Next Article in Journal
Examining the Prevalence, Nutritional Quality and Marketing of Foods with Voluntary Nutrient Additions in the Canadian Food Supply
Next Article in Special Issue
Could Vitamin D Be Effective in Prevention of Preeclampsia?
Previous Article in Journal
Partially Hydrolysed Whey-Based Infant Formula Improves Skin Barrier Function
Previous Article in Special Issue
Plasma 25(OH)D Concentrations and Gestational Diabetes Mellitus among Pregnant Women in Taiwan
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Nutrients
Volume 13
Issue 9
10.3390/nu13093114
nutrients-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cord Serum Calcitriol Inversely Correlates with Maternal Blood Pressure in Urinary Tract Infection-Affected Pregnancies: Sex-Dependent Immune Implications

by
Andrea Olmos-Ortiz
1,2,†,
Alberto Olivares-Huerta
1,†,
Janice García-Quiroz
1,
Euclides Avila
1,
Ali Halhali
1,
Braulio Quesada-Reyna
3,
Fernando Larrea
1,
Verónica Zaga-Clavellina
4,* and
Lorenza Díaz
1,*
1
Departamento de Biología de la Reproducción “Dr. Carlos Gual Castro”, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán, Av. Vasco de Quiroga No. 15, Belisario Domínguez Sección XVI, Tlalpan, Ciudad de Mexico 14080, Mexico
2
Departamento de Inmunobioquímica, Instituto Nacional de Perinatología Isidro Espinosa de los Reyes, Montes Urales 800, Lomas-Virreyes, Lomas de Chapultepec IV Sección, Miguel Hidalgo, Ciudad de Mexico 11000, Mexico
3
División de Obstetricia, UMAE Hospital de Gineco-Obstetricia No. 4 “Luis Castelazo Ayala”, IMSS, Rio de la Magdalena 289, Tizapán San Ángel, Progreso Tizapán, Álvaro Obregón, Ciudad de Mexico 01090, Mexico
4
Departamento de Fisiología y Desarrollo Celular, Instituto Nacional de Perinatología Isidro Espinosa de los Reyes, Montes Urales 800, Lomas-Virreyes, Lomas de Chapultepec IV Sección, Miguel Hidalgo, Ciudad de Mexico 11000, Mexico
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Nutrients 2021, 13(9), 3114; https://doi.org/10.3390/nu13093114
Submission received: 19 August 2021 / Revised: 30 August 2021 / Accepted: 2 September 2021 / Published: 4 September 2021
(This article belongs to the Special Issue Role of Vitamin D Deficiency in Pregnancy Disorders)
Browse Figures
Versions Notes

Abstract

:
Urinary tract infections (UTI) during pregnancy are frequently associated with hypertensive disorders, increasing the risk of perinatal morbidity. Calcitriol, vitamin D3’s most active metabolite, has been involved in blood pressure regulation and prevention of UTIs, partially through modulating vasoactive peptides and antimicrobial peptides, like cathelicidin. However, nothing is known regarding the interplay between placental calcitriol, cathelicidin, and maternal blood pressure in UTI-complicated pregnancies. Here, we analyzed the correlation between these parameters in pregnant women with UTI and with normal pregnancy (NP). Umbilical venous serum calcitriol and its precursor calcidiol were significantly elevated in UTI. Regardless of newborn’s sex, we found strong negative correlations between calcitriol and maternal systolic and diastolic blood pressure in the UTI cohort (p < 0.002). In NP, this relationship was observed only in female-carrying mothers. UTI-female placentas showed higher expression of cathelicidin and CYP27B1, the calcitriol activating-enzyme, compared to male and NP samples. Accordingly, cord-serum calcitriol from UTI-female neonates negatively correlated with maternal bacteriuria. Cathelicidin gene expression positively correlated with gestational age in UTI and with newborn anthropometric parameters. Our results suggest that vitamin D deficiency might predispose to maternal cardiovascular risk and perinatal infections especially in male-carrying pregnancies, probably due to lower placental CYP27B1 and cathelicidin expression.

Graphical Abstract

1. Introduction

During pregnancy, maternal cardiovascular and renal physiology undergo profound changes to favor adequate perfusion of the uteroplacental unit. These changes include increased cardiac output, stroke volume, blood volume, and heart rate as well as the increment in the circulation of molecules that rise blood pressure and body-fluid volume, such as renin and angiotensin (ANG) II, which are components of the renin-angiotensin system (RAS) [1,2]. Despite these changes and RAS activation throughout normal pregnancies, systolic and diastolic blood pressure (SBP, DBP) are significantly decreased compared to non-pregnant values. At the same time, peripheral vascular resistance is reduced [3,4]. The latter is partially explained by the concomitant increase in peripheral vasodilator levels in maternal serum, such as prostacyclin, progesterone, and ANG 1–7 [1,4,5,6,7]. The placenta is a major site of production of these and other vasoactive factors, contributing in this manner to systemic and uteroplacental hemodynamics. Disruption or dysregulation of the mechanisms involved in these processes may result in gestational hypertensive disorders, including preeclampsia, as shown when an excessive secretion of renin from placental origin is released into the maternal circulation [8,9]. Calcitriol is another important placental factor that spills into the maternal circulation and modulates feto-maternal physiology [10,11,12]. Calcitriol is the hormonal form and most active metabolite of vitamin D3 (VD), produced from its precursor calcidiol via the hydroxylating activity of CYP27B1, an enzyme expressed in placenta and kidney. Substantial evidence has implicated calcitriol in blood pressure regulation [13,14,15,16]. Accordingly, low VD levels in serum of pregnant women have been associated with higher risk of preeclampsia and other hypertensive disorders [17,18]. At the same time, VD supplementation is known to decrease the incidence of these pathologies [19]. Many mechanisms are thought to be involved in these processes, including the potent anti-inflammatory effect of calcitriol as well as its ability to repress renin transcription, preventing in this manner ANG II accumulation and the consequent rise in blood pressure [13,20,21].
On the other hand, several studies have associated VD-deficiency with increased odds of urinary tract infections (UTI) [22,23,24], highlighting hypovitaminosis D as a potential modifiable risk factor for bacterial vaginosis among the general population including pregnant women, and emphasizing VD supplementation as a prevention strategy for UTIs [25,26]. This epidemiological data reflect the ability of calcitriol to exert microbicidal activity, which is achieved by transcriptionally inducing antimicrobial peptides expression. Among these peptides, urinary and plasma cathelicidin levels are notably increased among UTI-affected patients [27]. Cathelicidin may be produced by immune cells, epithelial cells of the urothelium, as well as by the human placenta, where it is readily stimulated by calcitriol [28,29], conferring this hormone a major role in innate defense enhancement. Indeed, cathelicidin is involved in the protection of the urinary tract and the fetoplacental unit against bacterial infections [30,31,32]. Of particular importance is the existing evidence linking infections to the development of hypertension in pregnancy [33,34,35,36]. Regarding UTI, it has an estimated incidence of 20% during gestation and has been linked to a higher risk of preeclampsia, probably through increasing the inflammatory response and/or blood pressure [37]. Accordingly, treatment of bacteriuria in pregnancy is known to significantly reduce the incidence of hypertensive pathologies [33], corroborating a connection between infection and hypertension.
Considering all of the above, we aimed to investigate whether there is an association between the placental production of calcitriol (as reflected by its concentration in venous cord serum) and maternal blood pressure in control pregnancies and those affected with UTI. In addition, given the beneficial role of cathelicidin in fighting UTI, we studied its relationship with newborn anthropometric parameters and gestational age as markers of neonatal outcome. Finally, since existing data has shown sexual dimorphism in placental VD metabolism and cathelicidin production [38], we analyzed our results considering the neonate sex.

