Grape Seed Proanthocyanidin Extract Prevents Bone Loss via Regulation of Osteoclast Differentiation, Apoptosis, and Proliferation
Abstract
1. Introduction
2. Materials and Methods
2.1. Mice, Reagents and Antibodies
2.2. In Vitro Osteoclastogenesis Assay
2.3. Fluorescence Microscopy Analysis
2.4. Proliferation Assay
2.5. Pit Formation Assay
2.6. Gene Expression Analysis Using Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
2.7. Western Blot Analyses
2.8. Luciferase Assay
2.9. Retrovirus Preparation and Infection
2.10. Model of LPS-Induced Bone Loss and Treatment
2.11. Statistical Analyses
3. Results
3.1. GSPE Prevents LPS-Induced Inflammatory Bone Loss by Attenuating Osteoclast Formation In Vivo
3.2. GSPE Inhibits RANKL-Induced Osteoclast Differentiation and Bone Resorption In Vitro
3.3. GSPE Downregulates RANKL-Induced Expression of c-Fos, NFATc1, and Osteoclastogenic Marker Genes
3.4. GSPE Suppresses Osteoclastogenesis by Inhibition of RANKL-Induced NF-κB Signaling
3.5. GSPE Leads to the Phosphorylation of Downstream Signaling Molecules of the Akt and MAPK Pathways, such as p38, JNK, and ERK, without RANKL Stimulation
3.6. GSPE Promotes Proliferation of Osteoclast Precursor Cells and Inhibits Apoptosis in the Presence of RANKL
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Feng, X.; McDonald, J.M. Disorders of bone remodeling. Annu. Rev. Pathol. 2011, 6, 121–145. [Google Scholar] [CrossRef] [Scilit]
- McLean, R.R. Proinflammatory cytokines and osteoporosis. Curr. Osteoporos. Rep. 2009, 7, 134–139. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, Y.; Nakayamada, S.; Okada, Y. Osteoblasts and osteoclasts in bone remodeling and inflammation. Curr. Drug Targets Inflamm. Allergy 2005, 4, 325–328. [Google Scholar] [CrossRef] [Scilit]
- Pereira, M.; Petretto, E.; Gordon, S.; Bassett, J.H.D.; Williams, G.R.; Behmoaras, J. Common signaling pathways in macrophage and osteoclast multinucleation. J. Cell Sci. 2018, 131, jcs216267. [Google Scholar] [CrossRef] [Scilit]
- Roodman, G.D. Regulation of osteoclast differentiation. Ann. N. Y. Acad. Sci. 2006, 1068, 100–109. [Google Scholar] [CrossRef] [Scilit]
- Väänänen, K. Mechanism of osteoclast mediated bone resorption-rationale for the design of new therapeutics. Adv. Drug Deliv. Rev. 2005, 57, 959–971. [Google Scholar] [CrossRef] [Scilit]
- Lee, A.W.; States, D.J. Both src-dependent and-independent mechanisms mediate phosphatidylinositol 3-kinase regulation of colony-stimulating factor 1-activated mitogen-activated protein kinases in myeloid progenitors. Mol. Cell Biol. 2000, 20, 6779–6798. [Google Scholar] [CrossRef] [Scilit]
- Takeshita, S.; Faccio, R.; Chappel, J.; Zheng, L.; Feng, X.; Weber, J.D.; Teitebaum, S.L.; Ross, F.P. c-Fms tyrosine 559 is a major mediator of M-CSF-induced proliferation of primary macrophages. J. Biol. Chem. 2007, 282, 18980–18990. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.H.; Kim, N. Signaling pathway in osteoclast differentiation. Chonnam Med. J. 2016, 52, 12–17. [Google Scholar] [CrossRef] [Scilit]
- Ikeda, F.; Matsubara, T.; Tsurukai, T.; Hata, K.; Nishimura, R.; Yoneda, T. JNK/c-Jun signaling mediates an anti-apoptotic effect of RANKL in osteoclasts. J. Bone Miner. Res. 2008, 23, 907–914. [Google Scholar] [CrossRef] [Scilit]
