Protective Effect of Glycomacropeptide on Food Allergy with Gastrointestinal Manifestations in a Rat Model through Down-Regulation of Type 2 Immune Response
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Protocols for Induction of Experimental Food Allergy
2.3. Experimental Design and Sample Collection
2.4. Determination of Allergen-Specific IgE and IgG1 in Serum
2.5. Quantification of Serum Histamine and Rat Mast Cell Protease-2
2.6. Food Anaphylaxis
2.7. Intestinal Edema
2.8. Quantification of Gene Expression in Small Intestine
2.9. Histological Analysis
2.10. Statistical Analysis
3. Results
3.1. Characterization of IgE-Mediated Food Allergy Evoked by Systemic or Oral Sensitization with Allergen
3.2. GMP Administration Modulates Immunoglobulin Production in Response to Allergen Sensitization
3.3. Oral Administration of GMP Reduces the Severity of Gastrointestinal Manifestations after Allergen Intake
3.4. Oral Administration of GMP Improves the Pathophysiology of the Intestinal Mucosa in Food Allergy Animals
3.5. Oral Administration of GMP Down-Regulates the Type 2 Immune Response and Skews towards a Type 1 and Regulatory Profile
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Food Allergy. Available online: https://www.worldallergy.org/education-and-programs/education/allergic-disease-resource-center/professionals/food-allergy (accessed on 18 August 2020).
- Gupta, R.S.; Springston, E.E.; Warrier, M.N.; Smith, B.; Kumar, R.; Pongracic, J.; Holl, J.L. The Prevalence, Severity and Distribution of Childhood Food Allergy in the United States. Pediatrics 2011, 128, e9–e17. [Google Scholar] [CrossRef] [Green Version]
- Gupta, R.; Holford, D.; Bilaver, L.; Dyer, A.; Holl, J.L.; Meltzer, D. The Economic Impact of Childhood Food Allergy in the United States. JAMA Pediatr. 2013, 167, 1026–1031. [Google Scholar] [CrossRef] [Green Version]
- Yu, W.; Hussey-Freeland, D.M.; Nadeau, K.C. Food allergy: Immune mechanisms, diagnosis and immunotherapy. Nat. Rev. Immunol. 2016, 16, 751–765. [Google Scholar] [CrossRef]
- Muraro, A.; Werfel, T.; Koffmann-Sommergruber, K.; Roberts, G.; Beyer, K.; Bindslev-Jensen, C.; Cardona, V.; Dubois, A.; DuToit, G.; Eigenmann, P.; et al. EAACI food allergy and anaphylaxis guidelines: Diagnosis and management of food allergy. Allergy 2014, 69, 1008–1025. [Google Scholar] [CrossRef] [PubMed]
- Ahrens, B.; Niggemann, B.; Wahn, U.; Beyer, K. Organ-specific symptoms during oral food challenge in children with food allergy. J. Allergy Clin. Immunol. 2012, 130, 549–551. [Google Scholar] [CrossRef] [PubMed]
- Rona, R.J.; Keil, T.; Summers, C.; Gislason, D.; Zuidmeer, L.; Sodergren, E.; Sigurdardottir, S.T.; Lindner, T.; Goldhahn, K.; Dahlstrom, J.; et al. The prevalence of food allergy: A meta-analysis. J. Allergy Clin. Immunol. 2007, 120, 638–646. [Google Scholar] [CrossRef] [PubMed]
- Mine, Y.; Yang, M. Recent Advances in the Understanding of Egg Allergens: Basic, Industrial, and Clinical Perspectives. J. Agric. Food Chem. 2008, 56, 4874–4900. [Google Scholar] [CrossRef] [PubMed]
- Jiménez-Saiz, R.; Rupa, P.; Mine, Y. Immunomodulatory effects of heated ovomucoid-depleted egg white in a BALB/c mouse model of egg allergy. J. Agric. Food Chem. 2011, 59, 13195–13202. [Google Scholar] [CrossRef] [Green Version]
- Anvari, S.; Miller, J.; Yeh, C.Y.; Davis, C.M. IgE-Mediated Food Allergy. Clin. Rev. Allergy Immunol. 2019, 57, 244–260. [Google Scholar] [CrossRef] [Green Version]
- Reyes-Pavón, D.; Jiménez, M.; Salinas, E. Fisiopatología de la alergia alimentaria. Rev. Alerg. Mex. 2020, 67, 34–53. [Google Scholar] [CrossRef] [PubMed]
- Brandt, E.B.; Strait, R.T.; Hershko, D.; Wang, Q.; Muntel, E.E.; Scribner, T.A.; Zimmermann, N.; Finkelman, F.D.; Rothenberg, M.E. Mast cells are required for experimental oral allergen-induced diarrhea. J. Clin. Investig. 2003, 112, 1666–1677. [Google Scholar] [CrossRef] [PubMed]
