Impaired CPT1A Gene Expression Response to Retinoic Acid Treatment in Human PBMC as Predictor of Metabolic Risk
Abstract
1. Introduction
2. Materials and Methods
2.1. Subjects
2.2. All-Trans Retinoic Acid Preparation
2.3. Isolation and Ex Vivo treatment of PBMCs
2.4. RNA Extraction and Real-Time Reverse Transcriptase Polymerase Chain Reaction (RT-qPCR)
2.5. Measurement of Produced Cytokines
2.6. Statistical Analysis
3. Results
3.1. Dose-Response Effects of ATRA on Gene Expression of Isolated Human PBMsC Maintained Ex Vivo
3.2. Gene Expression of RXRα and RARα in Isolated Human PBMCs Treated with ATRA
3.3. Gene Expression and Release of Inflammatory Markers in Isolated Human PBMCs Treated with ATRA
3.4. Gene Expression of Key Lipid Metabolism Genes in Isolated Human PBMC Treated with ATRA
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- O’Neill, S.; O’Driscoll, L. Metabolic syndrome: A closer look at the growing epidemic and its associated pathologies. Obes. Rev. An Off. J. Int. Assoc. Study Obes. 2015, 16, 1–12. [Google Scholar] [CrossRef]
- Leitner, D.R.; Fruhbeck, G.; Yumuk, V.; Schindler, K.; Micic, D.; Woodward, E.; Toplak, H. Obesity and Type 2 Diabetes: Two Diseases with a Need for Combined Treatment Strategies—EASO Can Lead the Way. Obes. Facts 2017, 10, 483–492. [Google Scholar] [CrossRef]
- Liew, C.C.; Ma, J.; Tang, H.C.; Zheng, R.; Dempsey, A.A. The peripheral blood transcriptome dynamically reflects system wide biology: A potential diagnostic tool. J. Lab. Clin. Med. 2006, 147, 126–132. [Google Scholar] [CrossRef]
- Reynés, B.; Priego, T.; Cifre, M.; Oliver, P.; Palou, A. Peripheral Blood Cells, a Transcriptomic Tool in Nutrigenomic and Obesity Studies: Current State of the Art. Comp. Rev. Food Sci. Food Saf. 2018, 17, 1006–1020. [Google Scholar] [CrossRef]
- Caimari, A.; Oliver, P.; Keijer, J.; Palou, A. Peripheral blood mononuclear cells as a model to study the response of energy homeostasis-related genes to acute changes in feeding conditions. OMICS 2010, 14, 129–141. [Google Scholar] [CrossRef] [PubMed]
- Caimari, A.; Oliver, P.; Rodenburg, W.; Keijer, J.; Palou, A. Slc27a2 expression in peripheral blood mononuclear cells as a molecular marker for overweight development. Int. J. Obes. 2010, 34, 831–839. [Google Scholar] [CrossRef] [PubMed]
- Sánchez, J.; Priego, T.; Picó, C.; Ahrens, W.; De Henauw, S.; Fraterman, A.; Mårild, S.; Molnár, D.; Moreno, L.A.; Peplies, J.; et al. Blood cells as a source of transcriptional biomarkers of childhood obesity and its related metabolic alterations: Results of the IDEFICS study. J. Clin. Endocrinol. Metab. 2012, 97, E648–E652. [Google Scholar] [CrossRef] [PubMed]
- Priego, T.; Sánchez, J.; Picó, C.; Ahrens, W.; De Henauw, S.; Kourides, Y.; Lissner, L.; Molnár, D.; Moreno, L.A.; Russo, P.; et al. TAS1R3 and UCN2 Transcript Levels in Blood Cells Are Associated With Sugary and Fatty Food Consumption in Children. J. Clin. Endocrinol. Metab. 2015, 100, 3556–3564. [Google Scholar] [CrossRef]
- Reynés, B.; Díaz-Rúa, R.; Cifre, M.; Oliver, P.; Palou, A. Peripheral blood mononuclear cells as a potential source of biomarkers to test the efficacy of weight-loss strategies. Obesity (Silver Spring) 2015, 23, 28–31. [Google Scholar] [CrossRef]
- Díaz-Rúa, R.; Keijer, J.; Caimari, A.; Van Schothorst, E.M.; Palou, A.; Oliver, P. Peripheral blood mononuclear cells as a source to detect markers of homeostatic alterations caused by the intake of diets with an unbalanced macronutrient composition. J. Nutr. Biochem. 2015, 26, 398–407. [Google Scholar] [CrossRef]
