Next Article in Journal
Exploring New Applications of Municipal Solid Waste
Previous Article in Journal
The Impact of Anthropopressure on the Health Condition of Ancient Roadside Trees for a Sustainable City: Example of the Silver Maples (Acer saccharinum L.) Alley in Łódź (Central Poland)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Sustainability
Volume 17
Issue 8
10.3390/su17083721
sustainability-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Environmental Factors Influence Lichen Colonization and the Biodeterioration of Brick Carvings on Roof Ridges of Historic Buildings in Luoyang, China

by
Zijing Li
1,
Ping Ye
1 and
Yinju Li
2,*
1
School of Civil Engineering and Architecture, Henan University of Science and Technology, Luoyang 471003, China
2
Luoyang Key Laboratory of Living Carrier Materials, Henan University of Science and Technology, Luoyang 471003, China
*
Author to whom correspondence should be addressed.
Sustainability 2025, 17(8), 3721; https://doi.org/10.3390/su17083721
Submission received: 6 March 2025 / Revised: 15 April 2025 / Accepted: 18 April 2025 / Published: 20 April 2025
Browse Figures
Review Reports Versions Notes

Abstract

:
Lichens that inhabit the roofs of historic buildings create a unique ecosystem. Comprehending the mechanisms underlying lichen colonization and the associated biodegradation within these structures is essential for formulating effective conservation strategies for historic buildings. Here, the microbial communities of lichens on the roofs of 10 historic buildings in Luoyang and nine surrounding counties were investigated via visual assessments and molecular biological analyses. The diversity of lichen species and their biological degradation effects on brick carvings on roof ridges were examined. The findings indicate that both the matrix characteristics of brick carvings and the climatic conditions in Luoyang facilitate the aggregation of lichen communities within these architectural features. Molecular biological tests revealed that Cyanobacteria, Bacillus, Chlorococcus, and Micromonosporaceae were among the most frequently detected bacterial taxa associated with lichens. The fungal associates included Cladosporium and Aspergillus. The infiltration patterns exhibited by certain lichen mycelia correlated with the structural properties at the interface between lichens and brick carvings, allowing mycelial penetration into the interior of these bricks. Additionally, guano not only serves as an organic nutrient source for microbial proliferation but also is a transmission medium for lichen-associated microorganisms residing on roof brick carvings. Whilst there are slight variations in microbial composition among lichens found in mountains and hilly areas around Luoyang, their colonization behaviors and degradation patterns are similar to those observed in analogous communities across different microclimate zones. The results offer a robust theoretical foundation for mitigating lichen-induced bioerosion in the historical buildings of Luoyang and serve as a valuable reference for the sustainable preservation of cultural heritage.

1. Introduction

Architecture is an art form, and the visual appeal of buildings plays a significant role in enhancing mental health, providing strength, and fostering joy [1]. Historical Chinese architecture exemplifies a distinctive blend of natural aesthetics and ornamental beauty. However, historical buildings are subject to atmospheric conditions that can be influenced by varying levels of humidity, temperature, light exposure, and chemical pollution [2], potentially leading to the deterioration of their structural integrity. The degradation of these historic structures diminishes the strength of construction materials, thereby impacting both their structural soundness and aesthetic value [3]. The deterioration of historic building structures is the result of complex interactions among physicochemical processes and biological factors. Microbial-induced damage to these edifices is commonly referred to as biodegradation. This process primarily occurs due to the formation of lichens and other biofilms on building surfaces by bacteria, fungi and algae. These microorganisms exert erosive effects on buildings while accelerating material degradation through mechanisms such as cracking in construction materials and decomposition caused by bacterial secretions, along with the drying out and curling associated with lichen growth [4,5]. The presence and activity of microbes on heritage materials result in chemical alterations alongside aesthetic and physical damage [6]. Notably, filamentous fungi and actinomycetes can cause biophysical damage to the structural matrix by expanding their mycelial networks [7].
The succession of communities of living organisms on historical buildings typically commences with the establishment of lichen flora [8]. Lichens represent a stable symbiotic system formed through the interaction between fungi and algae (either cyanobacteria or green algae) over a long biological evolution [9]. This unique association creates a specific microhabitat that supports diverse bacterial communities, including actinomyces [10]. Fungi within lichen symbionts are primarily responsible for the distinctive biological characteristics exhibited by lichens. The fungal component is mainly represented by ascomycetes, along with basidiomycetes. The photosynthetic partners are either cyanobacteria or green algae. The upper surface of the thallus is covered by a cortical layer composed of organized hyphae, whereas the medulla, which is beneath the algal zone, consists of interwoven hyphae [11].
Lichens thrive in environments that are often inhospitable to many other life forms due to their remarkable resistance to desiccation and extreme temperatures, along with their ability to absorb nutrients from the surrounding environment [12,13]. The colonization of historical building materials by lichens is facilitated by wind, insects, and birds that disperse spores into the atmosphere. When these spores settle in pores or cavities that contain moisture, new organisms can grow [11]. Additionally, bird excrements provide organic nitrogen essential for the development of an ornithocoprophilous flora, which can lead to the biodeterioration of materials over time [12]. Certain lichen species found on historical buildings are characteristic of humid climates and nutrient-rich habitats associated with animal waste [12]. The damage inflicted by lichens can be both mechanical and chemical. Mechanical damage primarily arises from the penetration of hyphae into substrates, resulting in a loss of cohesion due to the contraction and expansion of thalli during fluctuations in water availability. In contrast, chemical damage involves the production of organic carboxylic acids, such as citric acid, oxalic acid, lactic acid, and gluconic acid, facilitating chemical processes through which lichens decompose constituents of building materials [11,13].
Porosity plays a crucial role in determining the durability of building materials as it influences the ingress of harmful substances. Fired clay ceramics, such as bricks and roof tiles, have traditionally been used as construction materials. Although various types of clay can be used in their production, their chemical composition remains relatively consistent as they primarily consist of vitrified aluminum and silicon oxides. Whilst fired clay is resistant to chemical attacks, its porous nature renders it susceptible to weathering caused by frost and salts as well as colonization by microorganisms [5]. Microorganisms may proliferate on surfaces and within crevices and fissures or may penetrate several millimeters or even centimeters into the material’s pore system. In particular, biofilms can alter the appearance of architectural structures. The ‘greening’ of surfaces may result from photosynthetic cyanobacteria or algae growth, whereas ‘blackening’ can occur due to fungal proliferation on various building materials. Most likely, lichens are the most conspicuous indicators of microbial colonization on human-made structures [5].
Microbial colonization is influenced by various environmental factors and the physicochemical characteristics of the construction materials [14]. Environmental factors, such as light intensity, temperature, and relative humidity, contribute to both physical and biophysical damage [15]. The physicochemical properties of construction materials, such as compressive strength, water content, porosity, and surface roughness [16], are interrelated and significantly affect a surface’s susceptibility to microbial colonization. Building materials with rough surfaces and high porosity create favorable habitats for microorganisms by retaining moisture and accumulating organic compounds on their surfaces. Bryophytes growing on rock surfaces can retain water, and the prolonged exposure of rocks to water enhances the chemical weathering processes affecting their surfaces [11]. Under dry conditions, lichens tend to lose moisture and curl up, which can dislodge particles from the building’s surface, thereby exacerbating damage to the material.
Historical buildings are the maximum expression of human heritage. As they are subject to deterioration, their conservation has become a matter of concern for the scientific community, ensuring the identity and cultural continuity for humanity [17]. In this context, understanding the physiological and morphological characteristics of deteriogenic lichens is necessary to establish the type of interaction that occurs with the material and to evaluate the cause–effect of the deteriorating action of a specific biological agent [18]. However, respective studies mainly focused on the biodegradation effects of lichens on historical stone relics [8,19,20,21], whereas studies addressing lichen biodegradation in brick historical buildings, particularly concerning brick carvings on roof ridges, are scarce. This gap impedes the development of targeted conservation strategies for such culturally significant structures.
Luoyang in central China is a city of significant historical importance and has served as the capital of 13 ancient dynasties. Its extensive history has endowed Luoyang with a rich array of historical treasures, including the Longmen Grottoes and notable Buddhist structures, such as the White Horse Temple. The Longmen Grottoes, recognized as UNESCO World Cultural Heritage Sites, along with 76 officially protected traditional Chinese villages dispersed throughout Luoyang, exemplify its profound cultural heritage. However, the historic buildings in this region are undergoing severe biodeterioration, exacerbated by the temperate monsoon climate and the porous nature of traditional brick materials. Prior research has demonstrated that microbial communities responsible for biodeterioration are influenced by environmental factors (e.g., humidity and light) as well as substrate properties (e.g., porosity and surface roughness) [8,15,16]. Limitations of existing studies include a focus on stone substrates, thereby neglecting the unique physicochemical interactions between lichen and brick substrates. Furthermore, the impact of microclimate variations within a single geographic region, such as Luoyang’s distinctive mountainous, hilly, and basin terrain, on regulating lichen community composition remains underexplored. It is, therefore, crucial to identify the organisms contributing to biological deterioration and to develop targeted prevention and control measures based on their biological characteristics and modes of erosion. Such an approach will ensure the effective preservation of these invaluable architectural treasures.
In this study, lichen samples collected from brick carvings within historic buildings in the Luoyang area were identified via molecular methods. Additionally, we compared microbial community compositions among lichen samples from brick carvings on roof ridges across different counties in Luoyang. The aim was to identify dominant bacterial and fungal taxa within lichen communities and their spatial distribution patterns and to elucidate the formation and development processes of lichens on brick carvings on the roof ridges of historic buildings throughout Luoyang. Furthermore, we discuss how environmental factors influence lichen composition while providing a foundation for future protection and restoration efforts.