- Boyce, B.F.; Xiu, Y.; Li, J.; Xing, L.; Yao, Z. NF-κB-mediated regulation of osteoclastogenesis. Endocrinol. Metab. (Seoul) 2015, 30, 35–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Novack, D.V.; Yin, L.; Hagen-Stapleton, A.; Schreiber, R.D.; Goeddel, D.V.; Ross, F.P.; Teitelbaum, S.L. The IκB function of NF-κB2 p100 controls stimulated osteoclastogenesis. J. Exp. Med. 2003, 198, 771–781. [Google Scholar] [CrossRef] [Scilit]
- Takayanagi, H.; Kim, S.; Koga, T.; Nishina, H.; Isshiki, M.; Yoshida, H.; Saiura, A.; Isobe, M.; Yokochi, T.; Inoue, J.; et al. Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts. Dev. Cell 2002, 3, 889–901. [Google Scholar] [CrossRef] [Scilit]
- Henriet, J.P. Veno-lymphatic insufficiency. 4729 patients undergoing hormonal and procyanidol oligomer therapy. Phlebologie 1993, 46, 313–325. [Google Scholar]
- Ma, Z.F.; Zhang, H. Phytochemical constituents, health benefits, and industrial applications of grape seeds: A mini-review. Antioxidnats (Basel) 2017, 6, 71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bagchi, D.; Swaroop, A.; Preuss, H.G.; Bagchi, M. Free radical scavenging, antioxidant and cancer chemoprevention by grape seed proanthocyanidin: An overview. Mutat. Res. 2014, 678, 69–73. [Google Scholar] [CrossRef] [Scilit]
- Li, W.G.; Zhang, X.Y.; Wu, Y.J.; Tian, X. Anti-inflammatory effect and mechanism of proanthocyanidins from grape seeds. Acta Pharmacol. Sin. 2001, 22, 1117–1120. [Google Scholar]
- Cho, M.L.; Heo, Y.J.; Park, M.K.; Oh, H.J.; Park, J.S.; Woo, Y.J.; Ju, J.H.; Oark, S.H.; Kim, H.Y.; Min, J.K. Grape seed proanthocyanidin extract (GSPE) attenuates collagen-induced arthritis. Immunol. Lett. 2009, 124, 102–110. [Google Scholar] [CrossRef] [Scilit]
- Jhun, J.Y.; Moon, S.J.; Yoon, B.Y.; Byun, J.K.; Kim, E.K.; Yang, E.J.; Ju, J.H.; Hong, Y.S.; Min, J.K.; Park, S.H.; et al. Regulation of STAT3 proteins contributes to treg differentiation and attenuates inflammation in a murine model of obesity-associated arthritis. PLoS ONE 2013, 8, e78843. [Google Scholar] [CrossRef] [Scilit]
- Woo, Y.J.; Joo, Y.B.; Jung, Y.O.; Ju, J.H.; Cho, M.L.; Oh, H.J.; Jhun, J.Y.; Park, M.K.; Park, J.S.; Kang, C.M.; et al. Grape seed proanthocyanidin extract ameliorates monosodium iodoacetate-induced osteoarthritis. Exp. Mol. Med. 2011, 43, 561–570. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Xhu, W.; Yin, Z.; Zhang, Q.; Guo, S.; Shen, Y.; Liu, T.; Liu, B.; Wan, L.; Li, S.; Chen, X.; et al. Proanthocyanidins inhibit osteoclast formation and function by inhibiting the NF-κB and JNK signaling pathways during osteoporosis treatment. Biochem. Biophys. Res. Commun. 2019, 509, 294–300. [Google Scholar]
- Song, Q.; Shi, Z.; Bi, W.; Liu, R.; Zhang, C.; Wang, K.; Dang, X. Beneficial effect of grape seed proanthocyanidin extract in rabbits with steroid-induced osteonecrosis via protecting against oxidative stress and apoptosis. J. Orthop. Sci. 2015, 20, 196–204. [Google Scholar] [CrossRef] [Scilit]
- Tofani, L.; Maki, K.; Kojima, K.; Kimura, M. Beneficial effects of grape seed proanthocyanidins extract on formation of tibia bone in low-calcium feeding rats. Pediatr. Dent. 2004, 14, 47–53. [Google Scholar] [CrossRef] [Scilit]