- Cifre, M.; Díaz-Rúa, R.; Varela-Calviño, R.; Reynés, B.; Pericás-Beltrán, J.; Palou, A.; Oliver, P. Human peripheral blood mononuclear cell in vitro system to test the efficacy of food bioactive compounds: Effects of polyunsaturated fatty acids and their relation with BMI. Mol. Nutr. Food Res. 2016, 61. [Google Scholar] [CrossRef]
- Puigserver, P.; Vázquez, F.; Bonet, M.L.; Picó, C.; Palou, A. In vitro and in vivo induction of brown adipocyte uncoupling protein (thermogenin) by retinoic acid. Biochem. J. 1996, 317, 827–833. [Google Scholar] [CrossRef]
- Mercader, J.; Ribot, J.; Murano, I.; Felipe, F.; Cinti, S.; Bonet, M.L.; Palou, A. Remodeling of white adipose tissue after retinoic acid administration in mice. Endocrinology 2006, 147, 5325–5332. [Google Scholar] [CrossRef] [PubMed]
- Amengual, J.; Ribot, J.; Bonet, M.L.; Palou, A. Retinoic acid treatment enhances lipid oxidation and inhibits lipid biosynthesis capacities in the liver of mice. Cell. Physiol. Biochem. 2010, 25, 657–666. [Google Scholar] [CrossRef] [PubMed]
- Felipe, F.; Bonet, M.L.; Ribot, J.; Palou, A. Modulation of resistin expression by retinoic acid and vitamin A status. Diabetes 2004, 53, 882–889. [Google Scholar] [CrossRef] [PubMed]
- Mercader, J.; Granados, N.; Bonet, M.L.; Palou, A. All-trans retinoic acid decreases murine adipose retinol binding protein 4 production. Cell. Physiol. Biochem. 2008, 22, 363–372. [Google Scholar] [CrossRef]
- Berry, D.C.; Noy, N. All-trans-retinoic acid represses obesity and insulin resistance by activating both peroxisome proliferation-activated receptor beta/delta and retinoic acid receptor. Mol. Cell. Biol. 2009, 29, 3286–3296. [Google Scholar] [CrossRef]
- Bonet, M.L.; Ribot, J.; Palou, A. Lipid metabolism in mammalian tissues and its control by retinoic acid. Biochim. Biophys. Acta 2012, 1821, 177–189. [Google Scholar] [CrossRef]
- Tourniaire, F.; Musinovic, H.; Gouranton, E.; Astier, J.; Marcotorchino, J.; Arreguin, A.; Bernot, D.; Palou, A.; Bonet, M.L.; Ribot, J.; et al. All-trans retinoic acid induces oxidative phosphorylation and mitochondria biogenesis in adipocytes. J. Lipid Res. 2015, 56, 1100–1109. [Google Scholar] [CrossRef]
- Olsen, T.; Blomhoff, R. Retinol, Retinoic Acid, and Retinol-Binding Protein 4 are Differentially Associated with Cardiovascular Disease, Type 2 Diabetes, and Obesity: An Overview of Human Studies. Adv. Nutr. 2020, 11, 644–666. [Google Scholar] [CrossRef]
- Rhee, E.J.; Plutzky, J. Retinoid metabolism and diabetes mellitus. Diabetes Metab. J. 2012, 36, 167–180. [Google Scholar] [CrossRef] [PubMed]
- Miller, A.P.; Coronel, J.; Amengual, J. The role of beta-carotene and vitamin A in atherogenesis: Evidences from preclinical and clinical studies. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2020. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Chen, H.; Mu, D.; Fan, J.; Song, J.; Zhong, Y.; Li, D.; Xia, M. Circulating Retinoic Acid Levels and the Development of Metabolic Syndrome. J. Clin. Endocrinol. Metab. 2016, 101, 1686–1692. [Google Scholar] [CrossRef] [PubMed]
- Szabova, L.; Macejova, D.; Dvorcakova, M.; Mostbock, S.; Blazickova, S.; Zorad, S.; Walrand, S.; Cardinault, N.; Vasson, M.P.; Rock, E.; et al. Expression of nuclear retinoic acid receptor in peripheral blood mononuclear cells (PBMC) of healthy subjects. Life Sci. 2003, 72, 831–836. [Google Scholar] [CrossRef]