2. Materials and Methods

2.1. The Research Area and Its Natural Environment

The research area encompasses the entirety of Luoyang City, situated in the western part of Henan Province, China. This district includes not only Luoyang City but also Yanshi County, Mengjin County, Yichuan County, Xin’an County, Yiyang County, Luoning County, Ruyang County, Song County, and Luanchuan County. Geographically, Luoyang extends from 112°16′ to 112°37′ east longitude and from 34°32′ to 34°45′ north latitude. The climate is a temperate monsoon climate. The city experiences a temperate monsoon climate. Covering a total area of 15,200 square kilometers, of which the urban area comprises approximately 803 square kilometers, the city extends approximately 179 km from east to west and 168 km from north to south. It straddles both the middle and lower reaches of the Yellow River. Notable rivers flowing through the city include the Luo River, Jian River, and Yi River. The terrain is predominantly mountainous (45.51%), followed by hilly regions (40.73%) and plains (13.8%) (Figure 1).
Situated at the intersection of the Qinling Orogenic Belt and the North China Craton, the Luoyang region is characterized by three principal structural units: an uplifted Proterozoic metamorphic basement in the southern mountainous areas, Mesozoic–Cenozoic fault basins in the central plains, and folded Paleozoic strata in the northwestern hilly regions. Major fault systems, such as the Luonan Fault and the Luoyang Basin Boundary Fault, control topographic zonation and significantly influence climatic zone distribution. The geological evolution of Luoyang has shaped its topography, resulting in three distinct climatic zones. The first region is the mountainous climate zone (elevation > 325 m), which includes the counties of Luoning, Ruyang, Songxian, and Luanchuan. This humid area corresponds to Precambrian highlands. The second region is the basin climate zone (elevation < 200 m), a sub-humid zone that encompasses urban Luoyang and Yichuan County, situated on Quaternary alluvium. Between these two regions lies the hilly climate zone (elevation 200–325 m), transitional semi-arid areas, including Yanshi, Mengjin, Xin’an, and Yiyang counties, which coincide with Paleozoic folded strata [22]. Temperature gradients reflect elevational contrasts, with annual means ranging from 12 °C in mountainous areas to 16 °C in the basin. January lows can reach −3 °C in metamorphic highlands, while July highs can reach 29 °C in sedimentary basins. The average annual minimum temperature is around 0 °C, with a maximum of 26.5 °C. Annual precipitation averages at approximately 578.3 mm. Notably higher levels are observed in mountainous areas, with an average of 903.4 mm, compared to only 532.3 mm in Yanshi County, 50% of which occurs during the summer months. Luoyang receives an average of 2141.6 h of sunshine annually [22].