- De Martinis, M.; Sirufo, M.M.; Suppa, M.; Ginaldi, L. New Perspectives in Food Allergy. Int. J. Mol. Sci. 2020, 21, 1474. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aldemir, H.; Bars, R.; Hrouet-Guicheney, C. Murine models for evaluating the allergenicity of novel proteins and foods. Regul. Toxicol. Pharmacol. 2009, 54, S52–S57. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Liu, C.; Wang, Y.; Wang, C.; Xie, M.; Qian, Y.; Fu, L. Application of in vitro and in vivo models in the study of food allergy. Food Sci. Hum. Wellness 2018, 7, 235–243. [Google Scholar] [CrossRef]
- Sun, N.; Zhou, C.; Pu, Q.; Wang, J.; Huang, K.; Che, H. Allergic reactions compared between BN and Wistar rats after oral exposure to ovalbumin. J. Immunotoxicol. 2013, 10, 67–74. [Google Scholar] [CrossRef]
- Bheroo, L. Fascinationg Findings from Sensitizing the Wistar Strain Rats Recruited as Peanut-Allergy Model. EC Nutr. 2015, 1, 192–202. [Google Scholar]
- Shishehbor, F.; Behroo, L.; Ghafouriyan-Broujerdnia, M.; Namjoyan, F.; Latifi, S.M. Quercetin effectively quells peanut-induced anaphylactic reactions in the peanut sensitized rats. Iran. J. Allergy Asthma Immunol. 2010, 9, 27–34. [Google Scholar]
- Chung, M.Y.; Shin, H.S.; Choi, D.W.; Shon, D.H. Citrus Tachibana Leaf Extract Mitigates Symptoms of Food Allergy by Inhibiting Th2-Associated Responses. J. Food Sci. 2016, 81, H1537–H1545. [Google Scholar] [CrossRef]
- Nongonierma, A.B.; FitzGerald, R.J. The scientific evidence for the role of milk protein-derived bioactive peptides in humans: A Review. J. Funct. Foods 2015, 17, 640–656. [Google Scholar] [CrossRef] [Green Version]
- Thomä-Worringer, C.; Sørensen, J.; López-Fandiño, R. Health effects and technological features of caseinomacropeptide. Int. Dairy J. 2006, 16, 1324–1333. [Google Scholar] [CrossRef]
- Neelima, R.S.; Yudjshthir, S.R.; Bimlesh, M. Chemical and functional properties of glycomacropeptide (GMP) and its role in the detection of cheese whey adulteration in milk: A review. Dairy Sci. Technol. 2013, 93, 21–43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mikkelsen, T.L.; Rasmussen, E.; Olsen, A.; Barkholt, V.; Frøkiaer, H. Immunogenicity of kappa-casein and glycomacropeptide. J. Dairy Sci. 2006, 89, 824–830. [Google Scholar] [CrossRef] [Green Version]
- Hvas, C.L.; Dige, A.; Bendix, M.; Wernlund, P.G.; Christensen, L.A.; Dahlerup, J.F.; Agnholt, J. Casein glycomacropeptide for active distal ulcerative colitis: A randomized pilot study. Eur. J. Clin. Investig. 2016, 46, 555–563. [Google Scholar] [CrossRef] [PubMed]
- Pena, M.J.; Pinto, A.; Daly, A.; MacDonald, A.; Azevedo, L.; Rocha, J.C.; Borges, N. The Use of Glycomacropeptide in Patients with Phenylketonuria: A Systematic Review and Meta-Analysis. Nutrients 2018, 10, 1794. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Córdova-Dávalos, L.E.; Jiménez, M.; Salinas, E. Glycomacropeptide Bioactivity and Health: A Review Highlighting Action Mechanisms and Signaling Pathways. Nutrients 2019, 11, 598. [Google Scholar] [CrossRef] [Green Version]
- Monnai, M.; Horimoto, Y.; Otani, H. Immunomodificatory effect of dietary bovine kappa-caseinoglycopeptide on serum antibody levels and proliferative responses of lymphocytes in mice. Milchwissenschaft 1998, 53, 129–132. [Google Scholar]
- Jiménez, M.; Chávez, N.A.; Salinas, E. Pretreatment with glycomacropeptide reduces allergen sensitization, alleviates immediate cutaneous hypersensitivity and protects from anaphylaxis. Clin. Exp. Immunol. 2012, 170, 18–27. [Google Scholar] [CrossRef]
- Otani, H.; Monnai, M.; Kawasaki, Y.; Kawakami, H.; Tanimoto, M. Inhibition of mitogen-induced prolifertive responses of lymphocytes by bovine κ-caseinoglycopeptides having different carbohydrate chains. J. Dairy Res. 1995, 65, 349–357. [Google Scholar] [CrossRef]
- Otani, H.; Hata, I. Inhibition of proliferative responses of mouse spleen lymphocytes and rabbit Peyer’s patch cells by bovine milk caseins and their digests. J. Dairy Res. 1995, 62, 339–348. [Google Scholar] [CrossRef]
