Changes in the Anti-Allergic Activities of Sesame by Bioconversion
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Sample Preparation
2.3. Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis (SDS-PAGE)
2.4. Cell Culture and Cell Viability Assay
2.5. Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
2.6. Enzyme-Linked Immunosorbent Assay (ELISA)
2.7. Western Blot Analysis
2.8. Statistical Analysis
3. Results and Disscusion
3.1. Changes in Protein Distribution
3.2. Cell Viability
3.3. mRNA Expressions of IL-1β, IL-6, ICAM-1, TARC, and MDC
3.4. IL-1β, IL-6, TARC, and MDC Production
3.5. Activation of STAT1 and NF-κB
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Suja, K.P.; Jayalekshmy, A.; Arumughan, C. Antioxidant activity of sesame cake extract. Food Chem. 2005, 91, 213–219. [Google Scholar] [CrossRef]
- Kang, M.H.; Naito, M.; Tsujihara, N.; Osawa, T. Sesamolin inhibits lipid peroxidation in rat liver and kidney. J. Nutr. 1998, 128, 1018–1022. [Google Scholar] [PubMed]
- Siao, A.C.; Hou, C.W.; Kao, Y.H.; Jeng, K.C. Effect of sesamin on apoptosis and cell cycle arrest in human breast cancer MCF-7 cells. Asian Pac. J. Cancer Prev. 2015, 16, 3779–3783. [Google Scholar] [CrossRef] [PubMed]
- Hsu, D.Z.; Chen, K.T.; Li, Y.H.; Chuang, Y.C.; Liu, M.Y. Sesamol delays mortality and attenuates hepatic injury after cecal ligation and puncture in rats: Role of oxidative stress. Shock 2006, 25, 528–532. [Google Scholar] [CrossRef] [PubMed]
- Dalal, I.; Goldberg, M.; Katz, Y. Sesame seed food allergy. Curr. Allergy Asthma Rep. 2012, 12, 339–345. [Google Scholar] [CrossRef] [PubMed]
- Gangur, V.; Kelly, C.; Navuluri, L. Sesame allergy: A growing food allergy of global proportions? Ann. Allergy Asthma Immunol. 2005, 95, 4–11. [Google Scholar] [CrossRef]
- Leduc, V.; Moneret-Vautrin, D.A.; Tzen, J.T.C.; Morisset, M.; Guerin, L.; Kanny, G. Identification of oleosins as major allergens in sesame seed allergic patients. Allergy 2006, 61, 349–356. [Google Scholar] [CrossRef] [PubMed]
- Sebastiani, S.; Albanesi, C.; De Pità, O.; Puddu, P.; Cavani, A.; Girolomoni, G. The role of chemokines in allergic contact dermatitis. Arch. Dermatol. Res. 2002, 293, 552–559. [Google Scholar] [CrossRef] [PubMed]
- Saeki, H.; Tamaki, K. Thymus and activation regulated chemokine (TARC)/CCL17 and skin diseases. J. Dermatol. Sci. 2006, 43, 75–84. [Google Scholar] [CrossRef] [PubMed]
- Ju, S.M.; Song, H.Y.; Lee, S.J.; Seo, W.Y.; Sin, D.H.; Goh, A.R.; Kang, Y.H.; Kang, I.J.; Won, M.H.; Yi, J.S.; et al. Suppression of thymus-and activation-regulated chemokine (TARC/CCL17) production by 1,2,3,4,6-penta-O-galloyl-β-d-glucose via blockade of NF-κB and STAT1 activation in the HaCaT cells. Biochem. Biophys. Res. Commun. 2009, 387, 115–120. [Google Scholar] [CrossRef] [PubMed]
- Qi, X.F.; Kim, D.H.; Yoon, Y.S.; Li, J.H.; Song, S.B.; Jin, D.; Hunag, X.Z.; Teng, Y.C.; Lee, K.J. The adenylyl cyclase-cAMP system suppresses TARC/CCL17 and MDC/CCL22 production through p38 MAPK and NF-κB in HaCaT keratinocytes. Mol. Immunol. 2009, 46, 1925–1934. [Google Scholar] [CrossRef] [PubMed]
- Granato, D.; Branco, G.F.; Cruz, A.G.; Faria, J.D.A.F.; Shah, N.P. Probiotic dairy products as functional foods. Compr. Rev. Food Sci. Food Saf. 2010, 9, 455–470. [Google Scholar] [CrossRef]
