Ethanol Extract of Illicium henryi Attenuates LPS-Induced Acute Kidney Injury in Mice via Regulating Inflammation and Oxidative Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemical and Reagents
2.2. Preparation and Characterization of EEIH
2.3. Cell Culture
2.4. Experimental Animals
2.5. Treatment of Mice
2.6. Kidney Histopathology
2.7. Biochemical Examinations of Serum Creatinine (Cre) and Blood Urea Nitrogen (BUN) Levels
2.8. Measurement of Renal MDA, MPO, NO, SOD, and GSH Levels or Activities
2.9. ELISA
2.10. Quantitative Real-Time PCR (qRT-PCR)
2.11. Western Blotting
2.12. MTT Assay
2.13. ROS Detection
2.14. Statistical Analysis
3. Results
3.1. Effects of EEIH on Body Weight and Renal Index in LPS-Treated Mice
3.2. EEIH Attenuated Histological Damage and Reduced MPO Activities in Renal Tissue of LPS-Treated Mice
3.3. EEIH Reduced the Serum Cre and BUN Levels in LPS-Induced AKI Mice
3.4. EEIH Exerted Anti-Inflammatory Activity in Renal Tissue of LPS-Induced AKI Mice via TLR4/NF-κB Pathway
3.5. EEIH Relieved Kidney Oxidative and Nitrosative Stress in Mice Induced by LPS through Upregulating Nrf2 mRNA Expression
3.6. EEIH Inhibited ROS Production in RAW264.7 Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Jiang, W.; Xu, J.; Shen, B.; Wang, Y.; Teng, J.; Ding, X. Acute kidney injury risk assessment. Contrib. Nephrol. 2018, 193, 13–20. [Google Scholar] [PubMed]
- Fan, H.Y.; Qi, D.; Yu, C.; Zhao, F.; Liu, T.; Zhang, Z.K.; Yang, M.Y.; Zhang, L.M.; Chen, D.Q.; Du, Y. Paeonol protects endotoxin-induced acute kidney injury: Potential mechanism of inhibiting TLR4-NF-κB signal pathway. Oncotarget 2016, 7, 39497–39510. [Google Scholar] [CrossRef] [PubMed]
- Acedillo, R.R.; Wald, R.; McArthur, E.; Nash, D.M.; Silver, S.A.; James, M.T.; Schull, M.J.; Siew, E.D.; Matheny, M.E.; House, A.A.; et al. Characteristics and outcomes of patients discharged home from an emergency department with AKI. Clin. J. Am. Soc. Nephrol. 2017, 12, 1215–1225. [Google Scholar] [CrossRef] [PubMed]
- Odutayo, A.; Wong, C.X.; Farkouh, M.; Altman, D.G.; Hopewell, S.; Emdin, C.A.; Hunn, B.H. AKI and long-term risk for cardiovascular events and mortality. J. Am. Soc. Nephrol. 2017, 28, 377–387. [Google Scholar] [CrossRef] [PubMed]
- Cerda, J.; Baldwin, I.; Honore, P.M.; Villa, G.; Kellum, J.A.; Ronco, C. Role of technology for the management of AKI in critically ill patients: From adoptive technology to precision continuous renal replacement therapy. Blood Purif. 2016, 42, 248–265. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Hua, Q.; Li, N.; Zhao, M.; Cui, Y. Protective effects of evodiamine against LPS-induced acute kidney injury through regulation of ROS-NF-κB-mediated inflammation. Evid. Based Complement. Altern. Med. 2019, 2019, 2190847. [Google Scholar] [CrossRef] [PubMed]