- Bouwens, M.; Afman, L.A.; Müller, M. Fasting induces changes in peripheral blood mononuclear cell gene expression profiles related to increases in fatty acid beta-oxidation: Functional role of peroxisome proliferator activated receptor alpha in human peripheral blood mononuclear cells. Am. J. Clin. Nutr. 2007, 86, 1515–1523. [Google Scholar] [CrossRef]
- Díaz-Rúa, R.; Palou, A.; Oliver, P. Cpt1a gene expression in peripheral blood mononuclear cells as an early biomarker of diet-related metabolic alterations. Food Nutr. Res. 2016, 60, 33554. [Google Scholar] [CrossRef]
- Panelli, M.C.; Wang, E.; Phan, G.; Puhlmann, M.; Miller, L.; Ohnmacht, G.A.; Klein, H.G.; Marincola, F.M. Gene-expression profiling of the response of peripheral blood mononuclear cells and melanoma metastases to systemic IL-2 administration. Genome Biol. 2002, 3, RESEARCH0035. [Google Scholar] [CrossRef]
- Hofmann, T.; Klenow, S.; Borowicki, A.; Gill, C.I.; Pool-Zobel, B.L.; Glei, M. Gene expression profiles in human peripheral blood mononuclear cells as biomarkers for nutritional in vitro and in vivo investigations. Genes Nutr. 2010, 5, 309–319. [Google Scholar] [CrossRef]
- Grundy, S.M. Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III) Final Report. Circulation 2002, 106, 3143–3421. [Google Scholar]
- Bidad, K.; Salehi, E.; Oraei, M.; Saboor-Yaraghi, A.A.; Nicknam, M.H. Effect of all-trans retinoic acid (ATRA) on viability, proliferation, activation and lineage-specific transcription factors of CD4+ T cells. Iran. J. Allergy Asthma Immunol. 2011, 10, 243–249. [Google Scholar]
- Oliver, P.; Reynés, B.; Caimari, A.; Palou, A. Peripheral blood mononuclear cells: A potential source of homeostatic imbalance markers associated with obesity development. Pflug. Arch. 2013, 465, 459–468. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Dheda, K.; Huggett, J.F.; Bustin, S.A.; Johnson, M.A.; Rook, G.; Zumla, A. Validation of housekeeping genes for normalizing RNA expression in real-time PCR. Biotechniques 2004, 37, 112–114, 116, 118–119. [Google Scholar] [CrossRef]
- Falkenberg, V.R.; Whistler, T.; Murray, J.R.; Unger, E.R.; Rajeevan, M.S. Identification of Phosphoglycerate Kinase 1 (PGK1) as a reference gene for quantitative gene expression measurements in human blood RNA. BMC Res. Notes 2011, 4, 324. [Google Scholar] [CrossRef] [PubMed]
- Bonet, M.L.; Puigserver, P.; Serra, F.; Ribot, J.; Vázquez, F.; Pico, C.; Palou, A. Retinoic acid modulates retinoid X receptor alpha and retinoic acid receptor alpha levels of cultured brown adipocytes. FEBS Lett. 1997, 406, 196–200. [Google Scholar] [CrossRef]
- Steinberg, S.J.; Wang, S.J.; Kim, D.G.; Mihalik, S.J.; Watkins, P.A. Human very-long-chain acyl-CoA synthetase: Cloning, topography, and relevance to branched-chain fatty acid metabolism. Biochem. Biophys. Res. Commun. 1999, 257, 615–621. [Google Scholar] [CrossRef] [PubMed]
- Krammer, J.; Digel, M.; Ehehalt, F.; Stremmel, W.; Füllekrug, J.; Ehehalt, R. Overexpression of CD36 and acyl-CoA synthetases FATP2, FATP4 and ACSL1 increases fatty acid uptake in human hepatoma cells. Int. J. Med. Sci. 2011, 8, 599–614. [Google Scholar] [CrossRef] [PubMed]