2. Materials and Methods

The following parameters and their associations were evaluated: (1) the concentration of calcidiol and calcitriol in umbilical serum; (2) placental tissue gene expression of cathelicidin and CYP27B1; and (3) clinical and anthropometric parameters of mothers and their newborns.

2.1. Subjects and Study Design

This was a cross-sectional study including pregnant women with a diagnosis of UTI (n = 48) at the time of delivery (UTI group) or with a normoevolutive pregnancy (NP group, n = 44), who delivered a single neonate vaginally or by cesarean section. The participants were in good health prior to the inclusion in this study, as determined by routine clinical examination throughout early-mid pregnancy, and were selected during admission to the maternal facility. Women with hormonal treatment or cases with newborn or placental abnormalities were excluded. The NP-group did not present inflammatory or infectious diseases, as corroborated by negative urine culture and/or urinalysis, absence of proteinuria, or UTI symptoms. The UTI-group was integrated by patients with symptomatic UTI, as defined by the presence of dysuria and high frequency and urgency of urination; urine test strip positive for leukocytes, nitrites, and alkaline pH; and/or urinalysis suggestive of positive infection (bacteriuria). In this group, women treated with an antibiotic for UTI were included. Arterial pressure in normal ranges was an inclusion criterion for both groups given that established hypertension could act as a confounding factor in our study. Considering the neonate’s sex, the following subgroups were formed: NP-females (n = 24), NP-males (n = 20), UTI-females (n = 22), and UTI-males (n = 26). In some instances, not all samples could be evaluated for all parameters due to losses during processing.

2.2. Sample Collection and Quantification of VD-Metabolites in Cord Serum

After delivery, a piece of tissue was collected from the central part of the placenta and preserved in RNAlater (Sigma-Aldrich, St. Louis, MO, USA) for gene expression studies. In addition, approximately 15 mL of cord blood were withdrawn exclusively from the umbilical vein after clamping. This sample was centrifuged at 3000 rpm for 10 min at 4 °C and stored in the dark at −70 °C until analysis.
The concentration of serum calcidiol and calcitriol in each sample was analyzed by a quantitative chemiluminescent immunoassay in the LIAISON platform (Liaison XL, DiaSorin Inc., Stillwater, MN, USA) at the central laboratory of the Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán.

2.3. Real Time PCR Amplifications

Placental tissue was homogenized in the presence of Trizol (Life Technologies, Carlsbad, CA, USA) using ceramic beads and the MagNA Lyser benchtop device (Roche Diagnostics Corp., Basel, Switzerland). RNA extraction from placental homogenates continued as indicated by the manufacturer. We used 2 µg of RNA for reverse-transcription, using the Maxima First Strand Kit (ThermoFisher Scientific, Pittsburgh, PA, USA). The obtained cDNA was amplified using the Master Mix on the LightCycler 480 (Roche), following standard cycling conditions. Results were normalized against the gene expression of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Sense and antisense oligonucleotides were: for cathelicidin (NM_004345.3), tcggatgctaacctctaccg/gtctgggtccccatccat; for GAPDH (NM_002046.3), agccacatcgctcagacac/gcccaatacgaccaaatcc; and for CYP27B1 (NM_000785.2), cttgcggactgctcactg/cgcagactacgttgttcagg. Hydrolysis probes used for cathelicidin, GAPDH, and CYP27B1 were number 85, 60, and 63, respectively, from the Roche Probe Library.

2.4. Statistical Analysis

Two-way analysis of variance (ANOVA) was used to calculate and compare least-square means and to identify interactions between condition (UTI) and neonate sex. Correlation analyses were carried out using Spearman’s rank correlation. p values < 0.05 were considered statistically significant. Analyses were performed using SigmaPlot package (SigmaPlot, RRID:SCR_003210).

3. Results

The clinical characteristics of mothers and their neonates are summarized in Table 1. In the UTI cohort, the newborn anthropometric parameters, Apgar scores, and gestational age at delivery were all significantly reduced as compared to NP. Bacteriuria was confirmed in UTI samples. Blood pressure and body mass index (BMI) did not significantly differ among groups (Table 1).

3.1. The Umbilical Cord Serum Concentrations of VD-Metabolites Were Significantly Higher in UTI Samples

The concentration of calcidiol and calcitriol in the umbilical vein serum was significantly elevated in UTI as compared to NP groups (Figure 1A,B). Although the concentration of both VD-metabolites was higher in UTI-female samples than in UTI-males (calcidiol: 19.8 ± 1.3 ng/mL vs. 17.85 ± 1.1 ng/mL, respectively; calcitriol: 65.6 ± 4.0 pg/mL vs. 58.0 ± 3.3 pg/mL, respectively), these differences did not reach statistical significance. Notably, considering the cut-offs in VD status according to the Endocrine Society [39], calcidiol levels in both the NP group (13.8 ng/mL) and the UTI group (18.8 ng/mL) must be considered as VD-deficient (<20 ng/mL).

3.2. Comparative Studies of Placental Cathelicidin and CYP27B1 mRNA Expression

CYP27B1 gene expression was found significantly more elevated in UTI-female placentas in comparison to males from the same condition: 1.18 ± 0.21 vs. 0.60 ± 0.21, respectively (least-square means ± SEM × 10−6, p = 0.03, Student’s t-test). No difference in CYP27B1 gene expression was found in NP sub-groups (data not shown). Likewise, placentas associated with female neonates from UTI-affected pregnancies had higher cathelicidin gene expression compared to UTI-males (p < 0.05, Figure 2). Interestingly, the presence of UTI significantly elevated placental cathelicidin gene expression as compared to NP, but only in placentas obtained from female neonates. A statistically significant interaction between neonate sex and clinical condition was found (p = 0.006), suggesting that the sexually dimorphic difference in this trait depended on the presence of maternal infection.

