium influx in L6 myotube cells. PLoS ONE 2020, 15, e0239428. [Google Scholar] [CrossRef] [PubMed]
- Han, J.H.; Kim, I.S.; Jung, S.H.; Lee, S.G.; Son, H.Y.; Myung, C.S. The effects of propionate and valerate on insulin responsiveness for glucose uptake in 3T3-L1 adipocytes and C2C12 myotubes via G protein-coupled receptor 41. PLoS ONE 2014, 9, e95268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chriett, S.; Zerzaihi, O.; Vidal, H.; Pirola, L. The histone deacetylase inhibitor sodium butyrate improves insulin signalling in palmitate-induced insulin resistance in L6 rat muscle cells through epigenetically-mediated up-regulation of Irs1. Mol. Cell Endocrinol. 2017, 439, 224–232. [Google Scholar] [CrossRef]
- Gao, Z.; Yin, J.; Zhang, J.; Ward, R.E.; Martin, R.J.; Lefevre, M.; Cefalu, W.T.; Ye, J. Butyrate improves insulin sensitivity and increases energy expenditure in mice. Diabetes 2009, 58, 1509–1517. [Google Scholar] [CrossRef] [Green Version]
- Hong, J.; Jia, Y.; Pan, S.; Jia, L.; Li, H.; Han, Z.; Cai, D.; Zhao, R. Butyrate alleviates high fat diet-induced obesity through activation of adiponectin-mediated pathway and stimulation of mitochondrial function in the skeletal muscle of mice. Oncotarget 2016, 7, 56071–56082. [Google Scholar] [CrossRef] [Green Version]
- Walsh, M.E.; Bhattacharya, A.; Sataranatarajan, K.; Qaisar, R.; Sloane, L.; Rahman, M.M.; Kinter, M.; Van Remmen, H. The histone deacetylase inhibitor butyrate improves metabolism and reduces muscle atrophy during aging. Aging Cell 2015, 14, 957–970. [Google Scholar] [CrossRef]
- Liu, L.; Fu, C.; Li, F. Acetate Affects the Process of Lipid Metabolism in Rabbit Liver, Skeletal Muscle and Adipose Tissue. Animals 2019, 9, 799. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, H.; Ballantyne, C.M. Skeletal muscle inflammation and insulin resistance in obesity. J. Clin. Investig. 2017, 127, 43–54. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; van Esch, B.C.A.M.; Wagenaar, G.T.M.; Garssen, J.; Folkerts, G.; Henricks, P.A.J. Pro- and anti-inflammatory effects of short chain fatty acids on immune and endothelial cells. Eur. J. Pharmacol. 2018, 831, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Mathew, O.P.; Ranganna, K.; Milton, S.G. Involvement of the Antioxidant Effect and Anti-inflammatory Response in Butyrate-Inhibited Vascular Smooth Muscle Cell Proliferation. Pharmaceuticals 2014, 7, 1008–1027. [Google Scholar] [CrossRef]
- Samokhvalov, V.; Bilan, P.J.; Schertzer, J.D.; Antonescu, C.N.; Klip, A. Palmitate- and lipopolysaccharide-activated macrophages evoke contrasting insulin responses in muscle cells. Am. J. Physiol. Endocrinol. Metab. 2009, 296, E37–E46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Creely, S.J.; McTernan, P.G.; Kusminski, C.M.; Fisher, f.; Da Silva, N.F.; Khanolkar, M.; Evans, M.; Harte, A.L.; Kumar, S. Lipopolysaccharide activates an innate immune system response in human adipose tissue in obesity and type 2 diabetes. Am. J. Physiol. Endocrinol. Metab. 2007, 292, E740–E747. [Google Scholar] [CrossRef] [Green Version]
- Cani, P.D.; Amar, J.; Iglesias, M.A.; Poggi, M.; Knauf, C.; Bastelica, D.; Neyrinck, A.M.; Fava, F.; Tuohy, K.M.; Chabo, C.; et al. Metabolic endotoxemia initiates obesity and insulin resistance. Diabetes 2007, 56, 1761–1772. [Google Scholar] [CrossRef] [Green Version]
- Laugerette, F.; Furet, J.P.; Debard, C.; Daira, P.; Loizon, E.; Géloën, A.; Soulage, C.O.; Simonet, C.; Lefils-Lacourtablaise, J.; Bernoud-Hubac, N.; et al. Oil composition of high-fat diet affects metabolic inflammation differently in connection with endotoxin receptors in mice. Am. J. Physiol. Endocrinol. Metab. 2012, 302, E374–E386. [Google Scholar] [CrossRef] [Green Version]
- Sawada, K.; Kawabata, K.; Yamashita, T.; Kawasaki, K.; Yamamoto, N.; Ashida, H. Ameliorative effects of polyunsaturated fatty acids against palmitic acid-induced insulin resistance in L6 skeletal muscle cells. Lipids Health Dis. 2012, 11, 36. [Google Scholar] [CrossRef] [Green Version]