- Singer, M.; Deutschman, C.S.; Seymour, C.W.; Shankar-Hari, M.; Annane, D.; Bauer, M.; Bellomo, R.; Bernard, G.R.; Chiche, J.D.; Coopersmith, C.M.; et al. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA 2016, 315, 801–810. [Google Scholar] [CrossRef]
- Alobaidi, R.; Basu, R.K.; Goldstein, S.L.; Bagshaw, S.M. Sepsis-Associated Acute Kidney Injury. Semin. Nephrol. 2015, 35, 2–11. [Google Scholar] [CrossRef]
- Mir, S.M.; Ravuri, H.G.; Pradhan, R.K.; Narra, S.; Kumar, J.M.; Kuncha, M.; Kanjilal, S.; Sistla, R. Ferulic acid protects lipopolysaccharide-induced acute kidney injury by suppressing inflammatory events and upregulating antioxidant defenses in Balb/c mice. Biomed. Pharmacother. 2018, 100, 304–315. [Google Scholar] [CrossRef]
- Kumar, S.; Tripathy, S.; Jyoti, A.; Singh, S.G. Recent advances in biosensors for diagnosis and detection of sepsis: A comprehensive review. Biosens. Bioelectron. 2019, 124–125, 205–215. [Google Scholar] [CrossRef]
- Chen, Y.; Luan, L.; Wang, C.; Song, M.; Zhao, Y.; Yao, Y.; Yang, H.; Ma, B.; Fan, H. Dexmedetomidine protects against lipopolysaccharide-induced early acute kidney injury by inhibiting the iNOS/NO signaling pathway in rats. Nitric Oxide 2019, 85, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Jin, S.; Teng, X.; Hu, Z.; Zhang, Z.; Qiu, X.; Tian, D.; Wu, Y. Hydrogen sulfide attenuates LPS-induced acute kidney injury by inhibiting inflammation and oxidative stress. Oxid. Med. Cell. Longev. 2018, 2018, 6717212. [Google Scholar] [CrossRef]
- Khajevand-Khazaei, M.R.; Azimi, S.; Sedighnejad, L.; Salari, S.; Ghorbanpour, A.; Baluchnejadmojarad, T.; Mohseni-Moghaddam, P.; Khamse, S.; Roghani, M. S-allyl cysteine protects against lipopolysaccharide-induced acute kidney injury in the C57BL/6 mouse strain: Involvement of oxidative stress and inflammation. Int. Immunopharmacol. 2019, 69, 19–26. [Google Scholar] [CrossRef]
- Niu, X.; Yao, Q.; Li, W.; Zang, L.; Li, W.; Zhao, J.; Liu, F.; Zhi, W. Harmine mitigates LPS-induced acute kidney injury through inhibition of the TLR4-NF-kappaB/NLRP3 inflammasome signalling pathway in mice. Eur. J. Pharmacol. 2019, 849, 160–169. [Google Scholar] [CrossRef]
- Akcay, A.; Nguyen, Q.; Edelstein, C.L. Mediators of inflammation in acute kidney injury. Med. Inflamm. 2009, 2009, 137072. [Google Scholar] [CrossRef]
- An, X.; Shang, F. RA-XII exerts anti-oxidant and anti-inflammatory activities on lipopolysaccharide-induced acute renal injury by suppressing NF-kappaB and MAPKs regulated by HO-1/Nrf2 pathway. Biochem. Biophys. Res. Commun. 2018, 495, 2317–2323. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.Q.; Hu, H.H.; Wang, Y.N.; Feng, Y.L.; Cao, G.; Zhao, Y.Y. Natural products for the prevention and treatment of kidney disease. Phytomedicine 2018, 50, 50–60. [Google Scholar] [CrossRef] [PubMed]