- Mikkelsen, T.L.; Bakman, S.; Sørensen, E.S.; Barkholt, V.; Frøkiaer, H. Sialic Acid-Containing Milk Proteins Show Differential Immunomodulatory Activities Independent of Sialic Acid. J. Agric. Food Chem. 2005, 53, 7673–7680. [Google Scholar] [CrossRef]
- Roldán, N.R.; Jiménez, M.; Cervantes-García, D.; Marín, E.; Salinas, E. Glycomacropeptide administration attenuates airway inflammation and remodeling associated to allergic asthma in rat. J. Inflamm. Res. 2016, 65, 273–283. [Google Scholar] [CrossRef] [PubMed]
- Muñoz, F.C.; Cervantes, M.M.; Cervantes-García, D.; Jiménez, M.; Ventura-Juárez, J.; Salinas, E. Glycomacropeptide Attenuates Inflammation, Pruritus, and Th2 Response Associated with Atopic Dermatitis Induced by 2,4-Dinitrochlorobenzene in Rat. J. Immunol. Res. 2017, 2017, 6935402. [Google Scholar] [CrossRef] [PubMed]
- Daddaoua, A.; Puerta, V.; Zarzuelo, A.; Suárez, M.D.; Sánchez de Medina, F.; Martínez-Augustin, O. Bovine Glycomacropeptide Is Anti-Inflammatory in Rats with Hapten-Induced Colitis. J. Nutr. 2005, 135, 1164–1170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Requena, P.; Daddaoua, A.; Martínez-Plata, E.; González, M.; Zarzuelo, A.; Suárez, M.D.; de Medina, F.S.; Martínez-Augustin, O. Bovine glycomacropeptide ameliorates experimental rat ileitis by mechanisms involving downregulation of interleukin 17. Br. J. Pharmacol. 2008, 154, 825–832. [Google Scholar] [CrossRef] [Green Version]
- López-Posadas, R.; Requena, P.; González, R.; Suárez, M.D.; Zarzuelo, A.; Sánchez de Medina, F.; Martínez-Augustin, O. Bovine Glycomacropeptide Has Intestinal Antiinflammatory Effects in Rats with Dextran Sulfate-Induced Colitis. J. Nutr. 2010, 140, 2014–2019. [Google Scholar] [CrossRef]
- Cervantes-García, D.; Bahena-Delgado, A.I.; Jiménez, M.; Córdova-Dávalos, L.E.; Ruiz-Esparza Palacios, V.; Sánchez-Alemán, E.; Martínez-Saldaña, M.C.; Salinas, E. Glycomacropeptide Ameliorates Indomethacin-Induced Enteropathy in Rats by Modifying Intestinal Inflammation and Oxidative Stress. Molecules 2020, 25, 2351. [Google Scholar] [CrossRef]
- Abril-Gil, M.; Garcia-Just, A.; Pérez-Cano, F.J.; Franch, À.; Castell, M. Development and Characterization of an Effective Food Allergy Model in Brown Norway Rats. PLoS ONE 2015, 10, e0125314. [Google Scholar] [CrossRef] [Green Version]
- Dai, Y.; Hou, L.F.; Chan, Y.P.; Cheng, L.; But, P.P.H. Inhibition of Immediate Allergic Reactions by Ethanol Extract from Plumbago zeylanica Stems. Biol. Pharm. Bull. 2004, 27, 429–432. [Google Scholar] [CrossRef] [Green Version]
- Li, X.M.; Serebrisky, D.; Lee, S.Y.; Huang, C.K.; Bardina, L.; Schofield, B.H.; Stanley, J.S.; Burks, A.W.; Bannon, G.A.; Sampson, H.A. A murine model of peanut anaphylaxis: T—And B-cell responses to a major peanut allergen mimic human responses. J. Allergy Clin. Immunol. 2000, 106, 150–158. [Google Scholar] [CrossRef]
- Duncker, S.C.; Philippe, D.; Martin-Paschoud, C.; Moser, M.; Mercenier, A.; Nutten, S. Nigella sativa (Black Cumin) Seed Extract Alleviates Symptoms of Allergic Diarrhea in Mice, Involving Opioid Receptors. PLoS ONE 2012, 7, e39841. [Google Scholar] [CrossRef]
- Muto, T.; Fukuoka, A.; Kabashima, K.; Ziegler, S.F.; Nakanishi, K.; Matsushita, K.; Yoshimoto, T. The role of basophils and proallergic cytokines, TSLP and IL-33, in cutaneously sensitized food allergy. Int. Immunol. 2014, 26, 539–549. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Kara, M.; Beser, O.F.; Konukoglu, D.; Cokugras, H.; Erkan, T.; Kutlu, T.; Cokugras, F.C. The utility of TNF-α, IL-6 and IL-10 in the diagnosis and/or follow-up food allergy. Allergol. Immunopathol. (Madr.) 2020, 48, 48–55. [Google Scholar] [CrossRef] [PubMed]
- Nambu, A.; Nakae, S. IL-1 and Allergy. Allergol. Int. 2010, 59, 125–135. [Google Scholar] [CrossRef] [PubMed]
- McCalla, R.; Savilahtl, E.; Perkkiö, M.; Kuitunen, P.; Backman, A. Morphology of the Jejunum in Children with Eczema due to Food Allergy. Allergy 1980, 35, 563–571. [Google Scholar] [CrossRef]