- Jung, T.D.; Shin, G.H.; Kim, J.M.; Oh, J.W.; Choi, S.I.; Lee, J.H.; Cho, M.L.L.; Lee, S.J.; Heo, I.Y.; Park, S.J.; et al. Changes in Lignan Content and Antioxidant Activity of Fermented Sesame (Sesame indicum L.) by Cultivars. J. Korean Soc. Food Sci. Nutr. 2016, 45, 143–148. [Google Scholar] [CrossRef]
- Holzhauser, T.; Wackermann, O.; Ballmer-Weber, B.K.; Bindslev-Jensen, C.; Scibilia, J.; Perono-Garoffo, L.; Utsumi, S.; Poulsen, K.; Vieths, S. Soybean (Glycine max) allergy in Europe: Gly m 5 (β-conglycinin) and Gly m 6 (glycinin) are potential diagnostic markers for severe allergic reactions to soy. J. Allergy Clin. Immunol. 2009, 123, 452–458. [Google Scholar] [CrossRef] [PubMed]
- El-Ghaish, S.; Ahmadova, A.; Hadji-Sfaxi, I.; El Mecherfi, K.E.; Bazukyan, I.; Choiset, Y.; Rabesona, H.; Sitohy, M.; Popov, G.; Kuliev, A.; et al. Potential use of lactic acid bacteria for reduction of allergenicity and for longer conservation of fermented foods. Trends Food Sci. Technol. 2011, 22, 509–516. [Google Scholar] [CrossRef]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef] [PubMed]
- Meinlschmidt, P.; Ueberham, E.; Lehmann, J.; Schweiggert-Weisz, U.; Eisner, P. Immunoreactivity, sensory and physicochemical properties of fermented soy protein isolate. Food Chem. 2016, 205, 229–238. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.S.; Pérez, V.G.; Pettigrew, J.E.; Martinez-Villaluenga, C.; de Mejia, E.G. Fermentation of soybean meal and its inclusion in diets for newly weaned pigs reduced diarrhea and measures of immunoreactivity in the plasma. Anim. Feed Sci. Technol. 2010, 159, 41–49. [Google Scholar] [CrossRef]
- Moreno, F.J.; Maldonado, B.M.; Wellner, N.; Mills, E.C. Thermostability and in vitro digestibility of a purified major allergen 2S albumin (Ses i 1) from white sesame seeds (Sesamum indicum L.). Biochim. Biophys. Acta 2005, 1752, 142–153. [Google Scholar] [CrossRef] [PubMed]
- Roehm, N.W.; Rodgers, G.H.; Hatfield, S.M.; Glasebrook, A.L. An improved colorimetric assay for cell proliferation and viability utilizing the tetrazolium salt XTT. J. Immunol. Methods 1991, 142, 257–265. [Google Scholar] [CrossRef]
- Spergel, J.M.; Boguniewicz, M.; Schneider, L.; Hanifin, J.M.; Paller, A.S.; Eichenfield, L.F. Food allergy in infants with atopic dermatitis: Limitations of food-specific IgE measurements. Am. Acad. Pediatr. 2015, 136, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Godiska, R.; Chantry, D.; Raport, C.J.; Sozzani, S.; Allavena, P.; Leviten, D.; Mantovani, A.; Gray, P.W. Human macrophage–derived chemokine (MDC), a novel chemoattractant for monocytes, monocyte-derived dendritic cells, and natural killer cells. J. Exp. Med. 1997, 185, 1595–1604. [Google Scholar] [CrossRef] [PubMed]
- Bito, T.; Roy, S.; Sen, C.K.; Packer, L. Pine bark extract pycnogenol downregulates IFN-γ-induced adhesion of T cells to human keratinocytes by inhibiting inducible ICAM-1 expression. Free Radic. Biol. Med. 2000, 28, 219–227. [Google Scholar] [CrossRef]
- Lee, T.H.; Do, M.H.; Oh, Y.L.; Cho, D.W.; Kim, S.H.; Kim, S.Y. Dietary fermented soybean suppresses UVB-induced skin inflammation in hairless mice via regulation of the MAPK signaling pathway. J. Agric. Food Chem. 2014, 62, 8962–8972. [Google Scholar] [CrossRef] [PubMed]