- Sergi, D.; Luscombe-Marsh, N.; Naumovski, N.; Abeywardena, M.; O’Callaghan, N. Palmitic Acid, but Not Lauric Acid, Induces Metabolic Inflammation, Mitochondrial Fragmentation, and a Drop in Mitochondrial Membrane Potential in Human Primary Myotubes. Front. Nutr. 2021, 8, 663838. [Google Scholar] [CrossRef]
- De Boer, A.A.; Monk, J.M.; Robinson, L.E. Docosahexaenoic acid decreases pro-inflammatory mediators in an in vitro murine adipocyte macrophage co-culture model. PLoS ONE 2014, 9, e85037. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vinolo, M.A.; Rodrigues, H.G.; Hatanaka, E.; Sato, F.T.; Sampaio, S.C.; Curi, R. Suppressive effect of short-chain fatty acids on production of proinflammatory mediators by neutrophils. J. Nutr. Biochem. 2011, 22, 849–855. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Deng, M.; Lu, A.; Chen, Y.; Wu, C.; Tan, Z.; Boini, K.M.; Yang, T.; Zhu, Q.; Wang, L. Sodium butyrate attenuates angiotensin II-induced cardiac hypertrophy by inhibiting COX2/PGE2 pathway via a HDAC5/HDAC6-dependent mechanism. J. Cell Mol. Med. 2019, 23, 8139–8150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mathew, O.P.; Ranganna, K.; Mathew, J.; Zhu, M.; Yousefipour, Z.; Selvam, C.; Milton, S.G. Cellular Effects of Butyrate on Vascular Smooth Muscle Cells are Mediated through Disparate Actions on Dual Targets, Histone Deacetylase (HDAC) Activity and PI3K/Akt Signaling Network. Int. J. Mol. Sci. 2019, 20, 2902. [Google Scholar] [CrossRef] [Green Version]
- Ranganna, K.; Yatsu, F.M.; Hayes, B.E.; Milton, S.G.; Jayakumar, A. Butyrate inhibits proliferation-induced proliferating cell nuclear antigen expression (PCNA) in rat vascular smooth muscle cells. Mol. Cell Biochem. 2000, 205, 149–161. [Google Scholar] [CrossRef]
- Mathew, O.P.; Ranganna, K.; Yatsu, F.M. Butyrate, an HDAC inhibitor, stimulates interplay between different posttranslational modifications of histone H3 and differently alters G1-specific cell cycle proteins in vascular smooth muscle cells. Biomed. Pharmacother. 2010, 64, 733–740. [Google Scholar] [CrossRef] [Green Version]
- Feng, P.; Ge, L.; Akyhani, N.; Liau, G. Sodium butyrate is a potent modulator of smooth muscle cell proliferation and gene expression. Cell Prolif. 1996, 29, 231–241. [Google Scholar] [CrossRef]
- Korbecki, J.; Bajdak-Rusinek, K. The effect of palmitic acid on inflammatory response in macrophages: An overview of molecular mechanisms. Inflamm. Res. 2019, 68, 915–932. [Google Scholar] [CrossRef] [Green Version]
- Radin, M.S.; Sinha, S.; Bhatt, B.A.; Dedousis, N.; O’Doherty, R.M. Inhibition or deletion of the lipopolysaccharide receptor Toll-like receptor-4 confers partial protection against lipid-induced insulin resistance in rodent skeletal muscle. Diabetologia 2008, 51, 336–346. [Google Scholar] [CrossRef] [Green Version]
- Greenberg, A.S.; McDaniel, M.L. Identifying the links between obesity, insulin resistance and beta-cell function: Potential role of adipocyte-derived cytokines in the pathogenesis of type 2 diabetes. Eur. J. Clin. Investig. 2002, 32 (Suppl. S3), 24–34. [Google Scholar] [CrossRef]
- Panee, J. Monocyte Chemoattractant Protein 1 (MCP-1) in obesity and diabetes. Cytokine 2012, 60, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, Z.; Hwang, D.; Bataille, F.; Lefevre, M.; York, D.; Quon, M.J.; Ye, J. Serine phosphorylation of insulin receptor substrate 1 by inhibitor kappa B kinase complex. J. Biol. Chem. 2002, 277, 48115–48121. [Google Scholar] [CrossRef] [Green Version]
- Balic, J.J.; Albargy, H.; Luu, K.; Kirby, F.J.; Jayasekara, W.S.N.; Mansell, F.; Garama, D.J.; De Nardo, D.; Baschuk, N.; Louis, C.; et al. STAT3 serine phosphorylation is required for TLR4 metabolic reprogramming and IL-1β expression. Nat. Commun. 2020, 11, 3816. [Google Scholar] [CrossRef]
- Mashili, F.; Chibalin, A.V.; Krook, A.; Zierath, J.R. Constitutive STAT3 phosphorylation contributes to skeletal muscle insulin resistance in type 2 diabetes. Diabetes 2013, 62, 457–465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koh, A.; De Vadder, F.; Kovatcheva-Datchary, P.; Bäckhed, F. From Dietary Fiber to Host Physiology: Short-Chain Fatty Acids as Key Bacterial Metabolites. Cell 2016, 165, 1332–1345. [Google Scholar] [CrossRef] [Green Version]