- De Mello, V.D.; Kolehmanien, M.; Schwab, U.; Pulkkinen, L.; Uusitupa, M. Gene expression of peripheral blood mononuclear cells as a tool in dietary intervention studies: What do we know so far? Mol. Nutr. Food Res. 2012, 56, 1160–1172. [Google Scholar] [CrossRef]
- Petrov, P.D.; Bonet, M.L.; Reynés, B.; Oliver, P.; Palou, A.; Ribot, J. Whole Blood RNA as a Source of Transcript-Based Nutrition- and Metabolic Health-Related Biomarkers. PLoS ONE 2016, 11, e0155361. [Google Scholar] [CrossRef]
- Chytil, F. Retinoic acid: Biochemistry and metabolism. J. Am. Acad. Dermatol. 1986, 15, 741–747. [Google Scholar] [CrossRef]
- Koistinen, H.A.; Remitz, A.; Gylling, H.; Miettinen, T.A.; Koivisto, V.A.; Ebeling, P. Dyslipidemia and a reversible decrease in insulin sensitivity induced by therapy with 13-cis-retinoic acid. Diabetes Metab. Res. Rev. 2001, 17, 391–395. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, L.S.V.; Da Veiga, G.V.; Ramalho, R.A. Association of serum concentrations of retinol and carotenoids with overweight in children and adolescents. Nutrition 2007, 23, 392–397. [Google Scholar] [CrossRef] [PubMed]
- Chaves, G.V.; Pereira, S.E.; Saboya, C.J.; Ramalho, A. Non-alcoholic fatty liver disease and its relationship with the nutritional status of vitamin A in individuals with class III obesity. Obes. Surg. 2008, 18, 378–385. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Bisgaier, C.L.; Aviram, M.; Newton, R.S. 9-cis retinoic acid induces monocyte chemoattractant protein-1 secretion in human monocytic THP-1 cells. Arter. Thromb. Vasc. Biol. 1999, 19, 2105–2111. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.T.; Krutzik, S.R.; Kim, J.; Modlin, R.L. Cutting edge: All-trans retinoic acid down-regulates TLR2 expression and function. J. Immunol. 2005, 174, 2467–2470. [Google Scholar] [CrossRef]
- Kirchmeyer, M.; Koufany, M.; Sebillaud, S.; Netter, P.; Jouzeau, J.Y.; Bianchi, A. All-trans retinoic acid suppresses interleukin-6 expression in interleukin-1-stimulated synovial fibroblasts by inhibition of ERK1/2 pathway independently of RAR activation. Arthritis Res. Ther. 2008, 10, R141. [Google Scholar] [CrossRef]
- Kwok, S.K.; Park, M.K.; Cho, M.L.; Oh, H.J.; Park, E.M.; Lee, D.G.; Lee, J.; Kim, H.Y.; Park, S.H. Retinoic acid attenuates rheumatoid inflammation in mice. J. Immunol. 2012, 189, 1062–1071. [Google Scholar] [CrossRef]
- Wu, J.; Zhang, Y.; Liu, Q.; Zhong, W.; Xia, Z. All-trans retinoic acid attenuates airway inflammation by inhibiting Th2 and Th17 response in experimental allergic asthma. BMC Immunol. 2013, 14, 28. [Google Scholar] [CrossRef]
- Amengual, J.; Petrov, P.; Bonet, M.L.; Ribot, J.; Palou, A. Induction of carnitine palmitoyl transferase 1 and fatty acid oxidation by retinoic acid in HepG2 cells. Int. J. Biochem. Cell Biol. 2012, 44, 2019–2027. [Google Scholar] [CrossRef]
- Gutin, I. In BMI We Trust: Reframing the Body Mass Index as a Measure of Health. Soc. Theory Health STH 2018, 16, 256–271. [Google Scholar] [CrossRef]
- Castelli, W.P.; Garrison, R.J.; Wilson, P.W.; Abbott, R.D.; Kalousdian, S.; Kannel, W.B. Incidence of coronary heart disease and lipoprotein cholesterol levels. The Framingham Study. JAMA 1986, 256, 2835–2838. [Google Scholar] [CrossRef] [PubMed]
- Toth, P.P. High-density lipoprotein and cardiovascular risk. Circulation 2004, 109, 1809–1812. [Google Scholar] [CrossRef] [PubMed]
- Bruckert, E.; Hansel, B. HDL-c is a powerful lipid predictor of cardiovascular diseases. Int. J. Clin. Pract. 2007, 61, 1905–1913. [Google Scholar] [CrossRef] [PubMed]