- Lee, J.B.; Matsumoto, T.; Shin, Y.O.; Yang, H.M.; Min, Y.K.; Timothy, O.; Bae, S.J.; Quan, F.S. The Role of RANTES in a Murine Model of Food Allergy. Immunol. Investig. 2004, 33, 27–38. [Google Scholar] [CrossRef]
- Mathias, C.B.; Hobson, S.A.; Garcia-Lloret, M.; Lawson, G.; Poddighe, D.; Freyschmidt, E.J.; Xing, W.; Gurish, M.F.; Chatila, T.A.; Oettgen, H.C. IgE-mediated systemic anaphylaxis and impaired tolerance to food antigens in mice with enhanced IL-4 receptor signaling. J. Allergy Clin. Immunol. 2011, 127, 795–805. [Google Scholar] [CrossRef] [Green Version]
- Zhu, J. T helper 2 (Th2) cell differentiation, type 2 innate lymphoid cell (ILC2) development and regulation of interleukin-4 (IL-4) and IL-13 production. Cytokine 2015, 75, 14–24. [Google Scholar] [CrossRef] [Green Version]
- Boyce, J.A.; Assa’a, A.; Burks, W.A.; Jones, S.M.; Sampson, H.A.; Wood, R.A.; Plaut, M.; Cooper, S.F.; Fenton, M.J.; Arshad, S.H.; et al. Guidelines for the Diagnosis and Management of Food Allergy in the United States: Summary of the NIAID-Sponsored Expert Panel Report. J. Allergy Clin. Immunol. 2010, 126, 1105–1118. [Google Scholar] [CrossRef]
- Wood, R.A. Oral Immunotherapy for Food Allergy. J. Investig. Allergol. Clin. Immunol. 2017, 27, 151–159. [Google Scholar] [CrossRef] [Green Version]
- Terhune, T.D.; Deth, R.C. How aluminum adjuvants could promote and enhance non-target IgE synthesis in a genetically-vulnerable sub-population. J. Immunotoxicol. 2013, 10, 210–222. [Google Scholar] [CrossRef] [PubMed]
- Dong, W.; Selgrade, M.K.; Gilmour, M.I. Systemic Administration of Bordetella pertussis Enhances Pulmonary Sensitization to House Dust Mite in Juvenile Rats. Toxicol. Sci. 2003, 72, 113–121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kucuk, Z.Y.; Strait, R.; Khodoun, M.V.; Mahler, A.; Hogan, S.; Finkelman, F.D. Induction and suppression of allergic diarrhea and systemic anaphylaxis in a mouse model of food allergy. J. Allergy Clin. Immunol. 2012, 129, 1343–1348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Knippels, L.M.; Penninks, A.H.; van Meeteren, M.; Houben, G.F. Humoral and Cellular Immune Responses in Different Rat Strains on Oral Exposure to Ovalbumin. Food Chem. Toxicol. 1999, 37, 881–888. [Google Scholar] [CrossRef]
- Chehade, M.; Mayer, L. Oral tolerance and its relation to food hypersensitivities. J. Allergy Clin. Immunol. 2005, 115, 3–12. [Google Scholar] [CrossRef]
- Dearman, R.J.; Caddick, H.; Stone, S.; Basketter, D.A.; Kimber, I. Characterization of antibody responses induced in rodents by exposure to food proteins: Influence of route of exposure. Toxicology 2001, 167, 217–231. [Google Scholar] [CrossRef]
- Gould, H.J.; Sutton, B.J.; Beavil, A.J.; Beavil, R.L.; McCloskey, N.; Coker, H.A.; Fear, D.; Smurthwaite, L. The biology of IGE and the basis of allergic disease. Annu. Rev. Immunol. 2003, 21, 579–628. [Google Scholar] [CrossRef]
- de Jonge, J.D.; Pennings, J.L.A.; Baken, K.A.; Konings, J.; Ezendam, J.; Van Loveren, H. Gene expression changes in the mesenteric lymph nodes of rats after oral peanut extract exposure. J. Immunotoxicol. 2008, 5, 385–394. [Google Scholar] [CrossRef]
- Gracie, J.A.; Bradley, J.A. Interleukin-12 induces interferon-γ-dependent switching of IgG alloantibody subclass. Eur. J. Immunol. 1996, 26, 1217–1221. [Google Scholar] [CrossRef]
- Liu, Q.M.; Zhang, Y.F.; Gao, Y.Y.; Liu, H.; Cao, M.J.; Yang, X.W.; Su, W.J.; Liu, G.M. Coumarin alleviates ovalbumin induced food anaphylaxis in a mouse model by affecting mast cell function. Food Funct. 2019, 10, 6767–6778. [Google Scholar] [CrossRef]
- Jiang, T.; Ji, H.; Zhang, L.; Wang, Y.; Zhou, H. Chitosan Oligosaccharide Exerts Anti-Allergic Effect against Shrimp Tropomyosin-Induced Food Allergy by Affecting Th1 and Th2 Cytokines. Int. Arch. Allergy Immunol. 2019, 180, 10–16. [Google Scholar] [CrossRef] [PubMed]