3.3. Correlation Studies between Expression of Placental Factors, Cord Serum VD-Metabolites, and Newborn/Maternal Parameters

In the UTI group, higher calcitriol levels in cord blood negatively correlated with maternal SBP and DBP (r = −0.57, p < 0.001 and r = −0.51, p = 0.002, respectively, Figure 3A,B). When analyzing by neonate sex, this inverse correlation was also highly significant in both male and female subgroups in the UTI condition (Table 2). Interestingly, in the NP control group, this negative association of calcitriol was observed only with SBP and only in the NP-female subgroup (r = −0.511, p = 0.03). Regarding calcidiol, no significant associations were found with blood pressure; however, a similar trend with borderline significance was found between calcidiol and DBP in the UTI-male subgroup (r = −0.431, p = 0.056).
Other significant associations found among studied parameters include the positive correlation between calcidiol and calcitriol in the UTI and NP groups (Figure 4A,B, Table 2), which was to be expected since calcidiol is the precursor of calcitriol. When analyzing by neonate sex, this relationship was observed only in the UTI-male subgroup, where calcitriol and calcidiol strongly correlated with high statistical significance (r = 0.703, p < 0.001).
Notably, cord calcitriol negatively correlated with maternal bacteriuria but only in the UTI-female subgroup (r = −0.636, p = 0.01), while cathelicidin placental gene expression was positively associated with gestational age at delivery in both UTI-male and UTI-female subgroups as well as with some neonate anthropometric parameters (Table 2). On the other hand, and as expected, SBP and DBP as well as neonate anthropometric parameters, such as weight, length, and cephalic perimeter, highly correlated between them (Table 2). Intriguingly, SBP positively correlated with BMI in NP and UTI subgroups only if the neonate was female (Table 2).

4. Discussion

Even though hypertension in pregnancy is one of the leading causes of maternal mortality and perinatal morbidity, the triggering factors and mechanisms involved in this condition are not yet fully elucidated. Conditions, such as alterations in trophoblast invasion, placental ischemia, endothelial dysfunction, and increased production of placental vasoconstrictor factors, are among those known to be involved in pregnancy-induced hypertension and preeclampsia [40,41]. However, additional mechanisms may participate in infection-related hypertension, including systemic inflammation, which is mediated by exacerbated production of inflammatory cytokines, as occurs in UTI [37,42,43]. While these immune mediators are produced to defend against invading microbes, an exacerbated response may jeopardize pregnancy [44]. Hence, the placenta has evolved regulatory feed-back strategies, such as the production of anti-inflammatory factors like calcitriol. In fact, inflammatory cytokines and/or LPS upregulate placental CYP27B1 expression, raising calcitriol production [45,46], which in turn decreases inflammation and induces antimicrobial peptides [29,32,47]. In the present study, we provide evidence supporting that placental calcitriol may also be involved in lowering maternal blood pressure in the presence of an UTI, helping to maintain normal ranges. Indeed, under this infectious condition, both SBP and DBP negatively correlated with calcitriol levels in venous cord serum with high coefficients of correlation and statistical significance. The fact that we observed this negative correlation mainly in the UTI group may relate to the significantly higher levels of VD metabolites found in all UTI cord serum samples compared to controls. However, an inverse and significant correlation between calcitriol and maternal SBP of female-carrying mothers was also found in the NP-female subgroup, suggesting a sex-dependent trend unrelated to the clinical condition. Although correlation does not imply causation, our results, together with the well-known ability of placental calcitriol to reach the maternal circulation [10,11,12] and act as a negative endocrine regulator of RAS [48], strongly support a role of placental calcitriol in the control of maternal blood pressure. In agreement with our observations, low maternal calcitriol serum levels in a cohort of infected women have been associated with pregnancy-induced hypertension and group B Streptococcus colonization [49]. Moreover, calcitriol is known to exert a potent vasodilator effect due to the presence of the vitamin D receptor in blood vessels, playing an essential role in endothelial cell function and blood pressure control [50,51]. In addition, calcitriol inhibits parathyroid hormone (PTH) secretion, which may help prevent the PTH-dependent increase in blood pressure [16,52].
Interestingly, calcidiol serum concentration has been inversely associated with cardiovascular mortality in women but not in men, further suggesting an interplay between sex hormones and cardiometabolic health [53]. Indeed, sexual dimorphism has been described in the association of serum VD deficiency and increased risk for cardiometabolic disorders [54].
Even though we found higher calcidiol and calcitriol levels in UTI-female cord samples than in males, this difference did not reach statistical significance, probably due to the small size of our subgroups. However, our data showed higher placental CYP27B1 and cathelicidin gene expression in UTI-female placentas in a similar manner as described previously in healthy placentas associated with female fetuses [38]. In the last report, male newborns also had lower umbilical cord cathelicidin serum levels, attributed to diminished placental cathelicidin expression secondary to decreased calcitriol bioavailability, resulting from a testosterone-dependent inhibition of CYP27B1 gene expression [38]. Remarkably, in this study, cord serum calcitriol negatively correlated with maternal bacteriuria only in the UTI-female subgroup, further supporting a sex-dependent differential VD regulation of the immune response and suggesting that placental production of calcitriol may help to attenuate maternal UTI. In agreement with our assumption, in a randomized controlled trial, the supplementation with VD significantly prevented UTI [26]. At the same time, serum calcidiol levels less than 20 ng/mL in pregnant subjects have been shown to represent the only factor associated with UTI [23]. Furthermore, maternal serum calcidiol levels have been correlated with an increased capacity to inhibit uropathogenic Escherichia coli growth in vitro [55], which is in line with the ability of VD to augment cathelicidin expression in bladder tissue of E. coli-infected women [56].
On the other hand, in our study, cathelicidin gene expression was positively and significantly associated with neonate birth measures; for instance, with birth weight in both NP and UTI groups independently of the neonate’s sex. Additionally, in UTI, cathelicidin expression was associated with gestational age in both male and female UTI subgroups, suggesting that a higher expression of this antimicrobial peptide relates to fewer preterm births under an infectious threat. Overall, these results link placental cathelicidin to a better neonatal outcome and suggest that this antimicrobial peptide influences prenatal physical development particularly in the presence of maternal UTI.
Various clinical and epidemiological studies have suggested a correlation between VD-deficiency and high blood pressure in different clinical and physiological settings [13,14,15,18,19,20,48,49]; however, this is the first study showing an inverse correlation between umbilical venous serum calcitriol and both SBP and DBP of pregnant subjects with UTI. Interestingly, significantly lower SBP and DBP have been reported among children and adolescents with higher cord-calcidiol levels at birth [21,57]. In contrast, maternal VD deficiency has been associated with increased susceptibility to hypertension in the offspring due to impaired endothelial relaxation of the large vessels [58]. Altogether, these evidences strongly suggest a VD-dependent intrauterine programming of the offspring’s blood pressure.
Herein, we specifically quantified VD metabolites in samples from the umbilical vein so that it would reflect placental biosynthesis. Notably, we detected VD-deficiency in all our cord serum samples, probably due to maternal deficiency, as shown elsewhere [59]. However, it should be noted that calcidiol levels in cord serum have been reported on average 25% reduced as compared to maternal serum levels [60]. Unfortunately, a high prevalence of maternal VD deficiency has been reported worldwide [61,62] and has been associated with overall adverse consequences for the mother and offspring [63]. One important limitation of the present study is that all the analyzed metabolites are mainly from fetal origin (i.e., venous umbilical cord serum). Indeed, we did not consider maternal VD metabolites. It would be interesting to measure their levels in peripheral maternal blood to visualize an integrated picture of the maternal–placental–fetal VD metabolism in the context of UTI and sexual dimorphism.
It is now well established that by activating toll-like receptors, bacterial products trigger CYP27B1 expression, which in turn increases endogenous calcitriol production and ultimately, bacterial killing [64]. Accordingly, in our study, maternal UTI significantly increased cord-calcitriol levels. However, and intriguingly, UTI also increased cord-calcidiol levels. We believe that this may be explained by the presence of binding sites for the inflammation-related transcription factor NF-kB in the CYP2R1 gene, which encodes the main VD 25-hydroxylase involved in calcidiol synthesis, the expression of which is robustly associated with this metabolite serum levels [65]. Moreover, in a study conducted in germ-free mice, hepatic cyp2r1 gene expression increased after microbial transplantation, while that of renal cyp24a1, encoding for the enzyme that catabolizes calcidiol and calcitriol, was inhibited [66]. These processes resulted in a significant increase in calcidiol serum levels. Interestingly, the authors showed that females produced more calcidiol than males, corroborating a sex-dependent VD-metabolism [66]. Further studies are needed to investigate more in depth a sexually dimorphic signature of the VD-endocrine system.
Our results warrant future research, including prospective longitudinal studies, to evaluate changes in maternal VD metabolites and immune markers along the first, second, and third trimesters of pregnancy and to relate these to the risk for hypertension and/or UTI development in the gestating mother.