- Mahdy Ali, K.; Wonnerth, A.; Huber, K.; Wojta, J. Cardiovascular disease risk reduction by raising HDL cholesterol—Current therapies and future opportunities. Br. J. Pharmacol. 2012, 167, 1177–1194. [Google Scholar] [CrossRef]
- Conus, F.; Rabasa-Lhoret, R.; Peronnet, F. Characteristics of metabolically obese normal-weight (MONW) subjects. Appl. Physiol. Nutr. Metab. Physiol. Appl. Nutr. Metab. 2007, 32, 4–12. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (3′-5′) | Amplicon Size (bp) |
---|---|---|---|
Lipid metabolism genes | |||
FASN | GAGGAAGGAGGGTGTGTTTG | CGGGGATAGAGGTGCTGA | 160 |
SREBP1C | TGAGGACAGCAAGGCAAAG | CAGGACAGGCAGAGGAAGAC | 108 |
CPT1A | GATTTTGCTGTCGGTCTTGG | CTCTTGCTGCCTGAATGTGA | 192 |
SLC27A2 | TTTCAGCCAGCCAGTTTTG | TCTCCTCGTAAGCCATTTCC | 157 |
Inflammatory genes | |||
CRP | TCGTATGCCACCAAGAGACA | CCCATCTACCCAGAACTCCA | 183 |
IL6 | ATGTGTGAAAGCAGCAAAGAG | CACCAGGCAAGTCTCCTCAT | 111 |
MCP1 | ATCAATGCCCCAGTCACCT | TCCTGAACCCACTTCTGCTT | 173 |
NFKB | AGCAATCATCCACCTTCATTC | AGCAAATCCTCCACCACATC | 159 |
TLR2 | GATGCCTACTGGGTGGAGAA | AAAAGACGGAAATGGGAGAAG | 224 |
TNFα | TGGGCAGGTCTACTTTGGGAT | AGAGGTTGAGGGTGTCTGAA | 117 |
Retinoid receptors | |||
RARα | GCTTCACCACCCTCACCAT | GTCTCCGCATCATCCATCTC | 235 |
RXRα | ACGAGAATGAGGTGGAGTCG | ATGTTGGTGACAGGGTCGTT | 157 |
Reference gene | |||
RPLP0 | ACAACCCAGCTCTGGAGAAA | TGCCCCTGGAGATTTTAGTG | 240 |
(A) | Gene Expression (%) | Treatment × Body Weight (T × BW) | Interactive Effect Size |
---|---|---|---|
RXRα | p = 0.075 | Ƞp2 = 0.184 | |
RARα | p = 0.037 | Ƞp2 = 0.246 | |
CRP | p = 0.603 | Ƞp2 = 0.017 | |
IL6 | p = 0.471 | Ƞp2 = 0.033 | |
MCP1 | p = 0.689 | Ƞp2 = 0.010 | |
NfKβ | p = 0.245 | Ƞp2 = 0.083 | |
TLR2 | p = 0.937 | Ƞp2 = 0.000 | |
TNFα | p = 0.041 | Ƞp2 = 0.237 | |
FASN | p = 0.027 | Ƞp2 = 0.272 | |
SREBP1C | p = 0.853 | Ƞp2 = 0.002 | |
CPT1A | p = 0.322 | Ƞp2 = 0.061 | |
SLC27A2 | p = 0.768 | Ƞp2 = 0.006 | |
(B) | Cytokine levels (pg/mL) | Treatment × body weight (T × BW) | Interactive effect size |
IL6 | p = 0.641 | Ƞp2 = 0.016 | |
TNFα | p = 0.227 | Ƞp2 = 0.096 | |
(C) | Gene expression (%) | Treatment × HDL levels (T × HDL) | Interactive effect size |
CPT1A | p = 0.060 | Ƞp2 = 0.216 | |
(D) | Parameters (mg/dL) | Body weight × CPT1A response (BW × CPT1A) | Interactive effect size |
Total-cholesterol | p = 0.244 | Ƞp2 = 0.111 | |
LDL-cholesterol | p = 0.835 | Ƞp2 = 0.003 | |
HDL-cholesterol | p = 0.090 | Ƞp2 = 0.191 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cifre, M.; Palou, A.; Oliver, P. Impaired CPT1A Gene Expression Response to Retinoic Acid Treatment in Human PBMC as Predictor of Metabolic Risk. Nutrients 2020, 12, 2269. https://doi.org/10.3390/nu12082269
Cifre M, Palou A, Oliver P. Impaired CPT1A Gene Expression Response to Retinoic Acid Treatment in Human PBMC as Predictor of Metabolic Risk. Nutrients. 2020; 12(8):2269. https://doi.org/10.3390/nu12082269
Chicago/Turabian StyleCifre, Margalida, Andreu Palou, and Paula Oliver. 2020. "Impaired CPT1A Gene Expression Response to Retinoic Acid Treatment in Human PBMC as Predictor of Metabolic Risk" Nutrients 12, no. 8: 2269. https://doi.org/10.3390/nu12082269
APA StyleCifre, M., Palou, A., & Oliver, P. (2020). Impaired CPT1A Gene Expression Response to Retinoic Acid Treatment in Human PBMC as Predictor of Metabolic Risk. Nutrients, 12(8), 2269. https://doi.org/10.3390/nu12082269