The Impact of Maternal Pre-Pregnancy Body Weight and Gestational Diabetes on Markers of Folate Metabolism in the Placenta
Abstract
:1. Introduction
2. Materials and Methods
2.1. Participants
2.2. Maternal Nutrient Intake
2.3. Collection and Analysis of Blood Samples
2.4. Collection of Placenta Samples
2.5. Laboratory Analysis
2.6. Statistical Analysis
3. Results
Maternal Folate Status and Adaptations within the Placenta
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Portela, A.; Esteller, M. Epigenetic modifications and human disease. Nat. Biotechnol. 2010, 28, 1057–1068. [Google Scholar] [CrossRef] [PubMed]
- Filiberto, A.C.; Maccani, M.A.; Koestler, D.C.; Wilhelm-Benartzi, C.; Avissar-Whiting, M.; Banister, C.E.; Gagne, L.A.; Marsit, C.J. Birthweight is associated with DNA promoter methylation of the glucocorticoid receptor in human placenta. Epigenetics 2011, 6, 566–572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.M.; Hong, K.; Lee, J.H.; Lee, S.; Chang, N. Effect of folate deficiency on placental DNA methylation in hyperhomocysteinemic rats. J. Nutr. Biochem. 2009, 20, 172–176. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.B.; He, J.L.; Liu, X.Q.; Chen, X.M.; Long, C.L.; Wang, Y.X. Expression of DNA methyltransferases in the mouse uterus during early pregnancy and susceptibility to dietary folate deficiency. Reproduction 2012, 144, 91–100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barres, R.; Zierath, J.R. DNA methylation in metabolic disorders. Am. J. Clin. Nutr. 2011, 93, 897S–900S. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; Hwang, J.Y.; Kim, K.N.; Ha, E.H.; Park, H.; Ha, M.; Lee, K.Y.; Hong, Y.C.; Tamura, T.; Chang, N. Relationship between body-mass index and serum folate concentrations in pregnant women. Eur. J. Clin. Nutr. 2012, 66, 136–138. [Google Scholar] [CrossRef] [PubMed]
- Serum and Red Blood Cell Folate Concentrations for Assessing Folate Status in Populations. Available online: http://apps.who.int/iris/bitstream/10665/75584/1/WHO_NMH_NHD_EPG_12.1_eng.pdf (accessed on 1 October 2016).
- Wald, N.J.; Morris, J.K.; Blakemore, C. Public health failure in the prevention of neural tube defects: Time to abandon the tolerable upper intake level of folate. Pub. Health Rev. 2018, 39, 2. [Google Scholar] [CrossRef] [PubMed]
- Guelinckx, I.; Devlieger, R.; Beckers, K.; Vansant, G. Maternal obesity: Pregnancy complications, gestational weight gain and nutrition. Obes. Rev. 2008, 9, 140–150. [Google Scholar] [CrossRef] [PubMed]
- Moran, L.J.; Sui, Z.; Cramp, C.S.; Dodd, J.M. A decrease in diet quality occurs during pregnancy in overweight and obese women which is maintained post-partum. Int. J. Obes. 2012, 37, 704–711. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rifas-Shiman, S.L.; Rich-Edwards, J.W.; Kleinman, K.P.; Oken, E.; Gillman, M.W. Dietary Quality during Pregnancy Varies by Maternal Characteristics in Project Viva: A US Cohort. J. Am. Diet. Assoc. 2009, 109, 1004–1011. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mojtabai, R. Body mass index and serum folate in childbearing age women. Eur. J. Epidemiol. 2004, 19, 1029–1036. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, V.R.; Hausman, D.B.; Kauwell, G.P.; Sokolow, A.; Tackett, R.L.; Rathbun, S.L.; Bailey, L.B. Obesity affects short-term folate pharmacokinetics in women of childbearing age. Int. J. Obes. 2013, 37, 1608–1610. [Google Scholar] [CrossRef] [PubMed]