- Xiang, W.J.; Ma, L.; Hu, L.H. Neolignans and flavonoids from the root bark of Illicium henryi. Fitoterapia 2010, 81, 1228–1231. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.D.; Gao, A.; Gong, J. An overview of pharmaceutical research on Illicium henryi Diels. J. Anhui Agric. Sci. 2011, 39, 8376–8377. [Google Scholar]
- Wang, S.; Li, T.; Qu, W.; Li, X.; Ma, S.; Wang, Z.; Liu, W.; Hou, S.; Fu, J. The Effects of Xiangqing Anodyne Spray on treating acute soft-Tissue injury mainly depend on suppressing activations of AKT and p38 pathways. Evid. Based Complement. Altern. Med. 2016, 2016, 9213489. [Google Scholar] [CrossRef]
- Geng, C.A.; Chen, J.J. The progress of anti-HBV constituents from medicinal plants in China. Nat. Prod. Bioprospect. 2018, 8, 227–244. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.C.; Liu, Z.L. Analysis of the essential oil of Illicium henryi Diels root bark and its insecticidal activity against Liposcelis bostrychophila Badonnel. J. Food Prot. 2015, 78, 772–777. [Google Scholar] [CrossRef] [PubMed]
- Zhuang, P.Y.; Zhang, G.J.; Wang, X.J.; Zhang, Y.; Yu, S.S.; Ma, S.G.; Liu, Y.B.; Qu, J.; Li, Y.; Xu, S.; et al. Prenylated C6-C3 compounds from the roots of Illicium henryi. Phytochemistry 2013, 86, 176–183. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Qu, W.; Li, T.; Guo, K.; Liu, W.; Wang, Z.; Fu, J. Xiangqing anodyne spray (XQAS): A combination of ethanol extracts of Cynanchum paniculatum and Illicium henryi for treating soft-tissue injury. Int. J. Clin. Exp. Med. 2015, 8, 12716–12725. [Google Scholar] [PubMed]
- Stoyanoff, T.R.; Rodriguez, J.P.; Todaro, J.S.; Colavita, J.P.M.; Torres, A.M.; Aguirre, M.V. Erythropoietin attenuates LPS-induced microvascular damage in a murine model of septic acute kidney injury. Biomed. Pharmacother. 2018, 107, 1046–1055. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.X.; Zhang, J.; Chen, F.Y.; Chen, X.F.; Zhou, Z.H.; Wang, H. Activation of RAW264.7 macrophages by the polysaccharides from the roots of Actinidia eriantha and its molecular mechanisms. Carbohydr. Polym. 2015, 121, 388–402. [Google Scholar] [CrossRef]
- Zhu, B.N.; Dong, J.; Gao, X.Y.; He, Y.F.; Sun, H.X. Antiasthmatic effects of Sanglong Pingchuan decoction through inducing a balanced Th1/Th2 Immune response. Evid. Based Complement. Altern. Med. 2018, 2018, 2629565. [Google Scholar] [CrossRef]
- Wang, H.; Ma, S. The cytokine storm and factors determining the sequence and severity of organ dysfunction in multiple organ dysfunction syndrome. Am. J. Emerg. Med. 2008, 26, 711–715. [Google Scholar] [CrossRef]
- Doi, K.; Leelahavanichkul, A.; Yuen, P.S.; Star, R.A. Animal models of sepsis and sepsis-induced kidney injury. J. Clin. Investig. 2009, 119, 2868–2878. [Google Scholar] [CrossRef]