2.2. Visual Evaluation and Sample Collection

In March and December 2023, we conducted three visual assessments of Qing Dynasty target buildings located in downtown Luoyang and nine surrounding counties. The external evaluations encompassed the conditions surrounding each building as well as any visible signs of moisture. For the brick carvings on roof ridges, our visual assessment included an examination of the ridge structure, plaster condition, and the state of the brick carvings on the roof ridges themselves. Additionally, a macro-inspection was performed to assess the extent of lichen contamination.
Samples comprising biofilm, guano, and building materials were collected from the brick carvings on the roof ridges of historic buildings across each district. The biofilm was meticulously harvested from the surfaces of sculptures using a sterile blade, and small fragments of building materials exhibiting signs of biological colonization were extracted with a sterile chisel. Samples were taken from three distinct locations on each building and subsequently combined into a single sample for analysis. The collected lichen samples were placed into clean sealing bags, with their respective quantities and collection sites documented (Table 1). All biological samples were then stored at −80 °C. Lichen-covered brick carving material was systematically sliced into 0.5-cm sections from its surface before being stored at −20 °C.

2.3. DNA Extraction and Polymerase Chain Reaction (PCR)

The improved cetyl trimethyl ammonium bromide (CTAB) method was employed for the extraction of bacterial and fungal DNA. Approximately 0.5 g of dry lichen or bird dung samples was taken from the ultra-low temperature water tank, and 10 mL of liquid nitrogen was added to rapidly grind them into a powder. Building materials were also crushed into a fine powder. The powdered building material samples were soaked in 1.0 mL of sterile water for 30 min, followed by centrifugation at 3000× g for 5 min. The supernatant was then subjected to further centrifugation at 12,000× g for an additional 5 min to collect the precipitate. Subsequently, 1.0 mL of 2 × CTAB (Real-time (Beijing) Biotechnology Co., LTD., Beijing, China) was added to the lichen, guano powder, and sediment from the building materials. This mixture was preheated at 65 °C for 20 min and transferred to a 1.5 mL centrifuge tube before being incubated in a water bath at this temperature for 30 min. Subsequently, it was centrifuged at 12,000× g at 25 °C for 10 min, and the resulting supernatant was carefully transferred into a new 1.5 mL centrifuge tube. We then added 5 μL of RNase A solution (10 mg/mL) and allowed fermentation to occur at 37 °C for 20 min. An equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) was then introduced; after gentle mixing, it underwent centrifugation at room temperature at 12,000× g for 10 min, with subsequent transfer of the supernatant into another new tube containing an equal volume of chloroform: isoamyl alcohol (24:1). After thorough mixing and another round of centrifugation under the conditions described above, we transferred the supernatant into a new 1.5 mL centrifuge tube, added 0.6 times the volume of cold isopropyl alcohol, gently mixed it, and left it for 30 min at −20 °C. After centrifugation at 14,000× g at 4 °C for 10 min, we discarded the supernatant, added 1 mL of 70% ethanol for rinsing and precipitation, centrifugated the mixture at 14,000× g at 4 °C for 3 min, added 50 μL of TE buffer to the precipitation to dissolve DNA, and stored it at −20 °C.
Bacterial, fungal, and cyanobacterial biodiversity in the samples was measured by polymerase chain reaction (PCR). To this end, the V3–V4 region of bacterial and cyanobacterial 16S rRNA genes and fungal 18S rRNA gene ITS regions were amplified. Fungal 18S rRNA and bacterial 16S rRNA genes were selected to study the composition and distribution of microbial communities. Fungal 18S rRNA gene ITS regions have high variability and polymorphism among different fungal species, which makes them an important tool for fungal classification and identification. The highly variable region of the 16S rRNA gene V3–V4 region is an important region for the analysis of microbial community composition and diversity [23,24]. The primers were designed based on the consensus sequences of the bacterial 16S rRNA gene, the cyanobacterial 16S rRNA gene, and the fungal 18S rRNA gene. Table 2 shows the primer sets used.
The PCR reactions were conducted using the TaKaRa PCR Amplification Kit (TakaRa Bio Inc., Otsu, Japan) following the manufacturer’s instructions. The PCR reactions were carried out in 25-µL reaction mixtures containing 40 pmol of each primer, 20 ng of template DNA, 10 × PCR Buffer 2.5 µL, and TaKaRa Taq 1 µL (5 U/μL), brought to a volume of 25 µL with ultra-pure water.
The reaction conditions for bacterial DNA amplification are as follows: predenaturation at 95 °C for 5 min, denaturation at 95 °C for 45 s, annealing at 58 °C for 45 s, extension at 72 °C for 100 s, a total of 33 cycles, and extension at 72 °C for 10 min. The fungal and cyanobacterial DNA amplification reaction conditions were similar to those for bacterial DNA, except that the annealing temperatures for fungi and cyanobacteria were 55 °C and 56 °C, respectively.

2.4. Nucleotide Sequence Analysis

The PCR products were purified from 1% agarose gel. The purified samples were then submitted to TakaRa Biotechnology (Dalian) Co., Ltd. (Dalian, China) for nucleotide sequencing. The sequencing data obtained were processed and corrected using the BioEdit V7.0.9.0 software, and a local database was established. Sequences with more than 97% similarity were classified as the same species and grouped into operational taxonomic units (OTUs). We searched the sequences in the GenBank database of NCBI and selected lichenous fungi, bacteria, and the reference sequences with high homology. The detection frequencies for bacteria and fungi in each sample were calculated. Through cluster analysis, the distribution patterns of microbial colonies in lichens across different microclimate zones in Luoyang were examined.

3. Results

3.1. Visual Assessment of Lichen-Induced Biodegradation

The visual assessment reveals that lichen-induced biodegradation is notably evident on the brick carvings of historic buildings in Luoyang, with its spatial distribution strongly correlated to microclimate zones (Figure 2). In humid mountainous regions (e.g., Luoning, Ruyang, Song, and Luanchuan counties), extensive lichen coverage (approximately 70% of surface area) is associated with significant material erosion, including cracking and particle disintegration (Figure 2 (LN, RY, SC, LC)). Conversely, semi-arid hilly areas (e.g., Yanshi, Mengjin, Xin’an, and Yiyang counties) exhibit limited colonization (<30% coverage), primarily confined to carved grooves and cracks (Figure 2 (YS, MJ, XA, YY)). This disparity underscores the vulnerability of humid zones to accelerated biodeterioration under current climate trajectories, where rising temperatures and erratic precipitation patterns may intensify microbial activity in these regions. Surface roughness and porosity are critical factors influencing microbial adhesion; complex carvings with high porosity retain moisture and organic particles, thereby promoting biofilm proliferation (Figure 2 (YC, XA, LN, RY, SC, LC)), while smooth surfaces (Figure 2 (YS, MJ, YY)) show minimal colonization. Notably, the shaded north side of the roof ridge supports a denser lichen community compared to the southern surface exposed to sunlight, underscoring light as a regulatory factor. Seasonal variations exerted minimal influence on degradation severity, suggesting that long-term microclimatic stability—rather than transient weather changes—drives long-term biological degradation, thereby compromising the aesthetic integrity of heritage structures.