- Punnonen, J.; Aversa, G.; Cocks, B.G.; McKenzie, A.N.; Menon, S.; Zurawski, G.; de Waal Malefyt, R.; de Vries, J.E. Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc. Natl. Acad. Sci. USA 1993, 90, 3730–3734. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuwahara, M.; Yamashita, M.; Shinoda, K.; Tofukuji, S.; Onodera, A.; Shinnakasu, R.; Motohashi, S.; Hosokawa, H.; Tumes, D.; Iwamura, C.; et al. The transcription factor Sox4 is a downstream target of signaling by the cytokine TGF-β and suppresses T(H)2 differentiation. Nat. Immunol. 2012, 13, 778–786. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiménez, M.; Cervantes-García, D.; Muñoz, Y.H.; García, A.; Haro, L.M., Jr.; Salinas, E. Novel Mechanisms Underlying the Therapeutic Effect of Glycomacropeptide on Allergy: Change in Gut Microbiota, Upregulation of TGF-β, and Inhibition of Mast Cells. Int. Arch. Allergy Immunol. 2016, 171, 217–226. [Google Scholar] [CrossRef]
- Snapper, C.M.; Finkelman, F.D.; Paul, W.E. Differential regulation of IgG1 and IgE Synthesis by Interleukin 4. J. Exp. Med. 1988, 167, 183–196. [Google Scholar] [CrossRef]
- Muñoz-Cano, R.; Picado, C.; Valero, A.; Batra, J. Mechanisms of Anaphylaxis Beyond IgE. J. Investig. Allergol. Clin. Immunol. 2016, 26, 73–82. [Google Scholar] [CrossRef]
- Golden, D.B.K. Patterns of anaphylaxis: Acute and late phase features of allergic reactions. Novartis Found. Symp. 2004, 257, 101–110. [Google Scholar]
- Lin, R.Y.; Schwartz, L.B.; Curry, A.; Pesola, G.R.; Knight, R.J.; Lee, H.S.; Bakalchuk, L.; Tenenbaum, C.; Westfal, R.E. Histamine and tryptase levels in patients with acute allergic reactions: An emergency department-based study. J. Allergy Clin. Immunol. 2000, 106, 65–71. [Google Scholar] [CrossRef]
- Rivera, J.; Gilfillan, A.M. Molecular regulation of mast-cell activation. J. Allergy Clin. Immunol. 2006, 117, 1214–1225. [Google Scholar] [CrossRef]
- Santos, J.; Bayarri, C.; Saperas, E.; Nogueiras, C.; Antolín, M.; Mourelle, M.; Cadahia, A.; Malagelada, J.R. Characterisation of immune mediator release during the immediate response to segmental mucosal challenge in the jejunum of patients with food allergy. Gut 1999, 45, 553–558. [Google Scholar] [CrossRef] [Green Version]
- Claesson-Welsh, L. Vascular permeability-the essentials. Upsala J. Med. Sci. 2015, 120, 135–143. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, M.; Han, J.; Domenico, J.; Shin, Y.S.; Jia, Y.; Gelfand, E.W. Combined blockade of the histamine H1 and H4 receptor suppresses peanut-induced intestinal anaphylaxis by regulating dendritic cell function. Allergy 2016, 71, 1561–1574. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Galli, S.J.; Tsai, M.; Piliponsky, A.M. The development of allergic inflammation. Nature 2008, 454, 445–454. [Google Scholar] [CrossRef] [Green Version]
- Theodorou, V.; Fioramonti, J.; Bueno, L. Recombinant interleukin-1 receptor antagonist protein prevents sensitization and intestinal anaphylaxis in guinea pigs. Life Sci. 1993, 53, 733–738. [Google Scholar] [CrossRef]
- Theodorou, V.; Fioramonti, J.; Junien, J.L.; Bueno, I. Anaphylactic colonic hypersecretion in cow’s milk sensitized guinea-pigs depends upon release of Interleukin-1, prostaglandins and mast-cell degranulation. Aliment. Pharmacol. Ther. 1994, 8, 301–307. [Google Scholar] [CrossRef] [PubMed]
- Subramanian, N.; Bray, M.A. Interleukin 1 releases histamine from human basophils and mast cells in vitro. J. Immunol. 1987, 138, 271–275. [Google Scholar]
- Rola-Pleszczynski, M.; Lemaire, I. Leukotrienes augment interleukin 1 production by human monocytes. J. Immunol. 1985, 135, 3958–3961. [Google Scholar]
- Ventura, M.T.; Polimeno, L.; Amoruso, A.C.; Gatti, F.; Annoscia, E.; Marinaro, M.; Di Leo, E.; Matino, M.G.; Buquicchio, R.; Bonini, S.; et al. Intestinal permeability in patients with adverse reactions to food. Dig. Liver Dis. 2006, 38, 732–736. [Google Scholar] [CrossRef]