- Coulombe, J.J.; Favreau, L. A new simple semimicro method for colorimetric determination of urea. Clin. Chem. 1963, 9, 102–108. [Google Scholar]
- Clarkson, P.M.; Kearns, A.K.; Rouzier, P.; Rubin, R.; Thompson, P.D. Serum creatine kinase levels and renal function measures in exertional muscle damage. Med. Sci. Sports Exerc. 2006, 38, 623–627. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.B.; Xu, S.; Li, J.; Song, J.; Luo, B.; Song, Y.P.; Zhang, Z.H.; Chen, Y.H.; Xie, D.D.; Yu, D.X.; et al. Farnesoid X receptor agonist obeticholic acid inhibits renal inflammation and oxidative stress during lipopolysaccharide-induced acute kidney injury. Eur. J. Pharmacol. 2018, 838, 60–68. [Google Scholar] [CrossRef] [PubMed]
- Kosaka, J.; Lankadeva, Y.R.; May, C.N.; Bellomo, R. Histopathology of Septic Acute Kidney Injury: A Systematic Review of Experimental Data. Crit. Care Med. 2016, 44, e897–e903. [Google Scholar] [CrossRef] [PubMed]
- Kothari, N.; Keshari, R.S.; Bogra, J.; Kohli, M.; Abbas, H.; Malik, A.; Dikshit, M.; Barthwal, M.K. Increased myeloperoxidase enzyme activity in plasma is an indicator of inflammation and onset of sepsis. J. Crit. Care 2011, 26, 435.e1–435.e7. [Google Scholar] [CrossRef] [PubMed]
- Cunningham, P.N.; Dyanov, H.M.; Park, P.; Wang, J.; Newell, K.A.; Quigg, R.J. Acute renal failure in endotoxemia is caused by TNF acting directly on TNF receptor-1 in kidney. J. Immunol. 2002, 168, 5817–5823. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Zheng, Q.; Hu, X.; Shen, H.; Li, F. Betulin attenuates kidney injury in septic rats through inhibiting TLR4/NF-κB signaling pathway. Life Sci. 2016, 144, 185–193. [Google Scholar] [CrossRef] [PubMed]
- Chawla, L.S.; Seneff, M.G.; Nelson, D.R.; Williams, M.; Levy, H.; Kimmel, P.L.; Macias, W.L. Elevated plasma concentrations of IL-6 and elevated APACHE II score predict acute kidney injury in patients with severe sepsis. Clin. J. Am. Soc. Nephrol. 2007, 2, 22–30. [Google Scholar] [CrossRef]
- Zhang, H.; Chen, M.K.; Li, K.; Hu, C.; Lu, M.H.; Situ, J. Eupafolin nanoparticle improves acute renal injury induced by LPS through inhibiting ROS and inflammation. Biomed. Pharmacother. 2017, 85, 704–711. [Google Scholar] [CrossRef]
- Takeda, K.; Akira, S. Toll-like receptors in innate immunity. Int. Immunol. 2005, 17, 1–14. [Google Scholar] [CrossRef]
- Chowdhury, P.; Sacks, S.H.; Sheerin, N.S. Toll-like receptors TLR2 and TLR4 initiate the innate immune response of the renal tubular epithelium to bacterial products. Clin. Exp. Immunol. 2006, 145, 346–356. [Google Scholar] [CrossRef]