5. Conclusions

Our findings strongly suggest that placental calcitriol biosynthesis is tightly linked to maternal blood pressure regulation and to the strength of the immune response in a sexually dimorphic manner. Specifically, the data presented herein reflect a more robust cathelicidin-dependent immune response at the fetoplacental unit of female-carrying pregnancies. We strongly recommend VD-assessment as part of routine care during pregnancy and VD-supplementation and/or solar exposure in the case of hypovitaminosis D, as an easy way to prevent UTI and high blood pressure.

Author Contributions

Investigation, formal analysis, methodology, data curation, and writing—review and editing, A.O.-O., A.O.-H. and L.D.; visualization, A.O.-O.; methodology and writing—review and editing, J.G.-Q., E.A., A.H., B.Q.-R. and F.L.; funding acquisition, F.L.; methodology, writing—review and editing, resources, and funding acquisition, V.Z.-C.; conceptualization, supervision, writing—original draft, funding acquisition, and resources, L.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by funds from the Department of Reproductive Biology “Carlos Gual Castro”, at Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán, México City, México, by Instituto Nacional de Perinatología Isidro Espinosa de los Reyes, grant number [3210-21205-01-14] to VZC and by Consejo Nacional de Ciencia y Tecnología (CONACyT), grant numer [CB2014-24162] to VZC. The APC was founded by Instituto Nacional de Perinatología Isidro Espinosa de los Reyes.

Institutional Review Board Statement

This protocol was approved by the Research and Ethical Comitees from Instituto Mexicano del Seguro Social, Nivel Central Secretaría de Salud de la Ciudad de México, and Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán (R-2013-785-033, 20800101917 and 2221 to LD, respectively) as well as from Instituto Nacional de Perinatología Isidro Espinosa de los Reyes (212250-3210-21205-01-14, to VZC). The study methodologies conformed to the standards set by the Declaration of Helsinki.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

All data supporting reported results are found within this article.