- Lee, S.H. Intestinal Permeability Regulation by Tight Junction: Implication on Inflammatory Bowel Diseases. Intest. Res. 2015, 13, 11–18. [Google Scholar] [CrossRef] [Green Version]
- Arbizu, S.; Chew, B.; Mertens-Talcott, S.U.; Noratto, G. Commercial whey products promote intestinal barrier function with glycomacropeptide enhanced activity in downregulating bacterial endotoxin lipopolysaccharides (LPS)-induces inflammation in vitro. Food Funct. 2020, 11, 5842–5852. [Google Scholar] [CrossRef]
- Feeney, S.; Ryan, J.T.; Kilcoyne, M.; Joshi, L.; Hickey, R. Glycomacropeptide Reduces Intestinal Epithelial Cell Barrier Dysfunction and Adhesion of Entero-Hemorrhagic and Entero-Pathogenic Escherichia coli in Vitro. Foods 2017, 6, 93. [Google Scholar] [CrossRef] [Green Version]
- Cui, Y.; Zhu, C.; Ming, Z.; Cao, J.; Yan, Y.; Zhao, P.; Pang, G.; Deng, Z.; Yao, Y.; Chen, Q. Molecular mechanisms by which casein glycomacropeptide maintains internal homeostasis in mice with experimental ulcerative colitis. PLoS ONE 2017, 12, e0181075. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Foisy-Sauvé, M.; Ahmarani, L.; Delvin, E.; Sané, A.T.; Spahis, S.; Levy, E. Glycomacropeptide Prevents Iron/Ascorbate-Induced Oxidative Stress, Inflammation and Insulin Sensitivity with an Impact on Lipoprotein Production in Intestinal Caco-2/15 Cells. Nutrients 2020, 12, 1175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, X.; Gao, D.; Chen, B.; Mao, X. Endotoxin-Binding Peptides Derived from Casein Glycomacropeptide Inhibit Lipopolysaccharide-Stimulated Inflammatory Responses via Blockade of NF-κB activation in macrophages. Nutrients 2015, 7, 3119–3137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, P.C.; Berin, M.C.; Yu, L.; Perdue, M.H. Mucosal pathophysiology and inflammatory changes in the late phase of the intestinal allergic reaction in the rat. Am. J. Pathol. 2001, 158, 681–690. [Google Scholar] [CrossRef] [Green Version]
- Nakajima-Adachi, H.; Kikuchi, A.; Fujimura, Y.; Shibahara, K.; Makino, T.; Goseki-Sone, M.; Kihara-Fujioka, M.; Nochi, T.; Kurashima, Y.; Igarashi, O.; et al. Peyer’s patches and mesenteric lymph nodes cooperatively promote enteropathy in a mouse model of food allergy. PLoS ONE 2014, 9, e107492. [Google Scholar] [CrossRef]
- Saldanha, J.C.S.; Gargiulo, D.L.; Silva, S.S.; Carmo-Pinto, F.H.; Andrade, M.C.; Alvarez-Leite, J.I.; Teixeira, M.M.; Cara, D.C. A model of chronic IgE-mediated food allergy in ovalbumin-sensitized mice. Braz. J. Med. Biol. Res. 2004, 37, 809–816. [Google Scholar] [CrossRef]
- Cheng, C.H.; Wu, H.Y.; Wu, C.F.; Jang, T.R. Pacific oyster-derived polysaccharides attenuate allergen-induced intestinal inflammation in a murine model of food allergy. J. Food Drug Anal. 2016, 24, 121–128. [Google Scholar] [CrossRef]
- Mishra, A.; Hogan, S.P.; Brandt, E.B.; Wagner, N.; Crossman, M.W.; Foster, P.S.; Rothenberg, M.E. Enterocyte expression of the eotaxin and interleukin-5 transgenes induces compartmentalized dysregulation of eosinophil trafficking. J. Biol. Chem. 2002, 277, 4406–4412. [Google Scholar] [CrossRef] [Green Version]
- McKenzie, G.J.; Emson, C.L.; Bell, S.E.; Anderson, S.; Fallon, P.; Zurawski, G.; Murray, R.; Grencis, R.; McKenzie, A.N. Impaired Development of Th2 Cells in IL-13-Deficient Mice. Immunity 1998, 9, 423–432. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.; Takeda, K.; Shirashi, Y.; Okamoto, M.; Dakhama, A.; Joetham, A.; Gelfand, E.W. Peanut-induced intestinal allergy is mediated through a mast cell-IgE-FcepsilonRI-IL-13 pathway. J. Allergy Clin. Immunol. 2010, 126, 306–316. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiménez, M.; Muñoz, F.C.; Cervantes-García, D.; Cervantes, M.M.; Hernández-Mercado, A.; Barrón-García, B.; Moreno Hernández-Duque, J.L.; Rodríguez-Carlos, A.; Rivas-Santiago, B.; Salinas, E. Protective effect of glycomacropeptide on the atopic dermatitis-like dysfunctional skin barrier in rats. J. Med. Food 2020. [Google Scholar] [CrossRef] [PubMed]