- McGhan, L.J.; Jaroszewski, D.E. The role of toll-like receptor-4 in the development of multi-organ failure following traumatic haemorrhagic shock and resuscitation. Injury 2012, 43, 129–136. [Google Scholar] [CrossRef] [PubMed]
- Cao, C.; Chai, Y.F.; Shou, S.T.; Wang, J.; Huang, Y.; Ma, T. Toll-like receptor 4 deficiency increases resistance in sepsis-induced immune dysfunction. Int. Immunopharmacol. 2018, 54, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Bi, F.F.; Chen, F.; Li, Y.N.; Wei, A.; Cao, W.S. Klotho preservation by Rhein promotes toll-like receptor 4 proteolysis and attenuates lipopolysaccharide-induced acute kidney injury. J. Mol. Med. 2018, 96, 915–927. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, A.F.; Safar, M.M.; Zaki, H.F.; Sayed, H.M. Telluric acid ameliorates endotoxemic kidney injury in mice: Involvement of TLR4, Nrf2, and PI3K/Akt signaling pathways. Inflammation 2017, 40, 1742–1752. [Google Scholar] [CrossRef] [PubMed]
- Prince, P.D.; Fischerman, L.; Toblli, J.E.; Fraga, C.G.; Galleano, M. LPS-induced renal inflammation is prevented by (-)-epicatechin in rats. Redox Biol. 2017, 11, 342–349. [Google Scholar] [CrossRef] [PubMed]
- Nair, A.R.; Masson, G.S.; Ebenezer, P.J.; Del Piero, F.; Francis, J. Role of TLR4 in lipopolysaccharide-induced acute kidney injury: Protection by blueberry. Free Radic. Biol. Med. 2014, 71, 16–25. [Google Scholar] [CrossRef]
- Small, D.M.; Bennett, N.C.; Roy, S.; Gabrielli, B.G.; Johnson, D.W.; Gobe, G.C. Oxidative stress and cell senescence combine to cause maximal renal tubular epithelial cell dysfunction and loss in an in vitro model of kidney disease. Nephron Exp. Nephrol. 2012, 122, 123–130. [Google Scholar] [CrossRef] [PubMed]
- Xia, S.L.; Lin, H.L.; Liu, H.; Lu, Z.D.; Wang, H.; Fan, S.T.; Li, N. Honokiol attenuates sepsis-associated acute kidney injury via the inhibition of oxidative stress and inflammation. Inflammation 2019, 42, 826–834. [Google Scholar] [CrossRef]
- Altavilla, D.; Squadrito, G.; Minutoli, L.; Deodato, B.; Bova, A.; Sardella, A.; Seminara, P.; Passaniti, M.; Urna, G.; Venuti, S.F.; et al. Inhibition of nuclear factor-κB activation by IRFI 042, protects against endotoxin-induced shock. Cardiovasc. Res. 2002, 54, 684–693. [Google Scholar] [CrossRef]
- Bohrer, H.; Qiu, F.; Zimmermann, T.; Zhang, Y.; Jllmer, T.; Mannel, D.; Bottiger, B.W.; Stern, D.M.; Waldherr, R.; Saeger, H.D.; et al. Role of NF-κaB in the mortality of sepsis. J. Clin. Investig. 1997, 100, 972–985. [Google Scholar] [CrossRef]
- Shames, B.D.; Meldrum, D.R.; Selzman, C.H.; Pulido, E.J.; Cain, B.S.; Banerjee, A.; Harken, A.H.; Meng, X. Increased levels of myocardial IκB-α protein promote tolerance to endotoxin. Am. J. Physiol. 1998, 275, H1084–H1091. [Google Scholar] [CrossRef] [PubMed]