Acknowledgments

We acknowledge with thanks Hospital de Gineco-Obstetricia “Luis Castelazo Ayala” and Instituto Nacional de Perinatología Isidro Espinosa de los Reyes for assistance in obtaining the placentas.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wang, Y. Vasoactivators and Placental Vasoactivity. In Vascular Biology of the Placenta; Morgan & Claypool Life Sciences: San Rafael, CA, USA, 2010. [Google Scholar]
  2. Irani, R.A.; Xia, Y. The functional role of the renin-angiotensin system in pregnancy and preeclampsia. Placenta 2008, 29, 763–771. [Google Scholar] [CrossRef] [Green Version]
  3. Duvekot, J.J.; Peeters, L.L. Maternal cardiovascular hemodynamic adaptation to pregnancy. Obstet. Gynecol. Surv. 1994, 49, S1–S14. [Google Scholar] [CrossRef]
  4. Sanghavi, M.; Rutherford, J.D. Cardiovascular physiology of pregnancy. Circulation 2014, 130, 1003–1008. [Google Scholar] [CrossRef]
  5. Duvekot, J.J.; Peeters, L.L. Renal hemodynamics and volume homeostasis in pregnancy. Obstet. Gynecol. Surv. 1994, 49, 830–839. [Google Scholar] [CrossRef] [PubMed]
  6. Minshall, R.D.; Pavcnik, D.; Browne, D.L.; Hermsmeyer, K. Nongenomic vasodilator action of progesterone on primate coronary arteries. J. Appl. Physiol. 2002, 92, 701–708. [Google Scholar] [CrossRef] [Green Version]
  7. Pringle, K.G.; Tadros, M.A.; Callister, R.J.; Lumbers, E.R. The expression and localization of the human placental prorenin/renin-angiotensin system throughout pregnancy: Roles in trophoblast invasion and angiogenesis? Placenta 2011, 32, 956–962. [Google Scholar] [CrossRef] [PubMed]
  8. Takimoto, E.; Ishida, J.; Sugiyama, F.; Horiguchi, H.; Murakami, K.; Fukamizu, A. Hypertension induced in pregnant mice by placental renin and maternal angiotensinogen. Science 1996, 274, 995–998. [Google Scholar] [CrossRef]
  9. Brar, H.S.; Do, Y.S.; Tam, H.B.; Valenzuela, G.J.; Murray, R.D.; Longo, L.D.; Yonekura, M.L.; Hsueh, W.A. Uteroplacental unit as a source of elevated circulating prorenin levels in normal pregnancy. Am. J. Obstet. Gynecol. 1986, 155, 1223–1226. [Google Scholar] [CrossRef]
  10. Blum, M.; Weisman, Y.; Turgeman, S.; Cabili, S.; Wollman, Y.; Peer, G.; Stern, N.; Silverberg, D.; Schwartz, D.; Iaina, A. Pregnancy decreases immunoreactive parathyroid hormone level in rats with chronic renal failure. Clin. Sci. 1999, 96, 427–430. [Google Scholar] [CrossRef]
  11. Gray, T.K.; Lester, G.E.; Lorenc, R.S. Evidence for extra-renal 1 alpha-hydroxylation of 25-hydroxyvitamin D3 in pregnancy. Science 1979, 204, 1311–1313. [Google Scholar] [CrossRef]
  12. Park, H.; Wood, M.R.; Malysheva, O.V.; Jones, S.; Mehta, S.; Brannon, P.M.; Caudill, M.A. Placental vitamin D metabolism and its associations with circulating vitamin D metabolites in pregnant women. Am. J. Clin. Nutr. 2017, 106, 1439–1448. [Google Scholar] [CrossRef] [Green Version]
  13. Li, Y.C.; Kong, J.; Wei, M.; Chen, Z.F.; Liu, S.Q.; Cao, L.P. 1,25-Dihydroxyvitamin D(3) is a negative endocrine regulator of the renin-angiotensin system. J. Clin. Investig. 2002, 110, 229–238. [Google Scholar] [CrossRef]
  14. Lind, L.; Hanni, A.; Lithell, H.; Hvarfner, A.; Sorensen, O.H.; Ljunghall, S. Vitamin D is related to blood pressure and other cardiovascular risk factors in middle-aged men. Am. J. Hypertens. 1995, 8, 894–901. [Google Scholar] [CrossRef]
  15. Lind, L.; Wengle, B.; Wide, L.; Ljunghall, S. Reduction of blood pressure during long-term treatment with active vitamin D (alphacalcidol) is dependent on plasma renin activity and calcium status. A double-blind, placebo-controlled study. Am. J. Hypertens. 1989, 2, 20–25. [Google Scholar] [CrossRef]
  16. Pfeifer, M.; Begerow, B.; Minne, H.W.; Nachtigall, D.; Hansen, C. Effects of a short-term vitamin D(3) and calcium supplementation on blood pressure and parathyroid hormone levels in elderly women. J. Clin. Endocrinol. Metab. 2001, 86, 1633–1637. [Google Scholar] [CrossRef] [Green Version]
  17. Adela, R.; Borkar, R.M.; Mishra, N.; Bhandi, M.M.; Vishwakarma, G.; Varma, B.A.; Ragampeta, S.; Banerjee, S.K. Lower Serum Vitamin D Metabolite Levels in Relation to Circulating Cytokines/Chemokines and Metabolic Hormones in Pregnant Women with Hypertensive Disorders. Front. Immunol. 2017, 8, 273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. Bodnar, L.M.; Catov, J.M.; Simhan, H.N.; Holick, M.F.; Powers, R.W.; Roberts, J.M. Maternal vitamin D deficiency increases the risk of preeclampsia. J. Clin. Endocrinol. Metab. 2007, 92, 3517–3522. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Ali, A.M.; Alobaid, A.; Malhis, T.N.; Khattab, A.F. Effect of vitamin D3 supplementation in pregnancy on risk of pre-eclampsia—Randomized controlled trial. Clin. Nutr. 2019, 38, 557–563. [Google Scholar] [CrossRef]
  20. Xu, M.L.; Yu, X.J.; Zhao, J.Q.; Du, Y.; Xia, W.J.; Su, Q.; Du, M.M.; Yang, Q.; Qi, J.; Li, Y.; et al. Calcitriol ameliorated autonomic dysfunction and hypertension by down-regulating inflammation and oxidative stress in the paraventricular nucleus of SHR. Toxicol. Appl. Pharmacol. 2020, 394, 114950. [Google Scholar] [CrossRef] [PubMed]
  21. Sauder, K.A.; Stamatoiu, A.V.; Leshchinskaya, E.; Ringham, B.M.; Glueck, D.H.; Dabelea, D. Cord Blood Vitamin D Levels and Early Childhood Blood Pressure: The Healthy Start Study. J. Am. Heart Assoc. 2019, 8, e011485. [Google Scholar] [CrossRef] [Green Version]
  22. Yang, J.; Chen, G.; Wang, D.; Chen, M.; Xing, C.; Wang, B. Low serum 25-hydroxyvitamin D level and risk of urinary tract infection in infants. Medicine 2016, 95, e4137. [Google Scholar] [CrossRef]
  23. Haghdoost, S.; Pazandeh, F.; Darvish, S.; Khabazkhoob, M.; Huss, R.; Lak, T.B. Association of serum vitamin D levels and urinary tract infection in pregnant women: A case control study. Eur. J. Obstet. Gynecol. Reprod. Biol. 2019, 243, 51–56. [Google Scholar] [CrossRef]
  24. Georgieva, V.; Kamolvit, W.; Herthelius, M.; Luthje, P.; Brauner, A.; Chromek, M. Association between vitamin D, antimicrobial peptides and urinary tract infection in infants and young children. Acta Paediatr. 2019, 108, 551–556. [Google Scholar] [CrossRef] [Green Version]
  25. Hensel, K.J.; Randis, T.M.; Gelber, S.E.; Ratner, A.J. Pregnancy-specific association of vitamin D deficiency and bacterial vaginosis. Am. J. Obstet. Gynecol. 2011, 204, e41–e49. [Google Scholar] [CrossRef] [PubMed]