- Yahara, N.; Tofani, I.; Maki, K.; Kojima, K.; Kojima, Y.; Kimura, M. Mechanical assessment of effects of grape seed proanthocyanidins extract on tibial bone diaphysis in rats. J. Musculoskelet. Neuronal Interact. 2005, 5, 162–169. [Google Scholar] [PubMed]
- Soysa, N.S.; Alles, N. Positive and negative regulators of osteoclast apoptosis. Bone Rep. 2019, 11, 100225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lerner, U.H. Osteoclasts in health and disease. Pediatr. Endocrinol. Rev. 2019, 17, 84–99. [Google Scholar]
- Feng, X.; Teitelbaum, S.L. Osteoclasts: New insights. Bone Res. 2013, 1, 11–26. [Google Scholar]
- Boyce, B.F. Advances in the regulation of osteoclasts and osteoclast functions. J. Dent. Res. 2013, 92, 860–867. [Google Scholar] [CrossRef] [Scilit]
- Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast differentiation and activation. Nature 2003, 423, 337–342. [Google Scholar] [CrossRef] [Scilit]
- Huang, W.C.; Hung, M.C. Beyond NF-kB activation: Nuclear functions of IkB kinase α. J. Biomed. Sci. 2013, 20, 3. [Google Scholar] [CrossRef] [Scilit]






| Gene | Forward (5′ → 3′) | Reverse (5′ → 3′) | Product (bp) |
|---|---|---|---|
| glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | TCAAGAAGGTGGTGAAGCAG | AGTGGGAGTTGCTGTTGAAGT | 102 |
| proto-oncogene cellular Fos (c-Fos) | GGTGAAGACCGTGTCAGGAG | TATTCCGTTCCCTTCGGATT | 110 |
| nuclear factor of activated T cells (NFATC1) | GAGTACACCTTCCAGCACCTT | TATGATGTCGGGGAAAGAGA | 110 |
| Integrin-β3 | GGAGTGGCTGATCCAGATGT | TCTGACCATCTTCCCTGTCC | 138 |
| osteoclast-associated receptor (OSCAR) | GGAATGGTCCTCATCTCCTT | TCCAGGCAGTCTCTTCAGTTT | 112 |
| Matrix metallopeptidase 9 (MMP9) | TCCAACCTCACGGACACCC | AGCAAAGCCGGCCGTAGA | 107 |
| Calcitonin receptor (Ctr) | TCCAACAAGGTGCTTGGGAA | CTTGAACTGCGTCCACTGGC | 141 |
| ATPase H+ Transporting V0 Subunit D2 (Atp6v0d2) | GACCCTGTGGCACTTTTTGT | GTGTTTGAGCTTGGGGAGAA | 102 |
| cathepsin K (CtsK) | CCAGTGGGAGCTATGGAAGA | CTCCAGGTTATGGGCAGAGA | 118 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kwak, S.C.; Cheon, Y.-H.; Lee, C.H.; Jun, H.Y.; Yoon, K.-H.; Lee, M.S.; Kim, J.-Y. Grape Seed Proanthocyanidin Extract Prevents Bone Loss via Regulation of Osteoclast Differentiation, Apoptosis, and Proliferation. Nutrients 2020, 12, 3164. https://doi.org/10.3390/nu12103164
Kwak SC, Cheon Y-H, Lee CH, Jun HY, Yoon K-H, Lee MS, Kim J-Y. Grape Seed Proanthocyanidin Extract Prevents Bone Loss via Regulation of Osteoclast Differentiation, Apoptosis, and Proliferation. Nutrients. 2020; 12(10):3164. https://doi.org/10.3390/nu12103164
Chicago/Turabian StyleKwak, Sung Chul, Yoon-Hee Cheon, Chang Hoon Lee, Hong Young Jun, Kwon-Ha Yoon, Myeung Su Lee, and Ju-Young Kim. 2020. "Grape Seed Proanthocyanidin Extract Prevents Bone Loss via Regulation of Osteoclast Differentiation, Apoptosis, and Proliferation" Nutrients 12, no. 10: 3164. https://doi.org/10.3390/nu12103164
APA StyleKwak, S. C., Cheon, Y.-H., Lee, C. H., Jun, H. Y., Yoon, K.-H., Lee, M. S., & Kim, J.-Y. (2020). Grape Seed Proanthocyanidin Extract Prevents Bone Loss via Regulation of Osteoclast Differentiation, Apoptosis, and Proliferation. Nutrients, 12(10), 3164. https://doi.org/10.3390/nu12103164