- Ray, J.G.; Wyatt, P.R.; Vermeulen, M.J.; Meier, C.; Cole, D.E. Greater maternal weight and the ongoing risk of neural tube defects after folic acid flour fortification. Obstet. Gynecol. 2005, 105, 261–265. [Google Scholar] [CrossRef] [PubMed]
- Eichholzer, M.; Tonz, O.; Zimmermann, R. Folic acid: A public-health challenge. Lancet 2006, 367, 1352–1361. [Google Scholar] [CrossRef]
- Oyama, K.; Sugimura, Y.; Murase, T.; Uchida, A.; Hayasaka, S.; Oiso, Y.; Murata, Y. Folic acid prevents congenital malformations in the offspring of diabetic mice. Endocr. J. 2009, 56, 29–37. [Google Scholar] [CrossRef] [PubMed]
- Pickell, L.; Li, D.Q.; Brown, K.; Mikael, L.G.; Wang, X.L.; Wu, Q.; Luo, L.; Jerome-Majewska, L.; Rozen, R. Methylenetetrahydrofolate Reductase Deficiency and Low Dietary Folate Increase Embryonic Delay and Placental Abnormalities in Mice. Birth Defects Res. A Clin. Mol. Teratol. 2009, 85, 531–541. [Google Scholar] [CrossRef] [PubMed]
- Antony, A.C. In utero physiology: Role of folic acid in nutrient delivery and fetal development. Am. J. Clin. Nutr. 2007, 85, 598S–603S. [Google Scholar] [CrossRef] [PubMed]
- Solanky, N.; Jimenez, A.R.; D’Souza, S.W.; Sibley, C.P.; Glazier, J.D. Expression of folate transporters in human placenta and implications for homocysteine metabolism. Placenta 2010, 31, 134–143. [Google Scholar] [CrossRef] [PubMed]
- Castano, E.; Caviedes, L.; Hirsch, S.; Llanos, M.; Iniguez, G.; Ronco, A.M. Folate Transporters in Placentas from Preterm Newborns and Their Relation to Cord Blood Folate and Vitamin B12 Levels. PLoS ONE 2017, 12, e0170389. [Google Scholar] [CrossRef] [PubMed]
- Solanky, N.; Jimenez, A.R.; D’Souza, S.W.; Sibley, C.P.; Glazier, J.D. Folate Transporters in First Trimester and Term Human Placenta. Reprod. Sci. 2009, 16, 81a–82a. [Google Scholar]
- Carter, M.F.; Powell, T.L.; Li, C.; Myatt, L.; Dudley, D.; Nathanielsz, P.; Jansson, T. Fetal serum folate concentrations and placental folate transport in obese women. Am. J. Obstet. Gynecol. 2011. [Google Scholar] [CrossRef] [PubMed]
- Martino, J.; Sebert, S.; Segura, M.T.; Garcia-Valdes, L.; Florido, J.; Padilla, M.C.; Marcos, A.; Rueda, R.; McArdle, H.J.; Budge, H.; et al. Maternal body weight and gestational diabetes differentially influence placental and pregnancy outcomes. J. Clin. Endocrinol. Metab. 2016, 101, 59–68. [Google Scholar] [CrossRef] [PubMed]
- Torres-Espinola, F.J.; Berglund, S.K.; Garcia-Valdes, L.M.; Segura, M.T.; Jerez, A.; Campos, D.; Moreno-Torres, R.; Rueda, R.; Catena, A.; Perez-Garcia, M.; et al. Maternal obesity, overweight and gestational diabetes affect the offspring neurodevelopment at 6 and 18 months of age—A follow up from the PREOBE cohort. PLoS ONE 2015, 10, e0133010. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Valdes, L.; Campoy, C.; Hayes, H.; Florido, J.; Rusanova, I.; Miranda, M.T.; McArdle, H.J. The impact of maternal obesity on iron status, placental transferrin receptor expression and hepcidin expression in human pregnancy. Int. J. Obes. 2015, 39, 571–578. [Google Scholar] [CrossRef] [PubMed]