3.2. Agarose Gel Electrophoresis Analysis of PCR Products from Lichen Samples

The PCR products obtained from lichen samples were subjected to analysis and purification via 1% agarose gel electrophoresis (Figure 3). Distinct bands corresponding to 378 bp, 512 bp, and 445 bp were detected in the bacterial, fungal, and cyanobacterial PCR products, respectively. These results were consistent with the pre-designed target sequence lengths. The electrophoretic bands were excised and collected for subsequent sequencing analysis.

3.3. Analysis of Microbial Diversity in Lichen Samples

Overall, 17 bacterial species and 10 fungal genera were identified within the lichen populations (Table 3).
Cyanobacteria, Bacillus, Chroococcus, Micromonosporaceae, and Actinobacteria exhibited the strongest symbiotic relationships within these lichen communities. Among these organisms, dominant strains included Cyanobacteria, Bacillus licheniformis, Chroococcidiopsis lichenoides, Bacillus cereus, Micromonospora, Actinobacteria, Actinomycetospora flava, Scytonema crispum, and Nostoc edaphicum (Figure 4a). In terms of fungi, Aspergillus, Cladosporium, and Mucor emerged as the predominant genera. The most common fungal strains were Aspergillus costaricensis, Aspergillus sydowii, Chaetophorales spp., Aspergillus terreus, Cladosporium halotolerans, Metarhizium marquandii, and Penicillium atramentosum (Figure 4b). Fungal communities within the lichen samples displayed significant intraspecific variability when compared to their bacterial counterparts, suggesting that additional factors influence their composition. Bacillus licheniformis, Bacillus cereus, and Aspergillus costaricensis were detected in guano collected from a rooftop. Furthermore, Actinomyces spp., Bacillus licheniformis, Aspergillus terreus, and Metarhizium martensii were found at depths ranging from 0.5 to 1.0 cm below the surface of brick carvings covered with lichens. Lichen samples obtained from mountain rocks and river flats demonstrated greater microbial diversity.

3.4. Microbial Communities of Lichens

Most of the lichen microbial species collected from brick carvings in Luoyang and its surrounding counties were also found in adjacent mountains and along rivers. Variations in lichen flora can be attributed to differences in local topography and microclimatic conditions. Nine bacterial species were identified in both basin and hilly climate zones, whereas 11 species were identified within mountainous climate zones. Cyanobacteria, Micromonosporaceae, and Chroococcidiopsis lichenoides were present across all three climate zones. Bacillus cereus and Actinomycetospora flava were detected in both basin and hilly climates. Bacillus licheniformis was observed in basin and mountain climates, whereas Scytonema crispum was found exclusively in hilly and mountainous climates (Figure 5a). Bacillus wiedmannii and Scytonema stuposum were only found in the basin climate region, whereas Bacillus rhizoplanae and Chroococcidiopsis occurred specifically in hilly climates. Microcoleus chthonoplastes, Microcoleus paludosus, Nostocaceae, Nostoc edaphicum, and Chroococcidiopsis muralis were recorded in the mountainous climate zones.
The distribution of fungi was more uniform throughout the Luoyang climatic zone. Aspergillus terreus, Aspergillus costaricensis, and Aspergillus sydowii appeared across all three climatic zones. Metarhizium marquandii was found in both basin and hilly climate regions, whereas Cladosporium halotolerans and Penicillium atramentosum were found in the basin as well as the mountain climates. Cladosporium sp., along with Chaetophorales, was noted only in hilly or mountainous climates (Figure 5b). Septoriella hibernica was restricted to the climatic region of the basin, whereas Aspergillus versicolor was only found in hilly climates.
The microbial diversity of lichen communities inhabiting mountain rocks and riverbeds was generally high. However, samples collected from urban areas as well as Yanshi County exhibited a simpler microbial structure (Table 3).

4. Discussion

The interplay between environmental factors, material properties, and microbial dynamics is fundamental to the biodeterioration of brick carvings on historic buildings in Luoyang. Our findings, supported by visual assessments and molecular biological analyses (Figure 2, Figure 3 and Figure 4; Table 3), underscore the critical role of microclimatic conditions and substrate characteristics in influencing lichen colonization patterns and their subsequent effects on cultural heritage. These insights are consistent with the principles of sustainable conservation, highlighting the necessity for tailored strategies to mitigate biodegradation while preserving the historical buildings’ integrity.

4.1. Impacts of Microclimatic Conditions and Environmental Factors on Lichen Microbial Communities

The microbial composition of lichen communities exhibited distinct spatial variations across Luoyang’s climatic zones (Figure 4a,b). Mountainous regions, characterized by higher humidity and precipitation, fostered greater microbial diversity (e.g., Cyanobacteria, Micromonosporaceae, Scytonema crispu, and Penicillium albino, Chaetomium), correlating with pronounced biodeterioration (Table 3). In contrast, semi-arid hilly areas harbored simpler communities dominated by drought-tolerant genera, such as Bacillus cereus and Aspergillus terreus. These patterns align with global studies linking microbial diversity to humidity gradients [25,26]. Notably, the ubiquity of Cyanobacteria, Micromonosporaceae, and Chroococcidiopsis lichenoides across all zones underscores their adaptability to fluctuating moisture regimes, a trait critical for survival in temperate monsoon climates [22,27]. Fungi exhibit remarkable adaptability; they can survive at temperatures significantly lower or higher than normal [28] and proliferate rapidly in environments where relative humidity exceeds 40% [29]. Aspergillus terreus, Aspergillus zeae, and Aspergillus sidoensis were detected across three distinct microclimate zones in Luoyang. Most lichen-associated microbial species collected can be found in the adjacent mountains and rivers. Furthermore, the diversity of lichen communities within urban settings tends to be low due to substantial filtering effects imposed by human activities [30]. The microbial communities associated with lichens on the roof brick carvings in Luoyang urban were predominantly composed of Actinomycetes and fungi, whereas bacteria and cyanobacteria appeared to exhibit a greater sensitivity to urban environmental conditions.