- Elamin, E.; Jonkers, D.; Juuti-Uusitalo, K.; van Ijzendoorn, S.; Troost, F.; Duimel, H.; Broers, J.; Verheyen, F.; Dekker, J.; Masclee, A. Effects of ethanol and acetaldehyde on tight junction integrity: In vitro study in a three dimensional intestinal epithelial cell culture model. PLoS ONE 2012, 7, e35008. [Google Scholar] [CrossRef] [Green Version]
- D’Souza, W.N.; Douangpanya, J.; Mu, S.; Jaeckel, P.; Zhang, M.; Maxwell, J.R.; Rottman, J.B.; Labitzke, K.; Willee, A.; Beckmann, H.; et al. Differing roles for short chain fatty acids and GPR43 agonism in the regulation of intestinal barrier function and immune responses. PLoS ONE 2017, 12, e0180190. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, T.; Yoshida, S.; Hara, H. Physiological concentrations of short-chain fatty acids immediately suppress colonic epithelial permeability. Br. J. Nutr. 2008, 100, 297–305. [Google Scholar] [CrossRef] [Green Version]
- Peng, L.; Li, Z.R.; Green, R.S.; Holzman, I.R.; Lin, J. Butyrate enhances the intestinal barrier by facilitating tight junction assembly via activation of AMP-activated protein kinase in Caco-2 cell monolayers. J. Nutr. 2009, 139, 1619–1625. [Google Scholar] [CrossRef]
- Mariadason, J.M.; Barkla, D.H.; Gibson, P.R. Effect of short-chain fatty acids on paracellular permeability in Caco-2 intestinal epithelium model. Am. J. Physiol. 1997, 272, G705–G712. [Google Scholar] [CrossRef]
- Wang, H.B.; Wang, P.Y.; Wang, X.; Wan, Y.L.; Liu, Y.C. Butyrate enhances intestinal epithelial barrier function via up-regulation of tight junction protein Claudin-1 transcription. Dig. Dis. Sci. 2012, 57, 3126–3135. [Google Scholar] [CrossRef] [PubMed]
- Feng, Y.; Wang, Y.; Wang, P.; Huang, Y.; Wang, F. Short-Chain Fatty Acids Manifest Stimulative and Protective Effects on Intestinal Barrier Function Through the Inhibition of NLRP3 Inflammasome and Autophagy. Cell Physiol. Biochem. 2018, 49, 190–205. [Google Scholar] [CrossRef] [PubMed]
- Elamin, E.E.; Masclee, A.A.; Dekker, J.; Pieters, H.J.; Jonkers, D.M. Short-chain fatty acids activate AMP-activated protein kinase and ameliorate ethanol-induced intestinal barrier dysfunction in Caco-2 cell monolayers. J. Nutr. 2013, 143, 1872–1881. [Google Scholar] [CrossRef] [PubMed] [Green Version]








| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| β-actin | accgagcatggctacagcgtcacc | gtggccatctcttgctcggagtct |
| Il-6 | cccttcaggaacagctatgaa | acaacatcagtcccaagaagg |
| Mcp-1 | cgtgctgtctcagccagat | ggatcatcttgccagtgaatg |
| Tnfα | gcccagaccctcacactc | ccactccagctgctcctct |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martin, J.L.A.; Cartwright, N.M.; Hutchinson, A.L.; Robinson, L.E.; Ma, D.W.L.; Monk, J.M. Differential Effects of Short-Chain Fatty Acids on L6 Myotube Inflammatory Mediator Production in Response to Lipopolysaccharide- or Palmitic Acid-Stimulation. Nutrients 2022, 14, 2826. https://doi.org/10.3390/nu14142826
Martin JLA, Cartwright NM, Hutchinson AL, Robinson LE, Ma DWL, Monk JM. Differential Effects of Short-Chain Fatty Acids on L6 Myotube Inflammatory Mediator Production in Response to Lipopolysaccharide- or Palmitic Acid-Stimulation. Nutrients. 2022; 14(14):2826. https://doi.org/10.3390/nu14142826
Chicago/Turabian StyleMartin, Jamie L. A., Nadia M. Cartwright, Amber L. Hutchinson, Lindsay E. Robinson, David W. L. Ma, and Jennifer M. Monk. 2022. "Differential Effects of Short-Chain Fatty Acids on L6 Myotube Inflammatory Mediator Production in Response to Lipopolysaccharide- or Palmitic Acid-Stimulation" Nutrients 14, no. 14: 2826. https://doi.org/10.3390/nu14142826
APA StyleMartin, J. L. A., Cartwright, N. M., Hutchinson, A. L., Robinson, L. E., Ma, D. W. L., & Monk, J. M. (2022). Differential Effects of Short-Chain Fatty Acids on L6 Myotube Inflammatory Mediator Production in Response to Lipopolysaccharide- or Palmitic Acid-Stimulation. Nutrients, 14(14), 2826. https://doi.org/10.3390/nu14142826