- Berglund, S.K.; Garcia-Valdes, L.; Torres-Espinola, F.J.; Segura, M.T.; Martinez-Zaldivar, C.; Aguilar, M.J.; Agil, A.; Lorente, J.A.; Florido, J.; Padilla, C.; et al. Maternal, fetal and perinatal alterations associated with obesity, overweight and gestational diabetes: An observational cohort study (PREOBE). BMC Public Health 2016, 16, 207. [Google Scholar] [CrossRef] [PubMed]
- Documento, C.d. Asistencia a la gestante con diabetes. Guía de práctica clínica actualizada en 2014 Grupo Español de Diabetes y Embarazo (GEDE). Av. Diabetol. 2015, 31, 45–59. [Google Scholar]
- Rasmussen, K.M.; Yaktine, A.L. Weight gain during pregnancy: Reexamining the guidelines; The National Academies Press: Washington, DC, USA, 2009. [Google Scholar]
- Casas-Agustench, P.; Lopez-Uriarte, P.; Bullo, M.; Ros, E.; Gomez-Flores, A.; Salas-Salvado, J. Acute effects of three high-fat meals with different fat saturations on energy expenditure, substrate oxidation and satiety. Clin. Nutr. 2009, 28, 39–45. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Caviedes, L.; Iñiguez, G.; Hidalgo, P.; Castro, J.J.; Castaño, E.; Llanos, M.; Hirsch, S.; Ronco, A.M. Relationship between folate transporters expression in human placentas at term and birth weights. Placenta 2016, 38, 24–28. [Google Scholar] [CrossRef] [PubMed]
- Astbury, S.; Mostyn, A.; Symonds, M.E.; Bell, R.C. Nutrient availability, the microbiome, and intestinal transport during pregnancy. Appl. Physiol. Nutr. Metab. 2015, 40, 1100–1106. [Google Scholar] [CrossRef] [PubMed]
- Astbury, S.; Song, A.; Zhou, M.; Nielsen, B.; Hoedl, A.; Willing, B.P.; Symonds, M.E.; Bell, R.C. High fructose intake during pregnancy in rats influences the maternal microbiome and gut development in the offspring. Front. Genet. 2018, 9, 203. [Google Scholar] [CrossRef] [PubMed]
- Khong, T.Y.; Hague, W.M. The placenta in maternal hyperhomocysteinaemia. Br. J. Obstet. Gynaecol. 1999, 106, 273–278. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bergen, N.E.; Timmermans, S.; Hofman, A.; Steegers-Theunissen, R.P.; Russcher, H.; Lindemans, J.; Jaddoe, V.W.; Steegers, E.A. First trimester homocysteine and folate levels are associated with increased adverse pregnancy outcomes. Reprod. Sci. 2011, 18, S22. [Google Scholar] [CrossRef]
- Friso, S.; Choi, S.W.; Girelli, D.; Mason, J.B.; Dolnikowski, G.G.; Bagley, P.J.; Olivieri, O.; Jacques, P.F.; Rosenberg, I.H.; Corrocher, R.; et al. A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects genomic DNA methylation through an interaction with folate status. Proc. Natl. Acad. Sci. USA 2002, 99, 5606–5611. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Di Simone, N.; Maggiano, N.; Caliandro, D.; Riccardi, P.; Evangelista, A.; Carducci, B.; Caruso, A. Homocysteine induces trophoblast cell death with apoptotic features. Biol. Reprod. 2003, 69, 1129–1134. [Google Scholar] [CrossRef] [PubMed]
- Ulrey, C.L.; Liu, L.; Andrews, L.G.; Tollefsbol, T.O. The impact of metabolism on DNA methylation. Hum. Mol. Genet. 2005, 14, R139–R147. [Google Scholar] [CrossRef] [PubMed]
- Mikael, L.G.; Pancer, J.; Jiang, X.; Wu, Q.; Caudill, M.; Rozen, R. Low dietary folate and methylenetetrahydrofolate reductase deficiency may lead to pregnancy complications through modulation of ApoAI and IFN-gamma in spleen and placenta, and through reduction of methylation potential. Mol. Nutr. Food Res. 2012. [Google Scholar] [CrossRef]