4.2. Effects of Physical Properties and Morphology of Brick Carvings on Colonization by Lichen Microorganisms

The porosity and surface roughness of brick carvings emerged as key determinants of microbial adhesion (Figure 2 and Figure 3). The density of locally sourced Qing Dynasty blue bricks in Henan ranges from 1.489 to 1.698 g/cm3, with an average density of 1.573 g/cm3. Over more than a century of exposure to natural environmental forces, weathering has resulted in increased surface roughness and porosity within the brick matrix [31]. These rough, porous surfaces retain moisture and organic particulates, thereby creating microhabitats that are conducive to biofilm formation [32,33,34]. The intricate surface morphology of brick carvings, characterized by uneven textures, expands the binding area available for microorganisms, thus facilitating their adhesion. For instance, lichen hyphae preferentially colonize cracks and grooves of brick carvings (Figure 2), where trapped water and nutrients promote microbial proliferation. These observations align with previous studies on bioreceptivity, which identify material texture as a critical factor in microbial settlement [8,35]. Furthermore, the high Ca2+ content in the ash joint of the brick layer likely accelerates biofilm expansion by serving as a nutrient reservoir [36], underscoring the need for material-specific conservation protocols.

4.3. Microecology of Roof Lichens and Biodegradation of Brick Carvings

Roof brick carvings are usually located on the ridge, which is the highest point of the building. It is not only eroded by direct sunlight, wind, and rain but also a habitat for birds and a specific microecological environment that is vulnerable to biodegradation.
Lichen infection is mainly airborne, and numerous spores can accumulate in dust layers, the amount of which is affected by seasonal changes [37]. The growth and metabolic activity of lichens are regulated by parameters such as light and humidity [26]. In the brick carvings of historical buildings in Luoyang, we detected a variety of microorganisms. Microorganisms require basic elements of building materials, such as carbon, oxygen, hydrogen, nitrogen, phosphorus, and sulfur [38]. Guano, often observed on the surface of historic buildings, may also have a positive effect on lichen colonization [39]. We detected bacteria and fungi in bird guano (e.g., Bacillus licheniformis; Aspergillus costaricensis; Table 3), indicating that birds not only provide organic nutrients, such as nitrogen and phosphorus, for lichen colonization but also are carriers of lichen microorganisms.
Molds can thrive deep inside building materials, where they cause degradation through chemical and mechanical attacks, making them a significant contributor to biodegradation [2]. The biophysical degradation of brick carvings by lichens is mainly due to the infiltration of fungal attachment structures into the pores and cracks on the surface of brick carvings. We detected actinomyces, bacilli, and molds at 0.5–1.0 cm below the surface of lichen-colonized brick carvings. Colonized voids and cracks may subsequently expand due to increased bacterial populations [40]. These bacteria and fungi can corrode building materials by releasing organic acids to change the pH value [41]. The biofilm of lichen expands and curls under wet and dry conditions. As the surface fragments of brick carvings are often attached to these biofilms, they can fall off. The increase in the water retention capacity of lichens will intensify the freeze–thaw cycle of bricks, leading to the deterioration of mechanical properties and brick durability [42]. When the environment becomes dry, soluble salts and mineral crystals from the water can create expansion stress inside the brick carving, causing the structure to crack, flake, scale, or fall off [31,43]. Such synergistic effects underscore the complexity of biodeterioration processes, necessitating holistic mitigation approaches that address both biological and environmental factors.

4.4. Implications for Sustainable Heritage Conservation

Our study underscores the urgency of integrating ecological insights into preservation strategies. For instance, reducing surface roughness through non-abrasive treatments could limit microbial adhesion in vulnerable areas [33], while regulating humidity via improved drainage systems may curb biofilm development in humid zones [44]. Environmentally friendly fungicides to kill lichen could be explored, ensuring that the fungicide is metabolized by the bacteria through diffusion [45]. Additionally, periodic removal of guano and organic debris could disrupt nutrient cycles, slowing lichen proliferation [39]. These measures, coupled with region-specific monitoring of microbial communities, align with the sustainability goals of minimizing chemical interventions and promoting long-term structural resilience [46,47].

5. Conclusions

This study elucidates the intricate relationship between environmental factors, material properties, and microbial colonization that has driven the biodegradation of brick carvings in historic buildings in Luoyang. Through comprehensive visual assessment and molecular biological analysis, we identified Cyanobacteria, Bacillus, Chlorococcus, Micromonosporaceae, and Actinomyces as well as Aspergillus, Cladosporium, and Mucor as the predominant groups in lichens, with their distribution influenced by local microclimatic conditions. The key findings of this study and their implications for sustainable heritage conservation are summarized as follows:
Microclimates determine microbial diversity: Moist mountainous areas exhibit greater microbial diversity and accelerated biodegradation, whereas semi-arid regions host simpler, drought-tolerant microbial communities. Temperature and humidity gradients are directly correlated with lichen proliferation, underscoring the necessity for climate-adaptive conservation strategies.
Material properties influence bioacceptability: High porosity and surface roughness in brick carvings facilitate microbial adhesion and biofilm formation. Targeted interventions aimed at reducing surface roughness and sealing microcracks can mitigate lichen colonization without compromising historical aesthetics.
Synergistic degradation mechanisms: Lichen-induced damage results from both mechanical stress (mycelium penetration) and chemical weathering. Guano serves as a nutrient reservoir, promoting microbial growth, which highlights the importance of prioritizing the removal of organic debris in maintenance programs.
In alignment with the principles of sustainable development, we recommend installing humidity control systems in humid areas to disrupt biofilm development; developing bioresistant bricks with reduced porosity and modified surface texture for restoration projects; and implementing regular guano removal and non-invasive cleaning methods to disrupt nutrient cycles and limit lichen spread. These strategies can address the current risks of biodegradation, promote the long-term resilience of cultural heritage. Future studies should explore monitoring frameworks for eco-friendly fungicides and community engagement initiatives to further advance the sustainable management of Luoyang’s built heritage.

Author Contributions

Conceptualization, Z.L., P.Y. and Y.L.; methodology, Z.L., P.Y. and Y.L.; investigation, Z.L. and P.Y.; data curation, Z.L. and Y.L.; writing—original draft preparation, Z.L.; writing—review and editing, Z.L. and Y.L.; All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article.