- Furuta, G.T.; Atkins, F.D.; Lee, N.A.; Lee, J.J. Changing roles of eosinophils in health and disease. Ann. Allergy Asthma Immunol. 2014, 113, 3–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Travers, J.; Rothenberg, M.E. Eosinophils in Mucosal Immune Responses. Mucosal Immunol. 2015, 8, 464–475. [Google Scholar] [CrossRef] [PubMed]
- Nussbaum, J.C.; Van Dyken, S.J.; von Moltke, J.; Cheng, L.E.; Mohapatra, A.; Molofsky, A.B.; Thornton, E.E.; Krummel, M.F.; Chawla, A.; Liang, H.E.; et al. Type 2 innate lymphoid cells control eosinophil homeostasis. Nature 2013, 502, 245–248. [Google Scholar] [CrossRef] [Green Version]
- Gowthaman, U.; Chen, J.S.; Zhang, B.; Flynn, W.F.; Lu, Y.; Song, W.; Joseph, J.; Gertie, J.A.; Xu, L.; Collet, M.A.; et al. Identification of a T follicular helper cell subset that drives anaphylactic IgE. Science 2019, 365, eaaw6433. [Google Scholar] [CrossRef]
- Schade, R.P.; Van Ieperen-Dan Dijk, A.; Van Reijsen, F.C.; Versluis, C.; Kimpen, J.L.; Knol, E.F.; Bruijnzeel-Koomen, C.A.; Van Hoffen, E. Differences in antigen-specific T-cell responses between infants with atopic dermatitis with and without cow’s milk allergy: Relevance of TH2 cytokines. J. Allergy Clin. Immunol. 2000, 106, 1155–1162. [Google Scholar] [CrossRef]
- Zhang, J.; Su, H.; Li, Q.; Wu, H.; Liu, M.; Huang, J.; Zeng, M.; Zheng, Y.; Sun, X. Oral administration of Clostridium butyricum CGMCC0313-1 inhibits β-lactoglobulin-induced intestinal anaphylaxis in a mouse model of food allergy. Gut Pathog. 2017, 9, 11. [Google Scholar] [CrossRef] [Green Version]
- Gorelik, L.; Fields, P.E.; Flavell, R.A. Cutting Edge: TGF-β Inhibits ThType 2 Development Through Inhibition of GATA-3 Expression. J. Immunol. 2000, 165, 4773–4777. [Google Scholar] [CrossRef] [Green Version]
- Okamoto, A.; Kawamura, T.; Kanbe, K.; Kanamaru, Y.; Ogawa, H.; Okamura, K.; Nakao, A. Suppression of serum IgE response and systemic anaphylaxis in a food allergy model by orally administered high-dose TGF-beta. Int. Immunol. 2005, 17, 705–712. [Google Scholar] [CrossRef]
- Shin, H.S.; Eom, J.E.; Shin, D.U.; Yeon, S.H.; Lim, S.I.; Lee, S.Y. Preventive Effects of a Probiotic Mixture in an Ovalbumin-Induced Food Allergy Model. J. Microbiol. Biotechnol. 2018, 28, 65–76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hong, J.Y.; Li, S.S.; Hu, T.Y.; Liu, Z.Q.; Yu, D.; Yu, H.Q.; Guan, L.; Wu, G.H.; Zeng, H.T.; Liu, Z.G.; et al. Frontline Science: TLR3 activation inhibits food allergy in mice by inducing IFN-γ+ Foxp3+ regulatory T cells. J. Leukoc. Biol. 2019, 106, 1201–1209. [Google Scholar] [CrossRef] [PubMed]
- Requena, P.; González, R.; López-Posadas, R.; Abadía-Molina, A.; Suárez, M.D.; Zarzuelo, A.; Sánchez de Medina, F.; Martínez-Agustín, O. The intestinal antiinflammatory agent glycomacropeptide has immunomodulatory actions on rat splenocytes. Biochem. Pharmacol. 2010, 79, 1797–1804. [Google Scholar] [CrossRef] [PubMed]
- Del Prete, G.; De Carli, M.; Almerigogna, F.; Giudizi, M.G.; Biagiotti, R.; Romagnani, S. Human IL-10 is produced by both type 1 helper (Th1) and type 2 helper (Th2) T cell clones and inhibits their antigen-specific proliferation and cytokine production. J. Immunol. 1993, 150, 353–360. [Google Scholar]
- Konkel, J.E.; Chen, W.J. Balancing acts: The role of TGF-β in the mucosal immune system. Trends Mol. Med. 2011, 17, 668–676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Favre, L.; Spertini, F.; Corthésy, B. Secretory IgA Possesses Intrinsic Modulatory Properties Stimulating Mucosal and Systemic Immune Responses. J. Immunol 2005, 175, 2793–2800. [Google Scholar] [CrossRef] [Green Version]
- Corthésy, B. Multi-faceted functions of secretory IgA at mucosal surfaces. Front. Immunol. 2013, 4, 185. [Google Scholar] [CrossRef] [Green Version]
- Ye, L.; Chen, Q.S.; Li, W.; Yan, Y.L.; Zhao, P.; Pang, G.C.; Hu, Z.H. Effect of Casein Glycomacropeptide on Phagocytic Cells and Intestinal Mucosa Immune Cells in Mice. Food Sci. 2014, 35, 234–240. [Google Scholar] [CrossRef]