  26. Jorde, R.; Sollid, S.T.; Svartberg, J.; Joakimsen, R.M.; Grimnes, G.; Hutchinson, M.Y. Prevention of urinary tract infections with vitamin D supplementation 20,000 IU per week for five years. Results from an RCT including 511 subjects. Infect. Dis. 2016, 48, 823–828. [Google Scholar] [CrossRef]
  27. Babikir, I.H.; Abugroun, E.A.; Bilal, N.E.; Alghasham, A.A.; Abdalla, E.E.; Adam, I. The impact of cathelicidin, the human antimicrobial peptide LL-37 in urinary tract infections. BMC Infect. Dis. 2018, 18, 17. [Google Scholar] [CrossRef] [Green Version]
  28. Wang, T.T.; Nestel, F.P.; Bourdeau, V.; Nagai, Y.; Wang, Q.; Liao, J.; Tavera-Mendoza, L.; Lin, R.; Hanrahan, J.W.; Mader, S.; et al. Cutting edge: 1,25-dihydroxyvitamin D3 is a direct inducer of antimicrobial peptide gene expression. J. Immunol. 2004, 173, 2909–2912. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Liu, N.; Kaplan, A.T.; Low, J.; Nguyen, L.; Liu, G.Y.; Equils, O.; Hewison, M. Vitamin D induces innate antibacterial responses in human trophoblasts via an intracrine pathway. Biol. Reprod. 2009, 80, 398–406. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Chromek, M.; Slamova, Z.; Bergman, P.; Kovacs, L.; Podracka, L.; Ehren, I.; Hokfelt, T.; Gudmundsson, G.H.; Gallo, R.L.; Agerberth, B.; et al. The antimicrobial peptide cathelicidin protects the urinary tract against invasive bacterial infection. Nat. Med. 2006, 12, 636–641. [Google Scholar] [CrossRef] [PubMed]
  31. Akoh, C.C.; Pressman, E.K.; Whisner, C.M.; Thomas, C.; Cao, C.; Kent, T.; Cooper, E.; O’Brien, K.O. Vitamin D mediates the relationship between placental cathelicidin and group B streptococcus colonization during pregnancy. J. Reprod. Immunol. 2017, 121, 42–48. [Google Scholar] [CrossRef] [PubMed]
  32. Olmos-Ortiz, A.; Noyola-Martinez, N.; Barrera, D.; Zaga-Clavellina, V.; Avila, E.; Halhali, A.; Biruete, B.; Larrea, F.; Diaz, L. IL-10 inhibits while calcitriol reestablishes placental antimicrobial peptides gene expression. J. Steroid Biochem. Mol. Biol. 2015, 148, 187–193. [Google Scholar] [CrossRef] [PubMed]
  33. Drazancic, A.; Balasa, A.; Zadjelovic, J.; Kralj-Pejakovic, L. The effect of treatment of bacteriuria on pregnancy outcome. Jugosl. Ginekol. Perinatol. 1989, 29, 15–18. [Google Scholar]
  34. Gibson, C.S.; Goldwater, P.N.; MacLennan, A.H.; Haan, E.A.; Priest, K.; Dekker, G.A.; South Australian Cerebral Palsy Research Group. Fetal exposure to herpesviruses may be associated with pregnancy-induced hypertensive disorders and preterm birth in a Caucasian population. Int. J. Obstet. Gynaecol. 2008, 115, 492–500. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Rosenbloom, J.I.; Raghuraman, N.; Carter, E.B.; Kelly, J.C. Coronavirus disease 2019 infection and hypertensive disorders of pregnancy. Am. J. Obstet. Gynecol. 2021, 224, 623–624. [Google Scholar] [CrossRef] [PubMed]
  36. Loh, K.; Sivalingam, N. Urinary tract infections in pregnancy. Acad. Fam. Physicians Malays. 2007, 2, 54–57. [Google Scholar]
  37. Yan, L.; Jin, Y.; Hang, H.; Yan, B. The association between urinary tract infection during pregnancy and preeclampsia: A meta-analysis. Medicine 2018, 97, e12192. [Google Scholar] [CrossRef]
  38. Olmos-Ortiz, A.; Garcia-Quiroz, J.; Lopez-Marure, R.; Gonzalez-Curiel, I.; Rivas-Santiago, B.; Olivares, A.; Avila, E.; Barrera, D.; Halhali, A.; Caldino, F.; et al. Evidence of sexual dimorphism in placental vitamin D metabolism: Testosterone inhibits calcitriol-dependent cathelicidin expression. J. Steroid Biochem. Mol. Biol. 2016, 163, 173–182. [Google Scholar] [CrossRef]
  39. Holick, M.F.; Binkley, N.C.; Bischoff-Ferrari, H.A.; Gordon, C.M.; Hanley, D.A.; Heaney, R.P.; Murad, M.H.; Weaver, C.M.; Endocrine, S. Evaluation, treatment, and prevention of vitamin D deficiency: An Endocrine Society clinical practice guideline. J. Clin. Endocrinol. Metab. 2011, 96, 1911–1930. [Google Scholar] [CrossRef] [Green Version]
  40. Granger, J.P.; Alexander, B.T.; Bennett, W.A.; Khalil, R.A. Pathophysiology of pregnancy-induced hypertension. Am. J. Hypertens. 2001, 14, 178S–185S. [Google Scholar] [CrossRef]
  41. Young, B.C.; Levine, R.J.; Karumanchi, S.A. Pathogenesis of preeclampsia. Annu. Rev. Pathol. Mech. Dis. 2010, 5, 173–192. [Google Scholar] [CrossRef]
  42. Alexander, B.T.; Cockrell, K.L.; Massey, M.B.; Bennett, W.A.; Granger, J.P. Tumor necrosis factor-alpha-induced hypertension in pregnant rats results in decreased renal neuronal nitric oxide synthase expression. Am. J. Hypertens. 2002, 15, 170–175. [Google Scholar] [CrossRef]
  43. Jayaram, A.; Deer, E.; Amaral, L.M.; Campbell, N.; Vaka, V.R.; Cunningham, M.; Ibrahim, T.; Cornelius, D.C.; LaMarca, B.B. The role of tumor necrosis factor in triggering activation of natural killer cell, multi-organ mitochondrial dysfunction and hypertension during pregnancy. Pregnancy Hypertens. 2021, 24, 65–72. [Google Scholar] [CrossRef]
  44. Olmos-Ortiz, A.; Flores-Espinosa, P.; Mancilla-Herrera, I.; Vega-Sanchez, R.; Diaz, L.; Zaga-Clavellina, V. Innate Immune Cells and Toll-like Receptor-Dependent Responses at the Maternal-Fetal Interface. Int. J. Mol. Sci. 2019, 20, 3654. [Google Scholar] [CrossRef] [Green Version]
  45. Olmos-Ortiz, A.; Garcia-Quiroz, J.; Avila, E.; Caldino-Soto, F.; Halhali, A.; Larrea, F.; Diaz, L. Lipopolysaccharide and cAMP modify placental calcitriol biosynthesis reducing antimicrobial peptides gene expression. Am. J. Reprod. Immunol. 2018, 79, e12841. [Google Scholar] [CrossRef] [PubMed]
  46. Noyola-Martinez, N.; Diaz, L.; Zaga-Clavellina, V.; Avila, E.; Halhali, A.; Larrea, F.; Barrera, D. Regulation of CYP27B1 and CYP24A1 gene expression by recombinant pro-inflammatory cytokines in cultured human trophoblasts. J. Steroid Biochem. Mol. Biol. 2014, 144 Pt A, 106–109. [Google Scholar] [CrossRef]
  47. Diaz, L.; Noyola-Martinez, N.; Barrera, D.; Hernandez, G.; Avila, E.; Halhali, A.; Larrea, F. Calcitriol inhibits TNF-alpha-induced inflammatory cytokines in human trophoblasts. J. Reprod. Immunol. 2009, 81, 17–24. [Google Scholar] [CrossRef] [PubMed]