Acknowledgments

The authors extend gratitude to the Luoyang Cultural Heritage Administration for facilitating access to historic sites.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zayats, I.; Murgul, V. The institutional architecture—Art or building? Procedia Eng. 2016, 165, 1460–1467. [Google Scholar] [CrossRef]
  2. Sterflinger, K.; Piñar, G. Microbial deterioration of cultural heritage and works of art—Tilting at windmills? Appl. Microbiol. Biotechnol. 2013, 97, 9637–9646. [Google Scholar] [CrossRef]
  3. De Belie, N. Microorganisms versus stony materials: A love-hate relationship. Mater. Struct. 2010, 43, 1191–1202. [Google Scholar] [CrossRef]
  4. Beata, G. The use of -omics tools for assessing biodeterioration of cultural heritage: A review. J. Cult. Herit. 2020, 45, 351–361. [Google Scholar] [CrossRef]
  5. Gadd, G.M. Geomicrobiology of the built environment. Nat. Microbiol. 2017, 2, 16275. [Google Scholar] [CrossRef]
  6. Kakakhel, M.A.; Wu, F.; Gu, J.-D.; Feng, H.; Shah, K.; Wang, W. Controlling biodeterioration of cultural heritage objects with biocides: A review. Int. Biodeterior. Biodegrad. 2019, 143, 104721. [Google Scholar] [CrossRef]
  7. Wiktor, V.; De Leo, F.; Urzi, C.; Guyonnet, R.; Grosseau, P.; Garcia-Diaz, E. Accelerated laboratory test to study fungal biodeterioration of cementitious matrix. Int. Biodeter. Biodegr. 2009, 63, 1061–1065. [Google Scholar] [CrossRef]
  8. Korkanç, M.; Savran, A. Impact of the Surface Roughness of Stones Used in Historical Buildings on Biodeterioration. Constr. Build. Mater. 2015, 80, 279–294. [Google Scholar] [CrossRef]
  9. Grube, M.; Cardinale, M.; De Castro, J.V.; Müller, H.; Berg, G. Species-specific structural and functional diversity of bacterial communities in lichen symbioses. ISME J. 2009, 3, 1105–1115. [Google Scholar] [CrossRef]
  10. Margrét, A.S.; Vilhelmsson, O. Selective isolation of potentially phosphate-mobilizing, biosurfactant-producing and biodegradative bacteria associated with a sub-Arctic, terricolous lichen, Peltigera membranacea. FEMS Microbiol. Ecol. 2016, 92, 90. [Google Scholar]
  11. Lisci, M.; Monte, M.; Pacini, E. Lichens and Higher Plants on Stone: A Review. Int. Biodeterior. Biodegrad. 2003, 51, 1–17. [Google Scholar] [CrossRef]
  12. Garcia-Rowe, J.; Saiz-Jimenez, C. Lichens and Bryophytes as Agents of Deterioration of Building Materials in Spanish Cathedrals. Int. Biodeterior. 1991, 28, 151–163. [Google Scholar] [CrossRef]
  13. Adamo, P. Weathering of Rocks and Neogenesis of Minerals Associated with Lichen Activity. Appl. Clay Sci. 2000, 16, 229–256. [Google Scholar] [CrossRef]
  14. Hayek, M.; Salgues, M.; Souche, J.; Cunge, E.; Giraudel, C.; Paireau, O. Influence of the Intrinsic Characteristics of Cementitious Materials on Biofouling in the Marine Environment. Sustainability 2021, 13, 2625. [Google Scholar] [CrossRef]
  15. Stanaszek-Tomal, E. Environmental Factors Causing the Development of Microorganisms on the Surfaces of National Cultural Monuments Made of Mineral Building Materials-Review. Coatings 2020, 10, 1203. [Google Scholar] [CrossRef]
  16. Giannantonio, D.J.; Kurth, J.C.; Kurtis, K.E.; Sobecky, P.A. Effects of concrete properties and nutrients on fungal colonization and fouling. Int. Biodeter. Biodegr. 2009, 63, 252–259. [Google Scholar] [CrossRef]
  17. Motti, R.; Bonanomi, G.; Stinca, A. Biodeteriogens at a Southern Italian Heritage Site: Analysis and Management of Vascular Flora on the Walls of Villa Rufolo. Int. Biodeterior. Biodegrad. 2021, 162, 105252. [Google Scholar] [CrossRef]
  18. Herrera, L.K.; Arroyave, C.; Guiamet, P.; de Saravia, S.G.; Videla, H. Biodeterioration of Peridotite and Other Constructional Materials in a Building of the Colombian Cultural Heritage. Int. Biodeterior. Biodegrad. 2004, 54, 135–141. [Google Scholar] [CrossRef]
  19. Warscheid, T.; Braams, J. Biodeterioration of Stone: A Review. Int. Biodeterior. Biodegrad. 2000, 46, 343–368. [Google Scholar] [CrossRef]
  20. Miller, A.Z.; Sanmartín, P.; Pereira-Pardo, L.; Dionísio, A.; Saiz-Jimenez, C.; Macedo, M.F.; Prieto, B. Bioreceptivity of Building Stones: A Review. Sci. Total Environ. 2012, 426, 1–12. [Google Scholar] [CrossRef]
  21. Cámara, B.; Álvarez de Buergo, M.; Fort, R.; Souza-Egipsy, V.; Pérez-Ortega, S.; de los Ríos, A.; Wierzchos, J.; Ascaso, C. Anthropic effect on the lichen colonization in building stones from cultural heritage. Period. Di Mineralogia 2015, 84, 539–552. [Google Scholar]
  22. Luoyang Local Chronicles Compilation Committee. Annals of Luoyang City—Annals of Natural Environment; Zhongzhou Ancient Books Publishing House: Zhengzhou, China, 2000; pp. 169–182. [Google Scholar]
  23. Gardes, M.; Brun, T.D. ITS primers with enhanced specificity for basidiomycetes—Application to the identification of mycorrhizae and rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef] [PubMed]
  24. Heuer, H.; Krsek, M.; Baker, P.; Smalla, K.; Wellington, E.M. Analysis of actinomycete communities by specific amplification of genes encoding 16S rRNA and gelelectrophoretic separation in denaturing gradients. Appl. Environ. Microbiol. 1997, 63, 3233–3241. [Google Scholar] [CrossRef]
  25. Konkol, N.R.; McNamara, C.J.; Hellman, E.; Mitchell, R. Early detection of fungal biomass on library materials. J. Cult. Herit. 2012, 13, 115–119. [Google Scholar] [CrossRef]