- Järvinen, K.M.; Westfall, J.E.; Seppo, M.S.; James, A.K.; Tsuang, A.J.; Feustel, P.J.; Sampson, H.A.; Berin, C. Role of maternal elimination diets and human milk IgA in the development of cow’s milk allergy in the infants. Clin. Exp. Allergy 2014, 44, 69–78. [Google Scholar] [CrossRef]
- Frossard, C.P.; Hauser, C.; Eigenmann, P.A. Antigen-specific secretory IgA antibodies in the gut are decreased in a mouse model of food allergy. J. Allergy Clin. Immunol. 2004, 114, 377–382. [Google Scholar] [CrossRef]
- Matsumoto, R.; Matsumoto, M.; Mita, S.; Hitoshi, Y.; Ando, M.; Araki, S.; Yamaguchi, N.; Tominaga, A.; Takatsu, K. Interleukin-5 induces maturation but not class switching of surface IgA-positive B cells into IgA-secreting cells. Immunology 1989, 66, 32–38. [Google Scholar] [PubMed]
- Sonoda, E.; Matsumoto, R.; Hitoshi, Y.; Ishii, T.; Sugimoto, M.; Araki, S.; Tominaga, A.; Yamaguchi, N.; Tkatsu, K. Transforming Growth factor β induces IgA production and acts additively with interleukin 5 for IgA production. J. Exp. Med. 1989, 170, 1415–1420. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Target | Sequence | Access Number |
---|---|---|
GATA3 | Fw: AGAAGGCAGGGAGTGTGTGA | NM_133293.1 |
Rv: TTAGCGTTCCTCCTCCAGAG | ||
Foxp3 | Fw: CGGGAGAGTTTCTCAAGCAC | NM_001108250.1 |
Rv: CACAGGTGGAGCTTTTGTCA | ||
T-bet | Fw: TCCAAGTTCAACCAGCACCA | NM_001107043.1 |
Rv: ATAAGCGGTTCCCTGGCATA | ||
RORγt | Fw: GCAGCAACGGGAACAAGTAG | XM_006232926.3 |
Rv: GGGCTATACTCAAGGTGGCA | ||
IgA-Fc | Fw: CGGAACTATGAATGTGACCT | AJ510151.1 |
Rv: GACTAAGGAGGGTTTTGGAC | ||
IgE-Fc | Fw: CGTCTGTCGGTTCTGATCTT | X00923.1 |
Rv: GTCGCAGGATGAATGGAGTA | ||
Mcpt2 | Fw: ATTATCGGTGGTGTGGAGTC | NM_172044.1 |
Rv: GTGTGGATTCTCGCTTTCTC | ||
IFN-γ | Fw: GCCTAGAAAGTCTGAAGAAC | NM_138880.2 |
Rv: GAGATAATCTGGCTCTCAAG | ||
TNF-α | Fw: GCCTCAGCCTCTTCTCAT | NM_012675.3 |
Rv: CGCTTGGTGGTTTGCTACGA | ||
IL-1β | Fw: AAATCTCACAGCAGCATCTC | NM_031512.2 |
Rv: ACTAGCAGGTCGTCATCATC | ||
IL-5 | Fw: CAGTGGTGAAAGAGACCTTG | NM_021834.1 |
Rv: GTATGTCTAGCCCCTGAAAG | ||
IL-13 | Fw: ATCGAGGAGCTGAGCAACAT | NM_053828.1 |
Rv: ATCCGAGGCCTTTTGGTTAC | ||
IL-17 | Fw: CGTGAAGGTCAACCTGAAAG | NM_001106897.1 |
Rv: TCTATCAGGGTCCTCATTGC | ||
IL-22 | Fw: CTCTGCCCATCAACTCCCAA | NM_001191988.1 |
Rv: TTGGCTTTGACTCCTCGGAA | ||
β-Actin | Fw: GTCGTACCACTGGCATTGTG | NM_031144.3 |
Rv: GCTGTGGTGGTGAAGCTGTA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Reyes-Pavón, D.; Cervantes-García, D.; Bermúdez-Humarán, L.G.; Córdova-Dávalos, L.E.; Quintanar-Stephano, A.; Jiménez, M.; Salinas, E. Protective Effect of Glycomacropeptide on Food Allergy with Gastrointestinal Manifestations in a Rat Model through Down-Regulation of Type 2 Immune Response. Nutrients 2020, 12, 2942. https://doi.org/10.3390/nu12102942
Reyes-Pavón D, Cervantes-García D, Bermúdez-Humarán LG, Córdova-Dávalos LE, Quintanar-Stephano A, Jiménez M, Salinas E. Protective Effect of Glycomacropeptide on Food Allergy with Gastrointestinal Manifestations in a Rat Model through Down-Regulation of Type 2 Immune Response. Nutrients. 2020; 12(10):2942. https://doi.org/10.3390/nu12102942
Chicago/Turabian StyleReyes-Pavón, Diana, Daniel Cervantes-García, Luis G. Bermúdez-Humarán, Laura Elena Córdova-Dávalos, Andrés Quintanar-Stephano, Mariela Jiménez, and Eva Salinas. 2020. "Protective Effect of Glycomacropeptide on Food Allergy with Gastrointestinal Manifestations in a Rat Model through Down-Regulation of Type 2 Immune Response" Nutrients 12, no. 10: 2942. https://doi.org/10.3390/nu12102942
APA StyleReyes-Pavón, D., Cervantes-García, D., Bermúdez-Humarán, L. G., Córdova-Dávalos, L. E., Quintanar-Stephano, A., Jiménez, M., & Salinas, E. (2020). Protective Effect of Glycomacropeptide on Food Allergy with Gastrointestinal Manifestations in a Rat Model through Down-Regulation of Type 2 Immune Response. Nutrients, 12(10), 2942. https://doi.org/10.3390/nu12102942