  48. Li, Y.C.; Qiao, G.; Uskokovic, M.; Xiang, W.; Zheng, W.; Kong, J. Vitamin D: A negative endocrine regulator of the renin-angiotensin system and blood pressure. J. Steroid Biochem. Mol. Biol. 2004, 89, 387–392. [Google Scholar] [CrossRef]
  49. Van Winden, K.R.; Bearden, A.; Kono, N.; Frederick, T.; Operskalski, E.; Stek, A.; Pandian, R.; Barton, L.; Kovacs, A. Low Bioactive Vitamin D Is Associated with Pregnancy-Induced Hypertension in a Cohort of Pregnant HIV-Infected Women Sampled Over a 23-Year Period. Am. J. Perinatol. 2020, 37, 1446–1454. [Google Scholar] [CrossRef]
  50. Ni, W.; Watts, S.W.; Ng, M.; Chen, S.; Glenn, D.J.; Gardner, D.G. Elimination of vitamin D receptor in vascular endothelial cells alters vascular function. Hypertension 2014, 64, 1290–1298. [Google Scholar] [CrossRef] [Green Version]
  51. Jia, X.; Gu, Y.; Groome, L.J.; Al-Kofahi, M.; Alexander, J.S.; Li, W.; Wang, Y. 1,25(OH)2D3 Induces Placental Vascular Smooth Muscle Cell Relaxation by Phosphorylation of Myosin Phosphatase Target Subunit 1Ser507: Potential Beneficial Effects of Vitamin D on Placental Vasculature in Humans. Biol. Reprod. 2016, 94, 116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Fisher, S.B.; Perrier, N.D. Primary hyperparathyroidism and hypertension. Gland. Surg. 2020, 9, 142–149. [Google Scholar] [CrossRef] [PubMed]
  53. Rohrmann, S.; Braun, J.; Bopp, M.; Faeh, D.; Swiss National, C. Inverse association between circulating vitamin D and mortality--dependent on sex and cause of death? Nutr. Metab. Cardiovasc. Dis. 2013, 23, 960–966. [Google Scholar] [CrossRef] [Green Version]
  54. Sanghera, D.K.; Sapkota, B.R.; Aston, C.E.; Blackett, P.R. Vitamin D Status, Gender Differences, and Cardiometabolic Health Disparities. Ann. Nutr. Metab. 2017, 70, 79–87. [Google Scholar] [CrossRef]
  55. Ramos, N.L.; Sekikubo, M.; Kironde, F.; Mirembe, F.; Saaf, M.; Brauner, A. The impact of vitamin D on the innate immune response to uropathogenic Escherichia coli during pregnancy. Clin. Microbiol. Infect. 2015, 21, 482.e1–482.e7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Hertting, O.; Holm, A.; Luthje, P.; Brauner, H.; Dyrdak, R.; Jonasson, A.F.; Wiklund, P.; Chromek, M.; Brauner, A. Vitamin D induction of the human antimicrobial Peptide cathelicidin in the urinary bladder. PLoS ONE 2010, 5, e15580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Williams, D.M.; Fraser, A.; Fraser, W.D.; Hypponen, E.; Davey Smith, G.; Deanfield, J.; Hingorani, A.; Sattar, N.; Lawlor, D.A. Associations of maternal 25-hydroxyvitamin D in pregnancy with offspring cardiovascular risk factors in childhood and adolescence: Findings from the Avon Longitudinal Study of Parents and Children. Heart 2013, 99, 1849–1856. [Google Scholar] [CrossRef] [Green Version]
  58. Meems, L.M.; Mahmud, H.; Buikema, H.; Tost, J.; Michel, S.; Takens, J.; Verkaik-Schakel, R.N.; Vreeswijk-Baudoin, I.; Mateo-Leach, I.V.; van der Harst, P.; et al. Parental vitamin D deficiency during pregnancy is associated with increased blood pressure in offspring via Panx1 hypermethylation. Am. J. Physiol. Heart Circ. Physiol. 2016, 311, H1459–H1469. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  59. Ariyawatkul, K.; Lersbuasin, P. Prevalence of vitamin D deficiency in cord blood of newborns and the association with maternal vitamin D status. Eur. J. Pediatr. 2018, 177, 1541–1545. [Google Scholar] [CrossRef] [PubMed]
  60. Ron, M.; Menczel, J.; Schwartz, L.; Palti, Z.; Kidroni, G. Vitamin D3 metabolites in amniotic fluid in relation with maternal and fetal sera in term pregnancies. J. Perinat. Med. 1987, 15, 282–290. [Google Scholar] [CrossRef] [Green Version]
  61. Li, H.; Ma, J.; Huang, R.; Wen, Y.; Liu, G.; Xuan, M.; Yang, L.; Yang, J.; Song, L. Prevalence of vitamin D deficiency in the pregnant women: An observational study in Shanghai, China. Arch. Public Health 2020, 78, 31. [Google Scholar] [CrossRef]
  62. Abbasian, M.; Chaman, R.; Amiri, M.; Ajami, M.E.; Jafari-Koshki, T.; Rohani, H.; Taghavi-Shahri, S.M.; Sadeghi, E.; Raei, M. Vitamin D Deficiency in Pregnant Women and Their Neonates. Glob. J. Health Sci. 2016, 8, 54008. [Google Scholar] [CrossRef] [PubMed]
  63. Olmos-Ortiz, A.; Avila, E.; Durand-Carbajal, M.; Diaz, L. Regulation of calcitriol biosynthesis and activity: Focus on gestational vitamin D deficiency and adverse pregnancy outcomes. Nutrients 2015, 7, 443–480. [Google Scholar] [CrossRef] [Green Version]
  64. Liu, P.T.; Stenger, S.; Li, H.; Wenzel, L.; Tan, B.H.; Krutzik, S.R.; Ochoa, M.T.; Schauber, J.; Wu, K.; Meinken, C.; et al. Toll-like receptor triggering of a vitamin D-mediated human antimicrobial response. Science 2006, 311, 1770–1773. [Google Scholar] [CrossRef]
  65. Roizen, J.D.; Long, C.; Casella, A.; O’Lear, L.; Caplan, I.; Lai, M.; Sasson, I.; Singh, R.; Makowski, A.J.; Simmons, R.; et al. Obesity Decreases Hepatic 25-Hydroxylase Activity Causing Low Serum 25-Hydroxyvitamin D. J. Bone Miner. Res. 2019, 34, 1068–1073. [Google Scholar] [CrossRef] [PubMed]
  66. Bora, S.A.; Kennett, M.J.; Smith, P.B.; Patterson, A.D.; Cantorna, M.T. The Gut Microbiota Regulates Endocrine Vitamin D Metabolism through Fibroblast Growth Factor 23. Front. Immunol. 2018, 9, 408. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Nutrients 13 03114 g001 550
Figure 1. Vitamin D3 metabolites in cord serum from normal and UTI-affected pregnancies. Calcidiol (A) and calcitriol (B) cord serum levels were quantified in samples from normal pregnancies (NP) and with urinary tract infection (UTI). Bars represent least-square means ± SEM. The value of p indicates the statistical significance as compared to NP samples within same sex.
Figure 1. Vitamin D3 metabolites in cord serum from normal and UTI-affected pregnancies. Calcidiol (A) and calcitriol (B) cord serum levels were quantified in samples from normal pregnancies (NP) and with urinary tract infection (UTI). Bars represent least-square means ± SEM. The value of p indicates the statistical significance as compared to NP samples within same sex.
Nutrients 13 03114 g001
Nutrients 13 03114 g002 550
Figure 2. Tissue cathelicidin gene expression in placentas from normal and UTI-affected pregnancies. The relative gene expression of cathelicidin was analyzed by qPCR in placentas obtained from normal pregnancies (NP) and with urinary tract infection (UTI) and was normalized against GAPDH gene expression. Bars represent least-square means ± SEM. * p < 0.03 vs. NP subgroups and vs. UTI-male subgroup.