  26. Ortega-Calvo, J.J.; Arino, X.; Hernandez-Marine, M.; Saiz-Jimenez, C. Factors affecting the weathering and colonization of monuments by phototrophic microorganisms. Sci. Total Environ. 1995, 167, 329–341. [Google Scholar] [CrossRef]
  27. Crispim, C.; Gaylarde, C. Cyanobacteria and biodeterioration of cultural heritage: A review. Microb. Ecol. 2005, 49, 1–9. [Google Scholar] [CrossRef]
  28. Hoang, C.P.; Kinney, K.A.; Corsi, R.L.; Szaniszlo, P.J. Resistance of green building materials to fungal growth. Int. Biodeterior. Biodegrad. 2010, 64, 104–113. [Google Scholar] [CrossRef]
  29. Hyvärinen, A.; Meklin, T.; Vepsäläinen, A. Fungi and actinobacteria in moisture-damaged building materials—Concentrations and diversity. Int. Biodeterior. Biodegrad. 2002, 49, 27–37. [Google Scholar] [CrossRef]
  30. Sawadogo, A.Y.F.; Roux, S.; Lecomte, A. Bioreceptivity of Portland and calcium Sulphoaluminate cements in urban sewerage networks. Constr. Build. Mater. 2021, 293, 123425. [Google Scholar] [CrossRef]
  31. Ma, S.C.; Wu, Y.W.; Bao, P. Experimental study on the properties of modern blue clay brick for Kaifeng People’s Conference Hall. Sci. Rep. 2021, 11, 20631. [Google Scholar] [CrossRef]
  32. Tran, T.H.; Govin, A.; Guyonnet, R.; Grosseau, P.; Lors, C.; Garcia-Diaz, E.; Damidot, D.; Devès, O.; Ruot, B. Influence of the intrinsic characteristics of mortars on biofouling by Klebsormidium flaccidum. Int. Biodeterior. Biodegrad. 2012, 70, 31–39. [Google Scholar] [CrossRef]
  33. D’Orazio, M.; Cursio, G.; Graziani, L.; Aquilanti, L.; Osimani, A.; Clementi, F.; Yéprémian, C.; Lariccia, V.; Amoroso, S. Effects of water absorption and surface roughness on the bioreceptivity of ETICS compared to clay bricks. Build. Environ. 2014, 77, 20–28. [Google Scholar] [CrossRef]
  34. Barberoussea, H.; Ruota, B.; Yepremian, C.; Boulon, G. An assessment of façade coatings against colonization by aerial algae and cyanobacteria. Build. Environ. 2007, 42, 2555–2561. [Google Scholar] [CrossRef]
  35. Petrozzi, S.; Dunn, I.J.; Heinzle, E.; Kut, O.M. Carrier influence in anaerobic biofilm fluidized beds for treating vapor condensate from the sulfite cellulose process. Can. J. Chem. Eng. 1991, 69, 527–553. [Google Scholar] [CrossRef]
  36. Gutarowska, B. Metabolic activity of moulds as a factor of building materials biodegradation. Pol. J. Microbiol. 2010, 59, 119–124. [Google Scholar] [CrossRef]
  37. Kaarakainen, P.; Rintala, H.; Vepsalainen, A.; Hyvarinene, A.; Nevalainen, A.; Meklin, T. Microbial content of house dust samples determined with qPCR. Sci. Total Environ. 2009, 407, 4673–4680. [Google Scholar] [CrossRef] [PubMed]
  38. Mascaro, M.E.; Pellegrino, G.; de Rose, I.; Palermo, A.M. Contribution to the Knowledge of Biodeteriogenic Flora on Three Historical Calabrian (Southern Italy) Churches. Open J. Ecol. 2021, 11, 287–300. [Google Scholar] [CrossRef]
  39. Caneva, G.; Nugari, M.P.; Salvadori, O. Plant Biology for Cultural Heritage: Biodeterioration and Conservation; Getty Publications: Los Angeles, CA, USA, 2008. [Google Scholar]
  40. De los Ríos, A.; Ascaso, C. Contributions of in situ microscopy to the current understanding of stone biodeterioration. Int. Microbiol. 2005, 8, 181–188. [Google Scholar]
  41. Bock, E.; Ahlers, B.; Meyer, C. Biogene Korrosion von Beton und Natursteinen durch Salpetersäure bildende Bakterien. Bauphysik 1989, 4, 141–144. [Google Scholar]
  42. Frankeová, D.; Bauerová, P.; Náhunková, P.; Slížková, Z.; Polák, M. Characterization and damage of the historic brick masonry of the Zákupy castle stables. J. Phys. Conf. Ser. 2024, 2792, 012015. [Google Scholar] [CrossRef]
  43. Liu, J.B.; Zhang, Z.J. Characteristics and weathering mechanisms of the traditional Chinese blue brick from the ancient city of Ping Yao. R. Soc. Open Sci. 2020, 7, 200058. [Google Scholar] [CrossRef] [PubMed]
  44. Prieto, B.; Vázquez-Nion, D.; Fuentes, E.; Durán-Román, A.G. Response of subaerial biofilms growing on stone-built cultural heritage to changing water regime and CO2 conditions. Int. Biodeter. Biodegr. 2020, 148, 104882. [Google Scholar] [CrossRef]
  45. Filomena, D.L.; Marchetta, A.; Urzì, C. Black Fungi on Stone-Built Heritage: Current Knowledge and Future Outlook. Appl. Sci. 2022, 12, 3969. [Google Scholar] [CrossRef]
  46. Geoffrey, M.G.; Dyer, T.D. Bioprotection of the built environment and cultural heritage. Microb. Biotechnol. 2017, 10, 1152–1156. [Google Scholar]
  47. Gaylarde, C.C.; Rodrıguez, C.H.; Navarro, N.Y.; Ortega, M.B. Microbial biofilms on the sandstone monuments of the Angkor Wat Complex, Cambodia. Curr. Microbiol. 2012, 64, 85–92. [Google Scholar] [CrossRef]
Sustainability 17 03721 g001
Figure 1. The geographical position of Luoyang in China and the chosen sample region.
Figure 1. The geographical position of Luoyang in China and the chosen sample region.
Sustainability 17 03721 g001
Sustainability 17 03721 g002
Figure 2. Investigation and sampling of lichen-induced biodeterioration on brick carvings on the roof ridge of historical buildings in the Luoyang region.
Figure 2. Investigation and sampling of lichen-induced biodeterioration on brick carvings on the roof ridge of historical buildings in the Luoyang region.
Sustainability 17 03721 g002
Sustainability 17 03721 g003
Figure 3. Agarose gel electrophoresis analysis of PCR products. (M) Marker Ladder (DL 1000); (1) bacteria; (2) fungi; (3) cyanobacteria.