- Shi, M.; Zeng, X.X.; Guo, F.; Huang, R.S.; Feng, Y.H.; Ma, L.; Zhou, L.; Fu, P. Anti-inflammatory pyranochalcone derivative attenuates LPS-induced acute kidney injury via inhibiting TLR4/NF-κB pathway. Molecules 2017, 22, 1683. [Google Scholar] [CrossRef] [PubMed]
- Pavlakou, P.; Liakopoulos, V.; Eleftheriadis, T.; Mitsis, M.; Dounousi, E. Oxidative stress and acute Kidney injury in critical illness: Pathophysiologic mechanisms-biomarkers-interventions, and future perspectives. Oxid. Med. Cell. Longev. 2017, 2017, 6193694. [Google Scholar] [CrossRef] [PubMed]
- Poljsak, B.; Suput, D.; Milisav, I. Achieving the balance between ROS and antioxidants: When to use the synthetic antioxidants. Oxid. Med. Cell. Longev. 2013, 2013, 956792. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Gong, X.B.; Huang, L.G.; Wang, Z.X.; Wan, R.Z.; Zhang, P.; Zhang, Q.Y.; Chen, Z.; Zhang, B.S. Diosmetin exerts anti-oxidative, anti-inflammatory and anti-apoptotic effects to protect against endotoxin-induced acute hepatic failure in mice. Oncotarget 2017, 8, 30723–30733. [Google Scholar] [CrossRef] [PubMed]
- Ballatori, N.; Krance, S.M.; Notenboom, S.; Shi, S.; Tieu, K.; Hammond, C.L. Glutathione dysregulation and the etiology and progression of human diseases. Biol. Chem. 2009, 390, 191–214. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Gupta, E.; Kaushik, S.; Kumar Srivastava, V.; Mehta, S.K.; Jyoti, A. Evaluation of oxidative stress and antioxidant status: Correlation with the severity of sepsis. Scand. J. Immunol. 2018, 87, e12653. [Google Scholar] [CrossRef] [PubMed]
- Vargas, F.; Romecin, P.; Garcia-Guillen, A.I.; Wangesteen, R.; Vargas-Tendero, P.; Paredes, M.D.; Atucha, N.M.; Garcia-Estan, J. Flavonoids in kidney health and disease. Front. Physiol. 2018, 9, 394. [Google Scholar] [CrossRef]
- La Russa, D.; Giordano, F.; Marrone, A.; Parafati, M.; Janda, E.; Pellegrino, D. Oxidative imbalance and kidney damage in cafeteria diet-induced rat model of metabolic syndrome: Effect of bergamot polyphenolic fraction. Antioxidants 2019, 8, 66. [Google Scholar] [CrossRef]
- Sato, K.; Miyakawa, K.; Takeya, M.; Hattori, R.; Yui, Y.; Sunamoto, M.; Ichimori, Y.; Ushio, Y.; Takahashi, K. Immunohistochemical expression of inducible nitric oxide synthase (iNOS) in reversible endotoxic shock studied by a novel monoclonal antibody against rat iNOS. J. Leukoc. Biol. 1995, 57, 36–44. [Google Scholar] [CrossRef]
- Guzik, T.J.; West, N.E.; Pillai, R.; Taggart, D.P.; Channon, K.M. Nitric oxide modulates superoxide release and peroxynitrite formation in human blood vessels. Hypertension 2002, 39, 1088–1894. [Google Scholar] [CrossRef]
- Moi, P.; Chan, K.; Asunis, I.; Cao, A.; Kan, Y.W. Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region. Proc. Natl. Acad. Sci. USA 1994, 91, 9926–9930. [Google Scholar] [CrossRef] [PubMed]