- Cooper, W.N.; Khulan, B.; Owens, S.; Elks, C.E.; Seidel, V.; Prentice, A.M.; Belteki, G.; Ong, K.K.; Affara, N.A.; Constancia, M.; et al. DNA methylation profiling at imprinted loci after periconceptional micronutrient supplementation in humans: Results of a pilot randomized controlled trial. FASEB J. 2012, 26, 1782–1790. [Google Scholar] [CrossRef] [PubMed]
- Rampersaud, G.C.; Kauwell, G.P.A.; Hutson, A.D.; Cerda, J.J.; Bailey, L.B. Genomic DNA methylation decreases in response to moderate folate depletion in elderly women. Am. J. Clin. Nutr. 2000, 72, 998–1003. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seki, Y.; Williams, L.; Vuguin, P.M.; Charron, M.J. Minireview: Epigenetic programming of diabetes and obesity: Animal models. Endocrinology 2012, 153, 1031–1038. [Google Scholar] [CrossRef] [PubMed]
- Radaelli, T.; Lepercq, J.; Varastehpour, A.; Basu, S.; Catalano, P.M.; Hauguel-De Mouzon, S. Differential regulation of genes for fetoplacental lipid pathways in pregnancy with gestational and type 1 diabetes mellitus. Am. J. Obstet. Gynecol. 2009. [Google Scholar] [CrossRef] [PubMed]
- Maccani, M.A.; Marsit, C.J. Epigenetics in the Placenta. Am. J. Reprod. Immunol. 2009, 62, 78–89. [Google Scholar] [CrossRef] [PubMed]
- Niculescu, M.D.; Zeisel, S.H. Diet, methyl donors and DNA methylation: Interactions between dietary folate, methionine and choline. J. Nutr. 2002, 132, 2333S–2335S. [Google Scholar] [CrossRef] [PubMed]
- Robertson, K.D.; Ait-Si-Ali, S.; Yokochi, T.; Wade, P.A.; Jones, P.L.; Wolffe, A.P. DNMT1 forms a complex with Rb, E2F1 and HDAC1 and represses transcription from E2F-responsive promoters. Nat. Genet. 2000, 25, 338–342. [Google Scholar] [CrossRef] [PubMed]
- Martino, J. Metabolic Alterations Induced by High Maternal BMI and Gestational Diabetes in Maternal, Placental and Neonatal Outcomes. Ph.D. Thesis, The University of Nottingham, Nottingham, UK, 2013. [Google Scholar]
- Symonds, M.E.; Bloor, I.; Ojha, S.; Budge, H. The placenta, maternal diet and adipose tissue development in the newborn. Ann. Nutr. Metab. 2017, 70, 232–235. [Google Scholar] [CrossRef] [PubMed]
N (n = 59) | OW (n = 29) | O (n = 22) | GDN (n = 14) | GDO (n = 11) | |
---|---|---|---|---|---|
Maternal characteristics | |||||
Age at delivery (years) | 30.4 ± 4.5 | 30.9 ± 7.2 | 29.0 ± 4.7 | 33.1 ± 4.1 * | 34.7 ± 4.3 ** |
Height (cm) | 162.9 ± 5.7 | 162.5 ± 6.4 | 162.7 ± 6.2 | 159.3 ± 3.9 | 160.5 ± 6.0 |
Pre pregnancy BMI (kg/m2) | 21.8 ± 1.8 | 27.8 ± 2.2 *** | 32.5 ± 2.6 *** | 22.4 ± 1.8 | 35.5 ± 4.9 *** |
BMI at 34 weeks (kg/m2) | 26.6 ± 2.6 | 31.3 ± 2.4 *** | 35.4 ± 2.4 *** | 25.9 ± 2.6 | 36.4 ± 4.1 *** |
GWG 0–34 weeks (kg) | 12.6 ± 4.3 | 9.9 ± 4.6 ** | 7.3 ± 5.1 *** | 9.0 ± 5.6 ** | 2.2 ± 7.8 *** |
Preterm (<37 gestational weeks) (n) | 2 (3%) | 1 (3%) | 2 (9%). | 1 (14%) | 4 (27%) * |
Male newborn (%) | 53 | 40 | 62 | 57 | 73 |
Number of caesarean section (%) | 12 | 26 | 38 | 25 | 50 |
Number on supplements + | 45 | 26 | 22 | 12 | 9 |
Infant characteristics | |||||
Newborn weight (g) | 3292 ± 410 | 3230 ± 587 | 3454 ± 549 | 3374 ± 402 | 3415 ± 549 |
Placental weight (g) | 469 ± 120 | 495 ± 135 | 531 ± 114 * | 498 ± 134 | 476 ± 93 |