- Hurst, S.M.; Wilkinson, T.S.; McLoughlin, R.M.; Jones, S.; Horiuchi, S.; Yamamoto, N.; Rose-John, S.; Fuller, M.; Topley, N.; Jones, A. Il-6 and its soluble receptor orchestrate a temporal switch in the pattern of leukocyte recruitment seen during acute inflammation. Immunity 2001, 146, 705–714. [Google Scholar] [CrossRef]
- Enk, A.H.; Angeloni, V.L.; Udey, M.C.; Katz, S.I. An essential role for Langerhans cell-derived IL-1 beta in the initiation of primary immune responses in skin. J. Immunol. 1993, 150, 3698–3704. [Google Scholar] [PubMed]
- Nakayama, T.; Hieshima, K.; Nagakubo, D.; Sato, E.; Nakayama, M.; Kawa, K.; Yoshie, O. Selective induction of Th2-attracting chemokines CCL17 and CCL22 in human B cells by latent membrane protein 1 of Epstein-Barr virus. Br. J. Virol. 2004, 78, 1665–1674. [Google Scholar] [CrossRef]
- Kim, H.H.; Lee, Y.; Eun, H.C.; Chung, J.H. Eicosapentaenoic acid inhibits TNF-α-induced matrix metalloproteinase-9 expression in human keratinocytes, HaCaT cells. Biochem. Biophys. Res. Commun. 2008, 368, 343–349. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.H.; Jin, S.W.; Han, E.H.; Park, B.H.; Kim, H.G.; Khanal, T.; Hwang, Y.P.; Do, M.T.; Lee, H.S.; Chung, Y.C.; et al. Platycodon grandiflorum root-derived saponins attenuate atopic dermatitis-like skin lesions via suppression of NF-κB and STAT1 and activation of Nrf2/ARE-mediated heme oxygenase-1. Phytomedicine 2014, 21, 1053–1061. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.J.; Lee, J.H.; Jung, Y.S. (+)-Nootkatone inhibits tumor necrosis factor α/interferon γ-induced production of chemokines in HaCaT cells. Biochem. Biophys. Res. Commun. 2014, 447, 278–284. [Google Scholar] [CrossRef] [PubMed]






| Genes | Forward | Reverse | Length (bp) |
|---|---|---|---|
| IL-1β | AAAAGCTTGGTGATGTCTGG | TTTCAACACGCAGGACAGG | 176 |
| IL-6 | AGAGTAACTGAGGAACAAGCC | TACATTTGCCGAAGAGCCCT | 238 |
| MDC | AGGACAGAGCATGGCTCGCCTACAGA | TAATGGCAGGGAGGTAGCGCTCCTGA | 361 |
| TARC | CTTCTCTGCAGCACATCC | AAGACCTCTCAAGGCTTTG | 236 |
| ICAM-1 | CACCCTAGAGCCAAGGTGAC | CATTGGACTCTGCTGGGAAT | 251 |
| β-Actin | GCGGGAAATCGTGCGTGACATT | GATGGAGTTGAAGGTAGTTTCGTG | 231 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jung, T.-D.; Choi, S.-I.; Choi, S.-H.; Cho, B.-Y.; Sim, W.-S.; Han-Xionggao; Lee, S.J.; Park, S.J.; Kim, D.-B.; Kim, Y.-C.; et al. Changes in the Anti-Allergic Activities of Sesame by Bioconversion. Nutrients 2018, 10, 210. https://doi.org/10.3390/nu10020210
Jung T-D, Choi S-I, Choi S-H, Cho B-Y, Sim W-S, Han-Xionggao, Lee SJ, Park SJ, Kim D-B, Kim Y-C, et al. Changes in the Anti-Allergic Activities of Sesame by Bioconversion. Nutrients. 2018; 10(2):210. https://doi.org/10.3390/nu10020210
Chicago/Turabian StyleJung, Tae-Dong, Sun-Il Choi, Seung-Hyun Choi, Bong-Yeon Cho, Wan-Sup Sim, Han-Xionggao, Sang Jong Lee, Seon Ju Park, Dan-Bi Kim, Young-Cheul Kim, and et al. 2018. "Changes in the Anti-Allergic Activities of Sesame by Bioconversion" Nutrients 10, no. 2: 210. https://doi.org/10.3390/nu10020210
APA StyleJung, T.-D., Choi, S.-I., Choi, S.-H., Cho, B.-Y., Sim, W.-S., Han-Xionggao, Lee, S. J., Park, S. J., Kim, D.-B., Kim, Y.-C., Lee, J.-H., & Lee, O.-H. (2018). Changes in the Anti-Allergic Activities of Sesame by Bioconversion. Nutrients, 10(2), 210. https://doi.org/10.3390/nu10020210