- Kwak, M.K.; Wakabayashi, N.; Kensler, T.W. Chemoprevention through the Keap1-Nrf2 signaling pathway by phase 2 enzyme inducers. Mutat. Res. 2004, 555, 133–148. [Google Scholar] [CrossRef] [PubMed]
- Saito, H. Toxico-pharmacological perspective of the Nrf2-Keap1 defense system against oxidative stress in kidney diseases. Biochem. Pharmacol. 2013, 85, 865–872. [Google Scholar] [CrossRef] [PubMed]
- Yoh, K.; Hirayama, A.; Ishizaki, K.; Yamada, A.; Takeuchi, M.; Yamagishi, S.; Morito, N.; Nakano, T.; Ojima, M.; Shimohata, H.; et al. Hyperglycemia induces oxidative and nitrosative stress and increases renal functional impairment in Nrf2-deficient mice. Genes Cells 2008, 13, 1159–1170. [Google Scholar] [CrossRef] [PubMed]





| Gene | Primer Sequence | Product Size (bp) |
|---|---|---|
| TNF-α | 5′-CCACCACGCTCTTCTGTCTAC-3′ 5′-GAGGGTCTGGGCCATAGAA-3′ | 104 |
| IL-6 | 5′-ACAACCACGGCCTTCCCTACTT-3′ 5′-CACGATTTCCCAGAGAACATGTG-3′ | 129 |
| IL-1β | 5′- GTAATGAAAGACGGCACACC -3′ 5′- CTTTGGGTATTGCTTGGGAT -3′ | 98 |
| iNOS | 5′-GGCAGCCTGTGAGACCTTTG-3′ 5′-GCATTGGAAGTGAAGCGTTTC-3′ | 72 |
| COX-2 | 5′- GCAGATGACTGCCCAACTC-3′ 5′- CAGGGATGAACTCTCTCCGT-3′ | 103 |
| TLR4 | 5′-GTTGCAGAAAATGCCAGGATG-3′ 5′-CAGGGATTCAAGCTTCCTGGT-3′ | 101 |
| NF-κB p65 | 5′-ACGACATTGAGGTTCGGTTC-3′ 5′-ATCTTGTGATAGGGCGGTGT-3′ | 124 |
| Nrf2 | 5′-AGCCAGCTGACCTCCTTAGA -3′ 5′-AGTGACTGACTGATGGCAGC-3′ | 131 |
| GAPDH | 5′-ATCCTGTAGGCCAGGTGATG-3′ 5′-TATGCCCGAGGACAATAAGG-3′ | 113 |
| Groups | Dose (mg/kg) | Body Weight (g) | Renal Index (g/100 g Body Weight) | |
|---|---|---|---|---|
| Before Treatment | After Treatment | |||
| NC | − | 21.54 ± 0.92 | 24.74 ± 1.82 | 1.43 ± 0.21 |
| MC | − | 21.38 ± 0.94 | 24.18 ± 1.50 | 1.72 ± 0.10 # |
| DEX | 1.8 | 21.94 ± 1.14 | 24.44 ± 2.00 | 1.51 ± 0.11 * |
| EEIH | 1.25 | 21.19 ± 0.97 | 25.09 ± 1.97 | 1.62 ± 0.12 |
| 2.5 | 21.61 ± 1.03 | 24.81 ± 1.30 | 1.60 ± 0.13 | |
| 5.0 | 22.04 ± 0.74 | 25.14 ± 2.34 | 1.53 ± 0.13 * | |
| Group | Dose (mg/kg) | MPO (U/g Tissue) | Cre (µmol/L) | BUN (mmol/L) |
|---|---|---|---|---|
| NC | − | 0.81 ± 0.20 | 24.00 ± 1.58 | 8.97 ± 1.20 |
| MC | − | 9.77 ± 0.73 ### | 55.60 ± 2.70 ### | 29.95 ± 1.96 ### |
| DEX | 1.8 | 1.09 ± 0.26 *** | 37.00 ± 3.54 *** | 16.92 ± 1.46 *** |
| EEIH | 1.25 | 0.94 ± 0.38 *** | 31.00 ± 1.83 *** | 19.98 ± 2.11 *** |
| 2.5 | 0.84 ± 0.30 *** | 29.60 ± 2.07 *** | 18.50 ± 1.73 *** | |
| 5.0 | 0.87 ± 0.31 *** | 27.20 ± 2.39 *** | 16.12 ± 1.24 *** |
| Group | Dose (mg/kg) | TNF-α (pg/mg) | IL-1β (pg/mg) | IL-6 (pg/mg) |
|---|---|---|---|---|
| NC | − | 80.62 ± 2.28 | 64.69 ± 3.94 | 105.40 ± 3.94 |
| MC | − | 140.40 ± 5.15 ### | 135.54 ± 8.20 ### | 168.74 ± 7.23 ### |
| DEX | 1.8 | 98.13 ± 8.34 *** | 100.53 ± 9.48 ** | 135.12 ± 5.99 ** |
| EEIH | 1.25 | 96.13 ± 4.28 *** | 97.49 ± 3.97 *** | 131.43 ± 9.67 ** |
| 2.5 | 92.69 ± 7.54 *** | 83.22 ± 6.84 *** | 128.25 ± 6.70 *** | |
| 5.0 | 84.74 ± 5.65 *** | 77.15 ± 5.34 *** | 119.16 ± 9.35 *** |
| Group | Dose (mg/kg) | TNF-α | IL-1β | IL-6 | COX-2 |
|---|---|---|---|---|---|
| NC | − | 1.00 ± 0.32 | 1.00 ± 0.19 | 1.00 ± 0.61 | 1.00 ± 0.46 |
| MC | − | 31.46 ± 2.55 ### | 13.75 ± 0.93 ### | 260.1 ± 20.8 ### | 26.84 ± 2.34 ### |
| DEX | 1.8 | 18.94 ± 2.07 *** | 9.24 ± 0.64 *** | 166.2 ± 25.2 *** | 15.54 ± 2.29 *** |
| EEIH | 1.25 | 18.51 ± 2.41 *** | 5.67 ± 1.11 *** | 178.9 ± 22.4 *** | 14.04 ± 1.52 *** |
| 2.5 | 15.17 ± 1.60 *** | 5.29 ± 0.80 *** | 188.3 ± 10.8 *** | 13.74 ± 1.70 *** | |
| 5.0 | 12.29 ± 2.10 *** | 4.02 ± 0.61 *** | 112.5 ± 14.0 *** | 11.41 ± 1.54 *** |
| Group | Dose (mg/kg) | SOD (U/mg prot) | GSH (µmol/g prot) | MDA (nmol/mg prot) | NO (µmol/g prot) |
|---|---|---|---|---|---|
| NC | − | 34.26 ± 1.79 | 10.59 ± 0.97 | 2.50 ± 0.28 | 0.24 ± 0.06 |
| MC | − | 22.32 ± 2.92 ### | 6.57 ± 0.53 ### | 5.43 ± 0.43 ### | 1.01 ± 0.05 ### |
| DEX | 1.8 | 30.82 ± 3.21 ** | 12.69 ± 0.78 *** | 2.99 ± 0.45 *** | 0.29 ± 0.06 *** |
| EEIH | 1.25 | 45.07 ± 3.77 *** | 14.08 ± 0.70 *** | 4.47 ± 0.42 ** | 0.26 ± 0.03 *** |
| 2.5 | 42.78 ± 3.14 *** | 15.88 ± 1.11 *** | 3.51 ± 0.32 *** | 0.25 ± 0.06 *** | |
| 5.0 | 47.59 ± 3.79 *** | 16.89 ± 0.68 *** | 2.80 ± 0.25 *** | 0.24 ± 0.05 *** |
| Group | Dose (mg/kg) | iNOS | Nrf2 |
|---|---|---|---|
| NC | − | 1.00 ± 0.42 | 1.00 ± 0.21 |
| MC | − | 23.68 ± 1.39 ### | 2.00 ± 0.24 ### |
| DEX | 1.8 | 9.62 ± 1.72 *** | 3.16 ± 0.13 *** |
| EEIH | 1.25 | 8.26 ± 1.53 *** | 3.26 ± 0.22 *** |
| 2.5 | 7.11 ± 1.99 *** | 3.67 ± 0.23 *** | |
| 5.0 | 4.38 ± 0.48 *** | 4.09 ± 0.20 *** |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Islam, M.S.; Miao, L.; Yu, H.; Han, Z.; Sun, H. Ethanol Extract of Illicium henryi Attenuates LPS-Induced Acute Kidney Injury in Mice via Regulating Inflammation and Oxidative Stress. Nutrients 2019, 11, 1412. https://doi.org/10.3390/nu11061412
Islam MS, Miao L, Yu H, Han Z, Sun H. Ethanol Extract of Illicium henryi Attenuates LPS-Induced Acute Kidney Injury in Mice via Regulating Inflammation and Oxidative Stress. Nutrients. 2019; 11(6):1412. https://doi.org/10.3390/nu11061412
Chicago/Turabian StyleIslam, Md Sodrul, Lingyan Miao, Hui Yu, Ziyi Han, and Hongxiang Sun. 2019. "Ethanol Extract of Illicium henryi Attenuates LPS-Induced Acute Kidney Injury in Mice via Regulating Inflammation and Oxidative Stress" Nutrients 11, no. 6: 1412. https://doi.org/10.3390/nu11061412
APA StyleIslam, M. S., Miao, L., Yu, H., Han, Z., & Sun, H. (2019). Ethanol Extract of Illicium henryi Attenuates LPS-Induced Acute Kidney Injury in Mice via Regulating Inflammation and Oxidative Stress. Nutrients, 11(6), 1412. https://doi.org/10.3390/nu11061412
