Lactose Intolerance Assessed by Analysis of Genetic Polymorphism, Breath Test and Symptoms in Patients with Inflammatory Bowel Disease
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design
- (1)
- eLac12F—ACTACTCCCCTTTTACCTCGTT,eLac12R—TCTGTTTATCTCTGCTCTCATCAT,amplifying the 400 bp region containing the −13910 position (rs4988235);
- (2)
- eLac22F—AGCTGGGACCACAAGCAC,eLac21R—CATTATCAGCCAACATCAAAGCamplifying the 250 bp region containing the −22018 position (rs182549).
| Primer Name | SNP | Expected Variation | Sequence | Final Length |
| eLac1 | rs41525747 | G/C | AGGAGAGTTCCTTTGAGGCCA | 36 |
| eLac2 | rs4988236 | G/A | GGAGAGTTCCTTTGAGGCCAG | 41 |
| eLac3 | rs4988235 | G/A | GAGTTCCTTTGAGGCCAGGG | 46 |
| eLac4 | rs41456145 | A/G | CCTTTGAGGCCAGGGGCT | 51 |
| eLac5 | rs773131166 | C/T | CCTTTGAGGCCAGGGGCTA | 56 |
| eLac6 | rs41380347 | A/C | CTTTGAGGCCAGGGGCTAC | 61 |
| eLac7 | rs145946881 | C/G | GGTATTAAATGGTAACTTACGTCTTTATG | 66 |
| eLac8 | rs182549 | C/T | ACAAAGGTGTGAGCCACCG | 71 |
2.2. Ethical Considerations
2.3. Statistical Analysis
3. Results
3.1. Patient Demographics
3.2. Lactose Breath Test
3.3. Genetic Test
3.4. Correlation between Lactose Breath Test and Genotypes
3.5. Correlation between Symptoms and Breath Test and Genetic Test
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Halpin, S.J.; Ford, A.C. Prevalence of symptoms meeting criteria for irritable bowel syndrome in inflammatory bowel disease: Systematic review and meta-analysis. Am. J. Gastroenterol. 2012, 107, 1474–1482. [Google Scholar] [CrossRef] [PubMed]
- Quigley, E.M. Overlapping irritable bowel syndrome and inflammatory bowel disease: Less to this than meets the eye? Ther. Adv. Gastroenterol. 2016, 9, 199–212. [Google Scholar] [CrossRef]
- Vivinus-Nebot, M.; Frin-Mathy, G.; Bzioueche, H.; Dainese, R.; Bernard, G.; Anty, R.; Filippi, J.; Saint-Paul, M.C.; Tulic, M.K.; Verhasselt, V.; et al. Functional bowel symptoms in quiescent inflammatory bowel diseases: Role of epithelial barrier disruption and low-grade inflammation. Gut 2014, 63, 744–752. [Google Scholar] [CrossRef] [PubMed]
- Storhaug, C.L.; Fosse, S.K.; Fadnes, L.T. Country, regional, and global estimates for lactose malabsorption in adults: A systematic review and meta-analysis. Lancet Gastroenterol. Hepatol. 2017, 2, 738–746. [Google Scholar] [CrossRef]
- Misselwitz, B.; Butter, M.; Verbeke, K.; Fox, M.R. Update on lactose malabsorption and intolerance: Pathogenesis, diagnosis and clinical management. Gut 2019, 68, 2080–2091. [Google Scholar] [CrossRef]
- Law, D.; Conklin, J.; Pimentel, M. Lactose intolerance and the role of the lactose breath test. Am. J. Gastroenterol. 2010, 105, 1726–1728. [Google Scholar] [CrossRef]
- Swallow, D.M. Genetics of lactase persistence and lactose intolerance. Annu. Rev. Genet. 2003, 37, 197–219. [Google Scholar] [CrossRef]
- Torres, J.; Bonovas, S.; Doherty, G.; Kucharzik, T.; Gisbert, J.P.; Raine, T.; Adamina, M.; Armuzzi, A.; Bachmann, O.; Bager, P.; et al. ECCO Guidelines on Therapeutics in Crohn’s Disease: Medical Treatment. J. Crohns. Colitis. 2020, 14, 4–22. [Google Scholar] [CrossRef]
- Peyrin-Biroulet, L.; Sandborn, W.; Sands, B.E.; Reinisch, W.; Bemelman, W.; Bryant, R.V.; D’Haens, G.; Dotan, I.; Dubinsky, M.; Feagan, B.; et al. Selecting Therapeutic Targets in Inflammatory Bowel Disease (STRIDE): Determining Therapeutic Goals for Treat-to-Target. Am. J. Gastroenterol. 2015, 110, 1324–1338. [Google Scholar] [CrossRef]
- Sturm, A.; Maaser, C.; Calabrese, E.; Annese, V.; Fiorino, G.; Kucharzik, T.; Vavricka, S.R.; Verstockt, B.; van Rheenen, P.; Tolan, D.; et al. ECCO-ESGAR Guideline for Diagnostic Assessment in IBD Part 2: IBD scores and general principles and technical aspects. J. Crohns. Colitis. 2019, 13, 273–284. [Google Scholar] [CrossRef] [PubMed]
- Rezaie, A.; Buresi, M.; Lembo, A.; Lin, H.; McCallum, R.; Rao, S.; Schmulson, M.; Valdovinos, M.; Zakko, S.; Pimentel, M. Hydrogen and Methane-Based Breath Testing in Gastrointestinal Disorders: The North American Consensus. Am. J. Gastroenterol. 2017, 112, 775–784. [Google Scholar] [CrossRef] [PubMed]
- Zheng, X.; Chu, H.; Cong, Y.; Deng, Y.; Long, Y.; Zhu, Y.; Pohl, D.; Fried, M.; Dai, N.; Fox, M. Self-reported lactose intolerance in clinic patients with functional gastrointestinal symptoms: Prevalence, risk factors, and impact on food choices. Neurogastroenterol. Motil. 2015, 27, 1138–1146. [Google Scholar] [CrossRef] [PubMed]
- Tag, C.G.; Schifflers, M.C.; Mohnen, M.; Gressner, A.M.; Weiskirchen, R. A novel proximal- 13914G>A base replacement in the vicinity of the common-13910T/C lactase gene variation results in an atypical LightCycler melting curve in testing with the MutaREAL Lactase test. Clin. Chem. 2007, 53, 146–148. [Google Scholar] [CrossRef]
- Ingram, C.J.; Elamin, M.F.; Mulcare, C.A.; Weale, M.E.; Tarekegn, A.; Raga, T.O.; Bekele, E.; Elamin, F.M.; Thomas, M.G.; Bradman, N.; et al. A novel polymorphism associated with lactose tolerance in Africa: Multiple causes for lactase persistence? Hum. Genet. 2007, 120, 779–788. [Google Scholar] [CrossRef]
- Tishkoff, S.A.; Reed, F.A.; Ranciaro, A.; Voight, B.F.; Babbitt, C.C.; Silverman, J.S.; Powell, K.; Mortensen, H.M.; Hirbo, J.B.; Osman, M.; et al. Convergent adaptation of human lactase persistence in Africa and Europe. Nat. Genet. 2007, 39, 31–40. [Google Scholar] [CrossRef]
- Szilagyi, A.; Galiatsatos, P.; Xue, X. Systematic review and meta-analysis of lactose digestion, its impact on intolerance and nutritional effects of dairy food restriction in inflammatory bowel diseases. Nutr. J. 2016, 15, 67. [Google Scholar] [CrossRef] [PubMed]
- Eadala, P.; Matthews, S.B.; Waud, J.P.; Green, J.T.; Campbell, A.K. Association of lactose sensitivity with inflammatory bowel disease--demonstrated by analysis of genetic polymorphism, breath gases and symptoms. Aliment. Pharmacol. Ther. 2011, 34, 735–746. [Google Scholar] [CrossRef]
- Ratajczak, A.E.; Rychter, A.M.; Zawada, A.; Dobrowolska, A.; Krela-Kazmierczak, I. Lactose intolerance in patients with inflammatory bowel diseases and dietary management in prevention of osteoporosis. Nutrition 2021, 82, 111043. [Google Scholar] [CrossRef] [PubMed]
- Jasielska, M.; Grzybowska-Chlebowczyk, U. Lactose Malabsorption and Lactose Intolerance in Children with Inflammatory Bowel Diseases. Gastroenterol. Res. Pract. 2019, 2019, 2507242. [Google Scholar] [CrossRef]
- Lomer, M.C.; Parkes, G.C.; Sanderson, J.D. Review article: Lactose intolerance in clinical practice--myths and realities. Aliment. Pharmacol. Ther. 2008, 27, 93–103. [Google Scholar] [CrossRef]
- Ridefelt, P.; Hakansson, L.D. Lactose intolerance: Lactose tolerance test versus genotyping. Scand. J. Gastroenterol. 2005, 40, 822–826. [Google Scholar] [CrossRef]
- Santonocito, C.; Scapaticci, M.; Guarino, D.; Annicchiarico, E.B.; Lisci, R.; Penitente, R.; Gasbarrini, A.; Zuppi, C.; Capoluongo, E. Lactose intolerance genetic testing: Is it useful as routine screening? Results on 1426 south-central Italy patients. Clin. Chim. Acta 2015, 439, 14–17. [Google Scholar] [CrossRef]
- Buning, C.; Ockenga, J.; Kruger, S.; Jurga, J.; Baier, P.; Dignass, A.; Vogel, A.; Strassburg, C.; Weltrich, R.; Genschel, J.; et al. The C/C(-13910) and G/G(-22018) genotypes for adult-type hypolactasia are not associated with inflammatory bowel disease. Scand. J. Gastroenterol. 2003, 38, 538–542. [Google Scholar] [CrossRef]
- Di Stefano, M.; Terulla, V.; Tana, P.; Mazzocchi, S.; Romero, E.; Corazza, G.R. Genetic test for lactase non-persistence and hydrogen breath test: Is genotype better than phenotype to diagnose lactose malabsorption? Dig. Liver Dis. 2009, 41, 474–479. [Google Scholar] [CrossRef] [PubMed]
- Roccarina, D.; Lauritano, E.C.; Gabrielli, M.; Franceschi, F.; Ojetti, V.; Gasbarrini, A. The role of methane in intestinal diseases. Am. J. Gastroenterol. 2010, 105, 1250–1256. [Google Scholar] [CrossRef] [PubMed]
- Glassner, K.L.; Abraham, B.P.; Quigley, E.M.M. The microbiome and inflammatory bowel disease. J. Allergy Clin. Immunol. 2020, 145, 16–27. [Google Scholar] [CrossRef]
- Corgneau, M.; Scher, J.; Ritie-Pertusa, L.; Le, D.T.L.; Petit, J.; Nikolova, Y.; Banon, S.; Gaiani, C. Recent advances on lactose intolerance: Tolerance thresholds and currently available answers. Crit. Rev. Food Sci. Nutr. 2017, 57, 3344–3356. [Google Scholar] [CrossRef]
- Hwang, C.; Ross, V.; Mahadevan, U. Popular exclusionary diets for inflammatory bowel disease: The search for a dietary culprit. Inflamm. Bowel. Dis. 2014, 20, 732–741. [Google Scholar] [CrossRef] [PubMed]
- Testa, A.; Imperatore, N.; Rispo, A.; Rea, M.; Tortora, R.; Nardone, O.M.; Lucci, L.; Accarino, G.; Caporaso, N.; Castiglione, F. Beyond Irritable Bowel Syndrome: The Efficacy of the Low Fodmap Diet for Improving Symptoms in Inflammatory Bowel Diseases and Celiac Disease. Dig. Dis. 2018, 36, 271–280. [Google Scholar] [CrossRef] [PubMed]
- Triggs, C.M.; Munday, K.; Hu, R.; Fraser, A.G.; Gearry, R.B.; Barclay, M.L.; Ferguson, L.R. Dietary factors in chronic inflammation: Food tolerances and intolerances of a New Zealand Caucasian Crohn’s disease population. Mutat. Res. 2010, 690, 123–138. [Google Scholar] [CrossRef]
- Labayen, I.; Forga, L.; Gonzalez, A.; Lenoir-Wijnkoop, I.; Nutr, R.; Martinez, J.A. Relationship between lactose digestion, gastrointestinal transit time and symptoms in lactose malabsorbers after dairy consumption. Aliment. Pharmacol. Ther. 2001, 15, 543–549. [Google Scholar] [CrossRef] [PubMed]
- Pelletier, X.; Laure-Boussuge, S.; Donazzolo, Y. Hydrogen excretion upon ingestion of dairy products in lactose-intolerant male subjects: Importance of the live flora. Eur. J. Clin. Nutr. 2001, 55, 509–512. [Google Scholar] [CrossRef]
- Dekker, P.J.T.; Koenders, D.; Bruins, M.J. Lactose-Free Dairy Products: Market Developments, Production, Nutrition and Health Benefits. Nutrients 2019, 11, 551. [Google Scholar] [CrossRef] [PubMed]
- Laing, B.B.; Lim, A.G.; Ferguson, L.R. A Personalised Dietary Approach-A Way Forward to Manage Nutrient Deficiency, Effects of the Western Diet, and Food Intolerances in Inflammatory Bowel Disease. Nutrients 2019, 11, 1532. [Google Scholar] [CrossRef] [PubMed]


| IBD * (n = 54) | Control Group (n = 69) | p Value | ||
|---|---|---|---|---|
| Males, n ξ (%) | 20 (37%) | 26 (37.7%) | 0.9 | |
| Mean age, years ± SD β | 37.3 ± 14.7 | 37.8 ± 15.2 | 0.8 | |
| BMI ¥ (mean Kg/m2 ± SD) | 24.07 ± 4.04 | 23.5 ± 4.01 | 0.4 | |
| Smoking habits | Yes, n (%) | 9 (16.7%) | 10 (14.5%) | 0.8 |
| No/Ex, n (%) | 45 (83.3%) | 59 (85.5%) | 0.1 | |
| Symptoms | Abdominal pain, n (%) | 15 (27.8%) | 19 (27.5%) | 0.4 |
| Diarrhoea, n (%) | 16 (29.6%) | 20 (29%) | 0.6 | |
| Bloating, n (%) | 23 (42.6%) | 30 (43.5%) | 0.3 | |
| Crohn’s disease, n (%) | 22 (40.7%) | |||
| Ulcerative colitis, n (%) | 32 (59.3%) | |||
| Montreal Classification | L1 ° | 16 (72.7%) | ||
| L2 °° | 1 (4.5%) | |||
| L3 °°° | 5 (22.7%) | |||
| L4 °°°° | 0 | |||
| E1 ץ | 11 (34.4%) | |||
| E2 ץץ | 9 (28.1%) | |||
| E3 ץץץ | 12 (37.5%) | |||
| Medications | Mesalamine, n (%) | 42 (77.8%) | ||
| Steroids, n (%) | 3 (5.6%) | |||
| Immunosuppressants, n (%) | 3 (5.6%) | |||
| Biologics, n (%) | 7 (12.9%) | |||
| Antibiotics, n (%) | 2 (3.7%) | |||
| Positive H-BT ¶, n (%) | 35 (64.8%) | 43 (62.3%) | 0.3 | |
| Genetics, n (%) | Wild type | 46 (85.2%) | 60 (87%) | 0.1 |
| CT-22018 | 5 (9.3%) | 4 (5.8%) | 0.8 | |
| AG-13910 | 1 (1.8%) | 4 (5.8%) | 0.3 | |
| CT-22018/AG-13910 | 2 (3.7%) | 1 (1.4%) | 0.6 | |
| IBD | Control | |||
|---|---|---|---|---|
| H-BT + | H-BT − | H-BT + | H-BT − | |
| Symptoms | 25 (72%) | 8 (42%) | 29 (68%) | 9 (34%) |
| No symptoms | 10 (28%) | 11 (58%) | 14 (32%) | 17 (66%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nardone, O.M.; Manfellotto, F.; D’Onofrio, C.; Rocco, A.; Annona, G.; Sasso, F.; De Luca, P.; Imperatore, N.; Testa, A.; de Sire, R.; et al. Lactose Intolerance Assessed by Analysis of Genetic Polymorphism, Breath Test and Symptoms in Patients with Inflammatory Bowel Disease. Nutrients 2021, 13, 1290. https://doi.org/10.3390/nu13041290
Nardone OM, Manfellotto F, D’Onofrio C, Rocco A, Annona G, Sasso F, De Luca P, Imperatore N, Testa A, de Sire R, et al. Lactose Intolerance Assessed by Analysis of Genetic Polymorphism, Breath Test and Symptoms in Patients with Inflammatory Bowel Disease. Nutrients. 2021; 13(4):1290. https://doi.org/10.3390/nu13041290
Chicago/Turabian StyleNardone, Olga Maria, Francesco Manfellotto, Caterina D’Onofrio, Alba Rocco, Giovanni Annona, Francesca Sasso, Pasquale De Luca, Nicola Imperatore, Anna Testa, Roberto de Sire, and et al. 2021. "Lactose Intolerance Assessed by Analysis of Genetic Polymorphism, Breath Test and Symptoms in Patients with Inflammatory Bowel Disease" Nutrients 13, no. 4: 1290. https://doi.org/10.3390/nu13041290
APA StyleNardone, O. M., Manfellotto, F., D’Onofrio, C., Rocco, A., Annona, G., Sasso, F., De Luca, P., Imperatore, N., Testa, A., de Sire, R., Biffali, E., & Castiglione, F. (2021). Lactose Intolerance Assessed by Analysis of Genetic Polymorphism, Breath Test and Symptoms in Patients with Inflammatory Bowel Disease. Nutrients, 13(4), 1290. https://doi.org/10.3390/nu13041290