Placental: birth weight ratio | 0.14 ± 0.03 | 0.16 ± 0.05 | 0.16 ± 0.04 | 0.15 ± 0.04 | 0.14 ± 0.02 |
Gestational age (weeks) | 39.2 ± 1.0 | 39.4 ± 1.6 | 39.3 ± 1.7 | 39.3 ± 1.3 | 38.8 ± 1.3 |
Target Gene | Forward Primer Sequence | Reverse Primer Sequence | Product Size (bp) | Temp (°C) |
---|---|---|---|---|
FOLR1 | CACTCCCTGCCTGTCTCC | TCTGCTCTGCTCTACACTCC | 80 | 59 |
PCFT (SLC46A1) | ATGCAGCTTTCTGCTTTGGT | GGAGCCACATAGAGCTGGAC | 100 | 60 |
RFC (SLC19A1) | CAGCATCTGGCTGTGCTATG | TGATGGTCTTGACGATGGTG | 161 | 59 |
MTHFR | TCCCGTCAGCTTCATGTTCT | TGTCGTGGATGTACTGGATGA | 116 | 59 |
DNMT1 | TTCTTCGCAGAGCAAATTGA | CGTCATCTGCCTCCTTCATGG | 210 | 57 |
DNMT3A | AAGCCTCAAGAGCAGTGGAA | AAGCAGACCTTTAGCCACGA | 190 | 59 |
Maternal Intake (μg DFE/day) | N (n = 37) | OW (n = 15) | O (n = 8) | GDN (n = 11) | GDO (n = 6) |
---|---|---|---|---|---|
Folate | 298 ± 12 | 258 ± 18 | 260 ± 46 | 342 ± 33 | 299 ± 53 |
Vitamin B12 | 5.8 ± 0.5 | 4.7 ± 0.5 | 5.3 ± 0.9 | 10.1 ± 4.1 | 5.3 ± 1.2 |
Pathway | NCBI Sequence | Target Gene | N (n = 59) | OW (n = 29) | O (n = 21) | GDN (n = 14) | GDO (n = 11) |
---|---|---|---|---|---|---|---|
Folate transport and metabolism | NM_016725.2 | FOLR1 | 1.0 ± 0.9 | 0.8 ± 0.6 | 0.5 ± 0.3 * | 0.6 ± 0.3 | 0.5 ± 0.3 * |
NM_080669.4 | PCFTψ | 1.0 ± 0.6 | 1.0 ± 0.5 | 1.1 ± 0.6 | 0.6 ± 0.7 | 0.8 ± 0.5 | |
NM_006996.2 | RFCψ | 1.0 ± 0.8 | 0.9 ± 0.5 | 1.0 ± 0.7 | 0.8 ± 0.5 | 0.7 ± 0.5 | |
NM_005957 | MTHFR | 1.0 ± 0.9 | 1.0 ± 0.9 | 0.8 ± 0.6 | 1.0 ± 0.7 | 1.5 ± 0.7 * | |
DNA methylation | NM_001130823 | DNMT1 | 1.0 ± 1.1 | 1.8 ± 1.1 ** | 1.5 ± 1.2 | 1.8 ± 1.5 | 0.5 ± 0.5 |
NM_022552.4 | DNMT3A | 1.0 ± 0.9 | 1.1 ± 1.2 | 0.7 ± 0.5 | 0.9 ± 0.9 | 0.6 ± 0.3 |
Linear Regression Model | B (95% CI) | SE B | β | p |
---|---|---|---|---|
Model 1 ψ | ||||
Maternal pre-BMI | −0.029 (−0.051, −0.007) | 0.011 | −0.214 | 0.009 |
Model 2 ψψ | ||||
Maternal pre-BMI | −0.032 (−0.054, −0.009) | 0.011 | −0.230 | 0.006 |
Maternal glucose (34 gw) | 0.004 (−0.002, 0.01) | 0.003 | 0.107 | 0.194 |
Model 3 ψψψ | ||||
Maternal pre-BMI | −0.033 (−0.056, −0.011) | 0.012 | −0.241 | 0.004 |
Maternal glucose (34 gw) | 0.005 (−0.001, 0.01) | 0.003 | 0.131 | 0.116 |
Maternal folate (34 gw) | −0.019 (−0.043, 0.005) | 0.012 | 0.128 | 0.124 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martino, J.; Segura, M.T.; García-Valdés, L.; Padilla, M.C.; Rueda, R.; McArdle, H.J.; Budge, H.; Symonds, M.E.; Campoy, C. The Impact of Maternal Pre-Pregnancy Body Weight and Gestational Diabetes on Markers of Folate Metabolism in the Placenta. Nutrients 2018, 10, 1750. https://doi.org/10.3390/nu10111750
Martino J, Segura MT, García-Valdés L, Padilla MC, Rueda R, McArdle HJ, Budge H, Symonds ME, Campoy C. The Impact of Maternal Pre-Pregnancy Body Weight and Gestational Diabetes on Markers of Folate Metabolism in the Placenta. Nutrients. 2018; 10(11):1750. https://doi.org/10.3390/nu10111750
Chicago/Turabian StyleMartino, Jole, Maria Teresa Segura, Luz García-Valdés, M C. Padilla, Ricardo Rueda, Harry J. McArdle, Helen Budge, Michael E. Symonds, and Cristina Campoy. 2018. "The Impact of Maternal Pre-Pregnancy Body Weight and Gestational Diabetes on Markers of Folate Metabolism in the Placenta" Nutrients 10, no. 11: 1750. https://doi.org/10.3390/nu10111750