Figure 2. Tissue cathelicidin gene expression in placentas from normal and UTI-affected pregnancies. The relative gene expression of cathelicidin was analyzed by qPCR in placentas obtained from normal pregnancies (NP) and with urinary tract infection (UTI) and was normalized against GAPDH gene expression. Bars represent least-square means ± SEM. * p < 0.03 vs. NP subgroups and vs. UTI-male subgroup.
Nutrients 13 03114 g002
Nutrients 13 03114 g003 550
Figure 3. Cord serum calcitriol levels inversely correlated with maternal blood pressure in UTI. Simple linear regression plots show the associations between cord serum calcitriol and maternal systolic and diastolic blood pressure (SBP, DBP; (A,B), respectively) in samples from the cohort of urinary tract infection. Dashed lines indicate 95% confidence intervals.
Figure 3. Cord serum calcitriol levels inversely correlated with maternal blood pressure in UTI. Simple linear regression plots show the associations between cord serum calcitriol and maternal systolic and diastolic blood pressure (SBP, DBP; (A,B), respectively) in samples from the cohort of urinary tract infection. Dashed lines indicate 95% confidence intervals.
Nutrients 13 03114 g003
Nutrients 13 03114 g004 550
Figure 4. Positive correlation between cord serum levels of calcitriol and calcidiol. Simple linear regression plots depict positive correlations between calcitriol and calcidiol in cord serum samples from the cohort of urinary tract infection (UTI, A) and normal pregnancy (NP, B). Dashed lines indicate 95% confidence intervals.
Figure 4. Positive correlation between cord serum levels of calcitriol and calcidiol. Simple linear regression plots depict positive correlations between calcitriol and calcidiol in cord serum samples from the cohort of urinary tract infection (UTI, A) and normal pregnancy (NP, B). Dashed lines indicate 95% confidence intervals.
Nutrients 13 03114 g004
Table
Table 1. Clinical data of mothers and newborns.
Table 1. Clinical data of mothers and newborns.
Clinical DataNP-FemaleNP-MaleUTI-FemaleUTI-MaleNP Total vs. UTI Total
n = 24n = 20n = 22n = 26(p)
Maternal parameters:
Pregestational BMI (kg/m2)24.7 ± 0.924.4 ± 0.9 24.8 ± 1.025.1 ± 0.8ns
Gestational age (weeks)38.6 ± 0.6 38.6 ± 0.735.9 ± 0.7 b36.3 ± 0.6 b<0.001
SBP (mm Hg)115 ± 2111 ± 3115 ± 3114 ± 2ns
DBP (mm Hg)72 ± 266 ± 270 ± 270 ± 2ns
Urinalysis (pH)6.0 ± 0.16.0 ± 0.26.5 ± 0.1 b6.5 ± 0.1 b0.005
Urinalysis (Bacteria U/µL)1.7 ± 12.6 1.0 ± 13.868.5 ± 14.6 a,b23.7 ± 12.6 b0.001
Newborn data:
Weight (g)3009 ± 139 3166 ± 1492481 ± 153 b2697 ± 133 b<0.001
Length (cm)49.5 ± 0.8 50.7 ± 0.946.6 ± 0.9 b47.3 ± 0.8 b0.001
Cephalic perimeter (cm)34.1 ± 0.434.2 ± 0.531.7 ± 0.5 b32.9 ± 0.4<0.001
Apgar score (1 min)8.0 ± 0.2 7.9 ± 0.27.4 ± 0.27.4 ± 0.20.016
Apgar score (5 min)9.0 ± 0.0 9.0 ± 0.08.8 ± 0.0 b8.9 ± 0.00.007
Least-square means ± standard error of the mean (SEM). Bold font depicts statistical significance. BMI, body mass index; DBP, diastolic blood pressure; SBP, systolic blood pressure; ns, non-significant; NP, normal pregnancy; UTI, urinary tract infection. a = p < 0.05 vs. opposite sex within UTI; b = p < 0.05 vs. same sex in NP.
Table
Table 2. Correlations between parameters with at least one significant result.
Table 2. Correlations between parameters with at least one significant result.
SubgroupsGroups
CorrelatedNP-FemaleNP-MaleUTI-FemaleUTI-MaleNP-TotalUTI-Total
Factorsrprprprprprp
CalSBP−0.5110.030.0140.952−0.5650.03−0.5840.006−0.1570.381−0.57<0.001
CalDBP−0.2560.316−0.0940.721−0.5510.03−0.5340.01−0.1250.485−0.5120.002
CalUB−0.1360.681−0.2030.658−0.6360.010.3460.881−0.0200.935−0.2410.168
Calcalcidiol0.4180.0820.2320.3780.0110.9640.703<0.0010.3380.050.4780.005
CalLL370.0780.7630.5590.020.1510.603−0.1630.4980.2890.10.0760.666
LL37NB-L0.2050.3780.0280.9050.410.0890.5440.0070.1440.380.4230.006
LL37CP0.1810.440.0550.820.5230.020.2550.2370.1010.530.2010.207
LL37NB-W0.4940.026−0.0170.940.450.0580.540.0080.330.040.380.01
LL37GAD0.0030.9870.0440.8540.5520.010.5350.0080.0510.7560.4280.005
LL37Apgar10.0380.866−0.0180.940.3520.1480.410.0570.0150.9260.3310.03
NB-WNB-L0.5810.0030.749<0.0010.866<0.0010.939<0.0010.63<0.0010.916<0.001
NB-WCP0.4110.050.2320.4170.716<0.0010.662<0.0010.3490.0230.796<0.001
NB-WGAD0.3120.1450.4250.0600.882<0.0010.82<0.0010.350.020.846<0.001
SBPDBP0.743<0.0010.757<0.0010.784<0.0010.774<0.0010.727<0.0010.774<0.001
SBPBMI0.5320.0090.1960.4030.5220.020.1050.6150.3840.010.3020.04
BMI, body mass index; Cal, calcitriol; CP, cephalic perimeter; GAD, gestational age at delivery; LL37, cathelicidin; NB-W, newborn weight; NB-L, newborn length; NP, normal pregnancy; UB, urinary bacteria (bacteria per µL of maternal urine); UTI, urinary tract infection. Genes depicted in italic font indicates mRNA expression. Significant values are shown in bold font.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Olmos-Ortiz, A.; Olivares-Huerta, A.; García-Quiroz, J.; Avila, E.; Halhali, A.; Quesada-Reyna, B.; Larrea, F.; Zaga-Clavellina, V.; Díaz, L. Cord Serum Calcitriol Inversely Correlates with Maternal Blood Pressure in Urinary Tract Infection-Affected Pregnancies: Sex-Dependent Immune Implications. Nutrients 2021, 13, 3114. https://doi.org/10.3390/nu13093114

AMA Style

Olmos-Ortiz A, Olivares-Huerta A, García-Quiroz J, Avila E, Halhali A, Quesada-Reyna B, Larrea F, Zaga-Clavellina V, Díaz L. Cord Serum Calcitriol Inversely Correlates with Maternal Blood Pressure in Urinary Tract Infection-Affected Pregnancies: Sex-Dependent Immune Implications. Nutrients. 2021; 13(9):3114. https://doi.org/10.3390/nu13093114

Chicago/Turabian Style

Olmos-Ortiz, Andrea, Alberto Olivares-Huerta, Janice García-Quiroz, Euclides Avila, Ali Halhali, Braulio Quesada-Reyna, Fernando Larrea, Verónica Zaga-Clavellina, and Lorenza Díaz. 2021. "Cord Serum Calcitriol Inversely Correlates with Maternal Blood Pressure in Urinary Tract Infection-Affected Pregnancies: Sex-Dependent Immune Implications" Nutrients 13, no. 9: 3114. https://doi.org/10.3390/nu13093114

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop