Effects of Early-Life Stress, Postnatal Diet Modulation and Long-Term Western-Style Diet on Peripheral and Central Inflammatory Markers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Breeding
2.2. Early-Life Stress (ES) Paradigm
2.3. Experimental Diets
2.4. Tissue Collection
2.5. Real-Time PCR
2.6. Immunohistochemistry
2.7. Quantification of Iba1 Coverage and Cell Density
2.8. Statistical Analysis
3. Results
3.1. ES Exposure Alters the Peripheral and Central Inflammatory Profile at P9
3.2. Effects of Early-Life Stress and Postnatal Diet on Adolescent Adipose Tissue Inflammatory Markers
3.3. Prolonged WSD Increases Inflammatory Markers in Adipose Tissue and Amoeboid Microglia Numbers in the Hypothalamus
3.4. Effects of ES and Postnatal Diet on Adult Adipose Tissue Inflammatory Markers and Hypothalamic Microglia under STD and WSD
4. Discussion
4.1. Prolonged WSD Exposure Leads to a Mild Inflammatory Phenotype in Control Animals
4.2. Effects of ES and Nuturis® on Peripheral Inflammation under STD and Prolonged WSD Exposure
4.3. ES and Nuturis® Lastingly Affect Hypothalamic Microglia under STD and Prolonged WSD Exposure
5. Conclusions
6. Patents
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Cordain, L.; Eaton, S.B.; Sebastian, A.; Mann, N.; Lindeberg, S.; Watkins, B.A.; O’Keefe, J.H.; Brand-Miller, J. Origins and evolution of the Western diet: Health implications for the 21st century. Am. J. Clin. Nutr. 2005, 81, 341–354. [Google Scholar] [CrossRef] [PubMed]
- Mozaffarian, D.; Hao, T.; Rimm, E.B.; Willett, W.C.; Hu, F.B. Changes in Diet and Lifestyle and Long-Term Weight Gain in Women and Men. N. Engl. J. Med. 2011, 364, 2392–2404. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bouret, S.G. Early life origins of obesity: Role of hypothalamic programming. J. Pediatr. Gastroenterol. Nutr. 2009, 48, S31–S38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Levin, B.E. Metabolic imprinting: Critical impact of the perinatal environment on the regulation of energy homeostasis. Phil. Trans. R. Soc. B 2006, 361, 1107–1121. [Google Scholar] [CrossRef] [Green Version]
- Bouret, S.G.; Simerly, R.B. Developmental programming of hypothalamic feeding circuits. Clin. Genet. 2006, 70, 295–301. [Google Scholar] [CrossRef]
- Symonds, M.E.; Pope, M.; Sharkey, D.; Budge, H. Adipose tissue and fetal programming. Diabetologia 2012, 55, 1597–1606. [Google Scholar] [CrossRef] [Green Version]
- Danese, A.; Tan, M. Childhood maltreatment and obesity: Systematic review and meta-analysis. Mol. Psychiatry 2014, 19, 544–554. [Google Scholar] [CrossRef] [PubMed]
- Alciati, A.; Gesuele, F.; Casazza, G.; Foschi, D. The relationship between childhood parental loss and metabolic syndrome in obese subjects. Stress Health 2013, 29, 5–13. [Google Scholar] [CrossRef] [PubMed]
- Williamson, D.F.; Thompson, T.J.; Anda, R.F.; Dietz, W.H.; Felitti, V. Body weight and obesity in adults and self-reported abuse in childhood. Int. J. Obes. 2002, 26, 1075–1082. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yam, K.Y.; Naninck, E.F.G.; Abbink, M.R.; La Fleur, S.E.; Schipper, L.; Beukel, J.C.V.D.; Grefhorst, A.; Oosting, A.; Van Der Beek, E.M.; Lucassen, P.J.; et al. Exposure to chronic early-life stress lastingly alters the adipose tissue, the leptin system and changes the vulnerability to western-style diet later in life in mice. Psychoneuroendocrinology 2017, 77, 186–195. [Google Scholar] [CrossRef]
- Murphy, M.O.; Herald, J.B.; Wills, C.T.; Unfried, S.G.; Cohn, D.M.; Loria, A.S. Postnatal treatment with metyrapone attenuates the effects of diet-induced obesity in female rats exposed to early-life stress. Am. J. Physiol. Metab. 2016. [Google Scholar] [CrossRef] [PubMed]
- Roseboom, T.; de Rooij, S.; Painter, R. The Dutch famine and its long-term consequences for adult health. Early Hum. Dev. 2006, 82, 485–491. [Google Scholar] [CrossRef] [PubMed]
- Koupil, I.; Toivanen, P. Social and early-life determinants of overweight and obesity in 18-year-old Swedish men. Int. J. Obes. 2008, 32, 73–81. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gouazé, A.; Brenachot, X.; Rigault, C.; Krezymon, A.; Rauche, C.; Nédélec, E.; Lemoine, A.; Gascuel, J.; Bauer, S.; Pénicaud, L.; et al. Cerebral Cell Renewal in Adult Mice Controls the Onset of Obesity. PLoS ONE 2013, 8, e72029. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Kaur, H.; Choi, W.S.; Huang, T.T.-K.; Lee, R.E.; Ahluwalia, J.S. Additive interactions of maternal prepregnancy BMI and breast-feeding on childhood overweight. Obes. Res. 2005, 13, 362–371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mosca, F.; Giannì, M.L. Human milk: Composition and health benefits. Pediatr. Med. Chir. 2017, 39, 155. [Google Scholar] [CrossRef] [Green Version]
- Dewey, K.G. Is breastfeeding protective against child obesity? J. Hum. Lact. 2003, 19, 9–18. [Google Scholar] [CrossRef]
- Ip, S.; Chung, M.; Raman, G.; Chew, P.; Magula, N.; Devine, D.; Trikalinos, T.; Lau, J. Breastfeeding and maternal and infant health outcomes in developed countries. Evid. Rep. Technol. Assess. (Full. Rep). 2007, 1–186. [Google Scholar] [CrossRef]
- Horta, B.L.; Loret De Mola, C.; Victora, C.G. Long-term consequences of breastfeeding on cholesterol, obesity, systolic blood pressure and type 2 diabetes: A systematic review and meta-analysis. Acta Paediatr. Int. J. Paediatr. 2015, 104, 30–37. [Google Scholar] [CrossRef]
- Mayer-Davis, E.J.; Rifas-Shiman, S.L.; Zhou, L.; Hu, F.B.; Colditz, G.A.; Gillman, M.W. Breast-Feeding and Risk for Childhood Obesity: Does maternal diabetes or obesity status matter? Diabetes Care 2006, 29, 2231–2237. [Google Scholar] [CrossRef] [Green Version]
- Spitsberg, V.L. Invited review: Bovine milk fat globule membrane as a potential nutraceutical. J. Dairy Sci. 2005, 88, 2289–2294. [Google Scholar] [CrossRef]
- Michalski, M.C.; Briard, V.; Michel, F.; Tasson, F.; Poulain, P. Size distribution of fat globules in human colostrum, breast milk, and infant formula. J. Dairy Sci. 2005, 88, 1927–1940. [Google Scholar] [CrossRef] [Green Version]
- Baars, A.; Oosting, A.; Engels, E.; Kegler, D.; Kodde, A.; Schipper, L.; Verkade, H.J.; Van Der Beek, E.M. Milk fat globule membrane coating of large lipid droplets in the diet of young mice prevents body fat accumulation in adulthood. Br. J. Nutr. 2016, 115, 1930–1937. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oosting, A.; Van Vlies, N.; Kegler, D.; Schipper, L.; Abrahamse-Berkeveld, M.; Ringler, S.; Verkade, H.J.; Van Der Beek, E.M. Effect of dietary lipid structure in early postnatal life on mouse adipose tissue development and function in adulthood. Br. J. Nutr. 2014, 111, 215–226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oosting, A.; Kegler, D.; Wopereis, H.J.; Teller, I.C.; Van De Heijning, B.J.M.; Verkade, H.J.; Van Der Beek, E.M. Size and phospholipid coating of lipid droplets in the diet of young mice modify body fat accumulation in adulthood. Pediatr. Res. 2012, 72, 362–369. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abbink, M.R.; Schipper, L.; Naninck, E.F.G.; de Vos, C.M.H.; Meier, R.; van der Beek, E.M.; Lucassen, P.J.; Korosi, A. The effects of early life stress, postnatal diet modulation, and long-term western-style diet on later-life metabolic and cognitive outcomes. Nutrients 2020, 12, 570. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ronda, O.A.H.O.; Van De Heijning, B.J.M.; De Bruin, A.; Jurdzinski, A.; Kuipers, F.; Verkade, H.J. Programming effects of an early life diet containing large phospholipid-coated lipid globules are transient under continuous exposure to a high-fat diet. Br. J. Nutr. 2019, 122, 1321–1328. [Google Scholar] [CrossRef] [Green Version]
- Yam, K.Y.; Ruigrok, S.R.; Ziko, I.; De Luca, S.N.; Lucassen, P.J.; Spencer, S.J.; Korosi, A. Ghrelin and hypothalamic NPY/AgRP expression in mice are affected by chronic early-life stress exposure in a sex-specific manner. Psychoneuroendocrinology 2017, 86, 73–77. [Google Scholar] [CrossRef]
- Schipper, L.; Bouyer, K.; Oosting, A.; Simerly, R.B.; Van Der Beek, E.M. Postnatal dietary fatty acid composition permanently affects the structure of hypothalamic pathways controlling energy balance in mice1-3. Am. J. Clin. Nutr. 2013, 98, 1395–1401. [Google Scholar] [CrossRef] [Green Version]
- Weisberg, S.P.; McCann, D.; Desai, M.; Rosenbaum, M.; Leibel, R.L.; Ferrante, A.W. Obesity is associated with macrophage accumulation in adipose tissue. J. Clin. Investig. 2003, 112, 1796–1808. [Google Scholar] [CrossRef]
- Ouchi, N.; Parker, J.L.; Lugus, J.J.; Walsh, K. Adipokines in inflammation and metabolic disease. Nat. Rev. Immunol. 2011, 11, 85–97. [Google Scholar] [CrossRef] [PubMed]
- Mraz, M.; Haluzik, M. The role of adipose tissue immune cells in obesity and low-grade inflammation. J. Endocrinol. 2014, 222, 113–127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Souza, C.T.; Araujo, E.P.; Bordin, S.; Ashimine, R.; Zollner, R.L.; Boschero, A.C.; Saad, M.J.A.; Velloso, L.A. Consumption of a fat-rich diet activates a proinflammatory response and induces insulin resistance in the hypothalamus. Endocrinology 2005, 146, 4192–4199. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kälin, S.; Heppner, F.L.; Bechmann, I.; Prinz, M.; Tschöp, M.H.; Yi, C.X. Hypothalamic innate immune reaction in obesity. Nat. Rev. Endocrinol. 2015, 11, 339–351. [Google Scholar] [CrossRef] [Green Version]
- Dorfman, M.D.; Thaler, J.P. Hypothalamic inflammation and gliosis in obesity. Curr. Opin. Endocrinol. Diabetes Obes. 2015, 22, 325–330. [Google Scholar] [CrossRef] [Green Version]
- Thaler, J.P.; Yi, C.X.; Schur, E.A.; Guyenet, S.J.; Hwang, B.H.; Dietrich, M.O.; Zhao, X.; Sarruf, D.A.; Izgur, V.; Maravilla, K.R.; et al. Obesity is associated with hypothalamic injury in rodents and humans. J. Clin. Investig. 2012, 122, 153–162. [Google Scholar] [CrossRef] [Green Version]
- Benzler, J.; Ganjam, G.K.; Pretz, D.; Oelkrug, R.; Koch, C.E.; Legler, K.; Stöhr, S.; Culmsee, C.; Williams, L.M.; Tups, A. Central inhibition of IKKβ/NF-κB signaling attenuates high-fat diet-induced obesity and glucose intolerance. Diabetes 2015, 64, 2015–2027. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.D.; Yoon, N.A.; Jin, S.; Diano, S. Microglial UCP2 Mediates Inflammation and Obesity Induced by High-Fat Feeding. Cell Metab. 2019, 30, 952–962.e5. [Google Scholar] [CrossRef]
- Baumeister, D.; Akhtar, R.; Ciufolini, S.; Pariante, C.M.; Mondelli, V. Childhood trauma and adulthood inflammation: A meta-analysis of peripheral C-reactive protein, interleukin-6 and tumour necrosis factor-α. Mol. Psychiatry 2016, 21, 642–649. [Google Scholar] [CrossRef] [Green Version]
- Bücker, J.; Fries, G.R.; Kapczinski, F.; Post, R.M.; Yatham, L.N.; Vianna, P.; Bogo Chies, J.A.; Gama, C.S.; Magalhães, P.V.; Aguiar, B.W.; et al. Brain-derived neurotrophic factor and inflammatory markers in school-aged children with early trauma. Acta Psychiatr. Scand. 2015, 131, 360–368. [Google Scholar] [CrossRef]
- Coelho, R.; Viola, T.W.; Walss-Bass, C.; Brietzke, E.; Grassi-Oliveira, R. Childhood maltreatment and inflammatory markers: A systematic review. Acta Psychiatr. Scand. 2014, 129, 180–192. [Google Scholar] [CrossRef]
- Tyrka, A.R.; Parade, S.H.; Valentine, T.R.; Eslinger, N.M.; Seifer, R. Adversity in preschool-aged children: Effects on salivary interleukin-1β. Dev. Psychopathol. 2015, 27, 567–576. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoeijmakers, L.; Ruigrok, S.R.; Amelianchik, A.; Ivan, D.; van Dam, A.-M.; Lucassen, P.J.; Korosi, A. Early-life stress lastingly alters the neuroinflammatory response to amyloid pathology in an Alzheimer’s disease mouse model. Brain. Behav. Immun. 2016. [Google Scholar] [CrossRef] [PubMed]
- Diz-Chaves, Y.; Astiz, M.; Bellini, M.J.; Garcia-Segura, L.M. Prenatal stress increases the expression of proinflammatory cytokines and exacerbates the inflammatory response to LPS in the hippocampal formation of adult male mice. Brain Behav. Immun. 2013, 28, 196–206. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Delpech, J.-C.; Wei, L.; Hao, J.; Yu, X.; Madore, C.; Butovsky, O.; Kaffman, A. Early life stress perturbs the maturation of microglia in the developing hippocampus. Brain Behav. Immun. 2016, 57, 79–93. [Google Scholar] [CrossRef] [Green Version]
- Roque, A.; Ochoa-Zarzosa, A.; Torner, L. Maternal separation activates microglial cells and induces an inflammatory response in the hippocampus of male rat pups, independently of hypothalamic and peripheral cytokine levels. Brain Behav. Immun. 2016, 55, 39–48. [Google Scholar] [CrossRef] [PubMed]
- Naninck, E.F.G.G.; Hoeijmakers, L.; Kakava-Georgiadou, N.; Meesters, A.; Lazic, S.E.; Lucassen, P.J.; Korosi, A. Chronic early life stress alters developmental and adult neurogenesis and impairs cognitive function in mice. Hippocampus 2015, 25, 309–328. [Google Scholar] [CrossRef] [PubMed]
- Rice, C.J.; Sandman, C.A.; Lenjavi, M.R.; Baram, T.Z. A novel mouse model for acute and long-lasting consequences of early life stress. Endocrinology 2008, 149, 4892–4900. [Google Scholar] [CrossRef] [Green Version]
- Reeves, P.G.; Nielsen, F.H.; Fahey, G.C. AIN-93 purified diets for laboratory rodents: Final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. J. Nutr. 1993, 123, 1939–1951. [Google Scholar] [CrossRef]
- Bjørndal, B.; Burri, L.; Staalesen, V.; Skorve, J.; Berge, R.K. Different adipose depots: Their role in the development of metabolic syndrome and mitochondrial response to hypolipidemic agents. J. Obes. 2011, 2011. [Google Scholar] [CrossRef] [Green Version]
- Karperien, A.; Ahammer, H.; Jelinek, H.F. Quantitating the subtleties of microglial morphology with fractal analysis. Front. Cell. Neurosci. 2013, 7. [Google Scholar] [CrossRef] [Green Version]
- Sominsky, L.; De Luca, S.; Spencer, S.J. Microglia: Key players in neurodevelopment and neuronal plasticity. Int. J. Biochem. Cell Biol. 2018, 94, 56–60. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, J.M.; Sholar, P.W.; Bilbo, S.D. Sex differences in microglial colonization of the developing rat brain. J. Neurochem. 2012, 120, 948–963. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Maratos-Flier, E.; Flier, J.S. Reduced adiposity and high-fat diet-induced adipose inflammation in mice deficient for phosphodiesterase 4B. Endocrinology 2009, 150, 3076–3082. [Google Scholar] [CrossRef] [Green Version]
- Gao, M.; Ma, Y.; Liu, D. High-fat diet-induced adiposity, adipose inflammation, hepatic steatosis and hyperinsulinemia in outbred CD-1 mice. PLoS ONE 2015, 10, e0119784. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kawanishi, N.; Yano, H.; Yokogawa, Y.; Suzuki, K. Exercise training inhibits inflammation in adipose tissue via both suppression of macrophage infiltration and acceleration of phenotypic switching from M1 to M2 macrophages in high-fat-diet-induced obese mice. Exerc. Immunol. Rev. 2010, 16, 105–118. [Google Scholar] [PubMed]
- Valdearcos, M.; Robblee, M.M.; Benjamin, D.I.; Nomura, D.K.; Xu, A.W.; Koliwad, S.K. Microglia Dictate the Impact of Saturated Fat Consumption on Hypothalamic Inflammation and Neuronal Function. Cell Rep. 2014, 9, 2124–2138. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miao, H.; Ou, J.; Ma, Y.; Guo, F.; Yang, Z.; Wiggins, M.; Liu, C.; Song, W.; Han, X.; Wang, M.; et al. Macrophage CGI-58 deficiency activates ros-inflammasome pathway to promote insulin resistance in mice. Cell Rep. 2014, 7, 223–235. [Google Scholar] [CrossRef] [Green Version]
- Lumeng, C.N.; Bodzin, J.L.; Saltiel, A.R. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J. Clin. Investig. 2007, 117, 175–184. [Google Scholar] [CrossRef] [Green Version]
- Kamei, N.; Tobe, K.; Suzuki, R.; Ohsugi, M.; Watanabe, T.; Kubota, N.; Ohtsuka-Kowatari, N.; Kumagai, K.; Sakamoto, K.; Kobayashi, M.; et al. Overexpression of Monocyte Chemoattractant Protein-1 in Adipose Tissues Causes Macrophage Recruitment and Insulin Resistance * Downloaded from. J. Biol. Chem. 2006, 281, 26602–26614. [Google Scholar] [CrossRef] [Green Version]
- Rull, A.; Camps, J.; Alonso-Villaverde, C.; Joven, J. Insulin resistance, inflammation, and obesity: Role of monocyte chemoattractant protein-1 (orCCL2) in the regulation of metabolism. Mediat. Inflamm. 2010, 2010, 326580. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fu, R.; Shen, Q.; Xu, P.; Luo, J.J.; Tang, Y. Phagocytosis of microglia in the central nervous system diseases. Mol. Neurobiol. 2014, 49, 1422–1434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morrison, K.E.; Jašarević, E.; Howard, C.D.; Bale, T.L. It’s the fiber, not the fat: Significant effects of dietary challenge on the gut microbiome. Microbiome 2020, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, M.J.; Pramyothin, P.; Karastergiou, K.; Fried, S.K. Deconstructing the roles of glucocorticoids in adipose tissue biology and the development of central obesity. Biochim. Biophys. Acta Mol. Basis Dis. 2014, 1842, 473–481. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rebuffé-Scrive, M.; Walsh, U.A.; McEwen, B.; Rodin, J. Effect of chronic stress and exogenous glucocorticoids on regional fat distribution and metabolism. Physiol. Behav. 1992, 52, 583–590. [Google Scholar] [CrossRef]
- de Kloet, A.D.; Krause, E.G.; Solomon, M.B.; Flak, J.N.; Scott, K.A.; Kim, D.H.; Myers, B.; Ulrich-Lai, Y.M.; Woods, S.C.; Seeley, R.J.; et al. Adipocyte glucocorticoid receptors mediate fat-to-brain signaling. Psychoneuroendocrinology 2015, 56, 110–119. [Google Scholar] [CrossRef] [Green Version]
- Peckett, A.J.; Wright, D.C.; Riddell, M.C. The effects of glucocorticoids on adipose tissue lipid metabolism. Metab. Clin. Exp. 2011, 60, 1500–1510. [Google Scholar] [CrossRef]
- Miyata, M.; Lee, J.Y.; Susuki-Miyata, S.; Wang, W.Y.; Xu, H.; Kai, H.; Kobayashi, K.S.; Flavell, R.A.; Li, J.D. Glucocorticoids suppress inflammation via the upregulation of negative regulator IRAK-M. Nat. Commun. 2015, 6, 6062. [Google Scholar] [CrossRef] [Green Version]
- Patsouris, D.; Neels, J.G.; Fan, W.Q.; Li, P.P.; Nguyen, M.T.A.; Olefsky, J.M. Glucocorticoids and thiazolidinediones interfere with adipocyte-mediated macrophage chemotaxis and recruitment. J. Biol. Chem. 2009, 284, 31223–31235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- do Prado, C.H.; Narahari, T.; Holland, F.H.; Lee, H.N.; Murthy, S.K.; Brenhouse, H.C. Effects of early adolescent environmental enrichment on cognitive dysfunction, prefrontal cortex development, and inflammatory cytokines after early life stress. Dev. Psychobiol. 2016, 58, 482–491. [Google Scholar] [CrossRef]
- Mangan, M.S.J.; Olhava, E.J.; Roush, W.R.; Seidel, H.M.; Glick, G.D.; Latz, E. Targeting the NLRP3 inflammasome in inflammatory diseases. Nat. Rev. Drug Discov. 2018, 17, 588–606. [Google Scholar] [CrossRef] [PubMed]
- Bauernfeind, F.G.; Horvath, G.; Stutz, A.; Alnemri, E.S.; MacDonald, K.; Speert, D.; Fernandes-Alnemri, T.; Wu, J.; Monks, B.G.; Fitzgerald, K.A.; et al. Cutting Edge: NF-κB Activating Pattern Recognition and Cytokine Receptors License NLRP3 Inflammasome Activation by Regulating NLRP3 Expression. J. Immunol. 2009, 183, 787–791. [Google Scholar] [CrossRef] [PubMed]
- Vandanmagsar, B.; Youm, Y.H.; Ravussin, A.; Galgani, J.E.; Stadler, K.; Mynatt, R.L.; Ravussin, E.; Stephens, J.M.; Dixit, V.D. The NLRP3 inflammasome instigates obesity-induced inflammation and insulin resistance. Nat. Med. 2011, 17, 179–189. [Google Scholar] [CrossRef] [PubMed]
- Reynolds, C.M.; Mcgillicuddy, F.C.; Harford, K.A.; Finucane, O.M.; Mills, K.H.G.; Roche, H.M. Dietary saturated fatty acids prime the NLRP3 inflammasome via TLR4 in dendritic cells-implications for diet-induced insulin resistance. Mol. Nutr. Food Res. 2012, 56, 1212–1222. [Google Scholar] [CrossRef]
- Ralston, J.C.; Lyons, C.L.; Kennedy, E.B.; Kirwan, A.M.; Roche, H.M. Fatty Acids and NLRP3 Inflammasome-Mediated Inflammation in Metabolic Tissues. Annu. Rev. Nutr. 2017, 37, 77–102. [Google Scholar] [CrossRef]
- Alliot, F.; Godin, I.; Pessac, B. Microglia derive from progenitors, originating from the yolk sac, and which proliferate in the brain. Dev. Brain Res. 1999, 117, 145–152. [Google Scholar] [CrossRef]
- Matcovitch-Natan, O.; Winter, D.R.; Giladi, A.; Aguilar, S.V.; Spinrad, A.; Sarrazin, S.; Ben-Yehuda, H.; David, E.; González, F.Z.; Perrin, P.; et al. Microglia development follows a stepwise program to regulate brain homeostasis. Science 2016, 353, aad8670. [Google Scholar] [CrossRef]
- Reemst, K.; Noctor, S.C.; Lucassen, P.J.; Hol, E.M. The indispensable roles of microglia and astrocytes during brain development. Front. Hum. Neurosci. 2016, 10, 566. [Google Scholar] [CrossRef] [Green Version]
- Schwarz, J.M.; Bilbo, S.D. Sex, glia, and development: Interactions in health and disease. Horm. Behav. 2012, 62, 243–253. [Google Scholar] [CrossRef] [Green Version]
- Nair, A.; Bonneau, R.H. Stress-induced elevation of glucocorticoids increases microglia proliferation through NMDA receptor activation. J. Neuroimmunol. 2006, 171, 72–85. [Google Scholar] [CrossRef]
- Nakatani, Y.; Amano, T.; Tsuji, M.; Takeda, H. Corticosterone suppresses the proliferation of BV2 microglia cells via glucocorticoid, but not mineralocorticoid receptor. Life Sci. 2012, 91, 761–770. [Google Scholar] [CrossRef] [PubMed]
- Szczesny, E.; Basta-Kaim, A.; Slusarczyk, J.; Trojan, E.; Glombik, K.; Regulska, M.; Leskiewicz, M.; Budziszewska, B.; Kubera, M.; Lason, W. The impact of prenatal stress on insulin-like growth factor-1 and pro-inflammatory cytokine expression in the brains of adult male rats: The possible role of suppressors of cytokine signaling proteins. J. Neuroimmunol. 2014, 276, 37–46. [Google Scholar] [CrossRef] [PubMed]
- Ziko, I.; De Luca, S.; Dinan, T.; Barwood, J.M.; Sominsky, L.; Cai, G.; Kenny, R.; Stokes, L.; Jenkins, T.A.; Spencer, S.J. Neonatal overfeeding alters hypothalamic microglial profiles and central responses to immune challenge long-term. Brain Behav. Immun. 2014, 41, 32–43. [Google Scholar] [CrossRef] [PubMed]
- Bourlieu, C.; Michalski, M.C. Structure-function relationship of the milk fat globule. Curr. Opin. Clin. Nutr. Metab. Care 2015, 18, 118–127. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Plakidas, A.; Lee, W.H.; Heikkinen, A.; Chanmugam, P.; Bray, G.; Hwang, D.H. Differential modulation of Toll-like receptors by fatty acids: Preferential inhibition by n-3 polyunsaturated fatty acids. J. Lipid Res. 2003, 44, 479–486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Serhan, C.N.; Chiang, N.; Van Dyke, T.E. Resolving inflammation: Dual anti-inflammatory and pro-resolution lipid mediators. Nat. Rev. Immunol. 2008, 8, 349–361. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rocha, D.M.; Caldas, A.P.; Oliveira, L.L.; Bressan, J.; Hermsdorff, H.H. Saturated fatty acids trigger TLR4-mediated inflammatory response. Atherosclerosis 2016, 244, 211–215. [Google Scholar] [CrossRef]
- Leyrolle, Q.; Layé, S.; Nadjar, A. Direct and indirect effects of lipids on microglia function. Neurosci. Lett. 2019, 708, 134348. [Google Scholar] [CrossRef]
- Galleguillos, D.; Wang, Q.; Steinberg, N.; Shrivastava, G.; Dhami, K.; Rubinstein, K.; Giuliani, F.; Churchward, M.; Power, C.; Todd, K.; et al. Anti-inflammatory role of GM1 and modulatory effects of gangliosides on microglia functions. bioRxiv 2020. [Google Scholar] [CrossRef] [Green Version]
- Boynton-Jarrett, R.; Fargnoli, J.; Suglia, S.F.; Zuckerman, B.; Wright, R.J. Association between maternal intimate partner violence and incident obesity in preschool-aged children: Results from the fragile families and child well-being study. Arch. Pediatr. Adolesc. Med. 2010, 164, 540–546. [Google Scholar] [CrossRef] [Green Version]
- Hay, D.F.; Pawlby, S.; Waters, C.S.; Sharp, D. Antepartum and postpartum exposure to maternal depression: Different effects on different adolescent outcomes. J. Child Psychol. Psychiatry Allied Discip. 2008, 49, 1079–1088. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.O.; Herald, J.B.; Leachman, J.; Villasante Tezanos, A.; Cohn, D.M.; Loria, A.S. A model of neglect during postnatal life heightens obesity-induced hypertension and is linked to a greater metabolic compromise in female mice. Int. J. Obes. 2018, 42, 1354–1365. [Google Scholar] [CrossRef] [PubMed]
- Bonapersona, V.; Kentrop, J.; Van Lissa, C.J.J.; van der Veen, R.; Joëls, M.; Sarabdjitsingh, R.A.A. The behavioral phenotype of early life adversity: A 3-level meta-analysis of rodent studies. Neurosci. Biobehav. Rev. 2019, 102, 299–307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dearden, L.; Bouret, S.G.; Ozanne, S.E. Sex and gender differences in developmental programming of metabolism. Mol. Metab. 2018, 15, 8–19. [Google Scholar] [CrossRef] [PubMed]
- Fuente-Martín, E.; Argente-Arizón, P.; Ros, P.; Argente, J.; Chowen, J.A. Sex differences in adipose tissue: It is not only a question of quantity and distribution. Adipocyte 2013, 2, 128–134. [Google Scholar] [CrossRef]
- Villa, A.; Gelosa, P.; Castiglioni, L.; Cimino, M.; Rizzi, N.; Pepe, G.; Lolli, F.; Marcello, E.; Sironi, L.; Vegeto, E.; et al. Sex-Specific Features of Microglia from Adult Mice. Cell Rep. 2018, 23, 3501–3511. [Google Scholar] [CrossRef]
- Dorfman, M.D.; Krull, J.E.; Douglass, J.D.; Fasnacht, R.; Lara-Lince, F.; Meek, T.H.; Shi, X.; Damian, V.; Nguyen, H.T.; Matsen, M.E.; et al. Sex differences in microglial CX3CR1 signalling determine obesity susceptibility in mice. Nat. Commun. 2017, 8, 14556. [Google Scholar] [CrossRef] [Green Version]
- Villa, A.; Della Torre, S.; Maggi, A. Sexual differentiation of microglia. Front. Neuroendocrinol. 2019, 52, 156–164. [Google Scholar] [CrossRef]
Gene | Pathway/Function | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|---|
CCL2 | Immune cell infiltration | AGCTGTAGTTTTTGTCACCAAGC | GTGCTGAAGACCTTAGGGCA |
CCR2 | Immune cell infiltration | AGGGAGACAGCAGATCGAGTG | ACAACCCAACCGAGACCTCTT |
F4/80 | Macrophage marker | TGTGTCGTGCTGTTCAGAACC | AGGATTCCCGCAATGATGG |
NLRP3 | Inflammasome | CAGCCAGAGTGGAATGACACG | GCGCGTTCCTGTCCTTGATA |
TNFα | Cytokine | GTAGCCCACGTCGTAGCAAAC | AGTTGGTTGTCTTTGAGATCCATG |
RPS29 | Reference gene | AGTCACCCACGGAAGTTCGG | GTCCAACTTAATGAAGCCTATGTCCTT |
RPL19 | Reference gene | TTGCCTCTAGTGTCCTCCGC | CTTCCTGATCTGCTGACGGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ruigrok, S.R.; Abbink, M.R.; Geertsema, J.; Kuindersma, J.E.; Stöberl, N.; van der Beek, E.M.; Lucassen, P.J.; Schipper, L.; Korosi, A. Effects of Early-Life Stress, Postnatal Diet Modulation and Long-Term Western-Style Diet on Peripheral and Central Inflammatory Markers. Nutrients 2021, 13, 288. https://doi.org/10.3390/nu13020288
Ruigrok SR, Abbink MR, Geertsema J, Kuindersma JE, Stöberl N, van der Beek EM, Lucassen PJ, Schipper L, Korosi A. Effects of Early-Life Stress, Postnatal Diet Modulation and Long-Term Western-Style Diet on Peripheral and Central Inflammatory Markers. Nutrients. 2021; 13(2):288. https://doi.org/10.3390/nu13020288
Chicago/Turabian StyleRuigrok, Silvie R., Maralinde R. Abbink, Jorine Geertsema, Jesse E. Kuindersma, Nina Stöberl, Eline M. van der Beek, Paul J. Lucassen, Lidewij Schipper, and Aniko Korosi. 2021. "Effects of Early-Life Stress, Postnatal Diet Modulation and Long-Term Western-Style Diet on Peripheral and Central Inflammatory Markers" Nutrients 13, no. 2: 288. https://doi.org/10.3390/nu13020288
APA StyleRuigrok, S. R., Abbink, M. R., Geertsema, J., Kuindersma, J. E., Stöberl, N., van der Beek, E. M., Lucassen, P. J., Schipper, L., & Korosi, A. (2021). Effects of Early-Life Stress, Postnatal Diet Modulation and Long-Term Western-Style Diet on Peripheral and Central Inflammatory Markers. Nutrients, 13(2), 288. https://doi.org/10.3390/nu13020288