Figure 3. Agarose gel electrophoresis analysis of PCR products. (M) Marker Ladder (DL 1000); (1) bacteria; (2) fungi; (3) cyanobacteria.
Sustainability 17 03721 g003
Sustainability 17 03721 g004
Figure 4. Detection rate of lichen microbial community on brick carvings on roof ridges of historical buildings in the Luoyang region: (a) bacterial community; (b) fungal community.
Figure 4. Detection rate of lichen microbial community on brick carvings on roof ridges of historical buildings in the Luoyang region: (a) bacterial community; (b) fungal community.
Sustainability 17 03721 g004
Sustainability 17 03721 g005
Figure 5. Distribution patterns of lichen microbial communities on brick carvings on roof ridges of historical buildings in various microclimate zones in the Luoyang region: (a) bacterial community; (b) fungal community.
Figure 5. Distribution patterns of lichen microbial communities on brick carvings on roof ridges of historical buildings in various microclimate zones in the Luoyang region: (a) bacterial community; (b) fungal community.
Sustainability 17 03721 g005
Table 1. Study area and purposive sampling.
Table 1. Study area and purposive sampling.
Location of Historic BuildingsHistoric Buildings NameConstruction Time (AD)Sample No.
Luoyang urban areaZhang’s residence1781LYU
Yichuan CountyWen’s residence1873YC
GuanoYC-G
Carving materialYC-C
Yi River beach YC-R
Yanshi CountyGuo’s residence1873YS
Mengjin CountyWei’s residence1804MJ
Xin’an CountyWhang’s residence1877XA
Yiyang CountySu’s residence1831YY
Luoning CountyCheng’s residence1861LN
Ruyang CountyWang’s residence1862RY
Song CountyChai’s residence1824SC
Luanchuan CountyLi’s residence1817LC
Mountain rock LC-M
Table 2. Primer sets used in this study for bacteria, fungi, and cyanobacteria.
Table 2. Primer sets used in this study for bacteria, fungi, and cyanobacteria.
PopulationPrimersSequence (5′-3′)Reference Strains
Bacteria338FACTCCTACG GGAGGCAGCAGBacillus halmapalus (MW893675.1)
806RGGACTACCAGGGTATCTAAC
FungiITS5GAAGTAAAAGTCGTAACAAGGAspergillus aureoterreus (OL772679.1)
ITS1FCTTGGTCATTTAGAGGAAGTAA
Cyanobacteria309FGGGGAATTTTCCGCAATGGGNostocaceae cyanobacterium (OP502075.1)
732RTACTGGGGTATCTAATCCCATT
Table 3. Microbial community of lichen on roof ridge brick carvings in the microclimate zone of the Luoyang region.
Table 3. Microbial community of lichen on roof ridge brick carvings in the microclimate zone of the Luoyang region.
Microclimatic ZoneSample No.Microbial Type
BacteriaFungi
Basin climate zoneLYUActinobacteria;
Bacillus wiedmannii		Cladosporium halotolerans;
Aspergillus costaricensis
YCCyanobacteria;
Bacillus licheniformis;
Chroococcidiopsis lichenoides;
Micromonosporaceae;
Actinomycetospora flava		Cladosporium tenuissimum;
Septoriella hibernica;
Aspergillus terreus;
Metarhizium marquandii
YC-GBacillus licheniformis;
Bacillus cereus		Aspergillus costaricensis
YC-CActinobacteria;
Bacillus licheniformis		Metarhizium marquandii;
Aspergillus terreus
YC-RCyanobacteria;
Chroococcidiopsis lichenoides; Bacillus licheniformis;
Scytonema stuposum;
Actinobacteria		Penicillium atramentosum; Metarhizium marquandii; Aspergillus sydowii;
Aspergillus terreus
Hilly climate zoneYSCyanobacteria;
Bacillus cereus;
Actinomycetospora flava		Aspergillus terreus;
Metarhizium marquandii
MJCyanobacteria;
Bacillus cereus; Actinomycetospora flava;
Chroococcidiopsis		Aspergillus costaricensis;
Metarhizium marquandii;
Aspergillus terreus
XACyanobacteria;
Bacillus rhizoplanae;
Chroococcidiopsis lichenoides		Aspergillus versicolor;
Aspergillus sydowii;
Cladosporium sp.;
YYCyanobacteria;
Bacillus cereus;
Micromonosporaceae;
Scytonema crispum;
Chroococcidiopsis;
Actinobacteria		Chaetophorales;
Cladosporium sp.;
Aspergillus sydowii;
Aspergillus terreus
Mountainous climate zoneLNCyanobacteria;
Bacillus licheniformis;
Chroococcidiopsis lichenoides;
Microcoleus chthonoplastes;
Actinobacteria		Chaetophorales;
Aspergillus terreus;
Aspergillus costaricensi
RYMicrocoleus paludosus;
Chroococcidiopsis lichenoides; Nostocaceae;
Micromonosporaceae		Cladosporium halotolerans;
Aspergillus sydowii;
Penicillium atramentosum
SCCyanobacteria;
Bacillus licheniformis;
Microcoleus paludosus;
Chroococcidiopsis lichenoides;
Nostoc edaphicum		Cladosporium halotolerans;
Chaetophorales;
Penicillium atramentosum;
Aspergillus sydowii
LCCyanobacteria;
Bacillus licheniformis; Chroococcidiopsis lichenoides; Nostoc edaphicum;
Scytonema crispum		Chaetophorales; Cladosporium sp.;
Cladosporium halotolerans;
Aspergillus costaricensis;
Penicillium atramentosum
LC-MCyanobacteria;
Bacillus licheniformis; Chroococcidiopsis muralis; Micromonosporaceae;
Nostoc edaphicum;
Scytonema crispum;
Microcoleus paludosus		Cladosporium halotolerans; Chaetophorales;
Penicillium atramentosum; Aspergillus sydowii;
Aspergillus costaricensis
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, Z.; Ye, P.; Li, Y. Environmental Factors Influence Lichen Colonization and the Biodeterioration of Brick Carvings on Roof Ridges of Historic Buildings in Luoyang, China. Sustainability 2025, 17, 3721. https://doi.org/10.3390/su17083721

AMA Style

Li Z, Ye P, Li Y. Environmental Factors Influence Lichen Colonization and the Biodeterioration of Brick Carvings on Roof Ridges of Historic Buildings in Luoyang, China. Sustainability. 2025; 17(8):3721. https://doi.org/10.3390/su17083721

Chicago/Turabian Style

Li, Zijing, Ping Ye, and Yinju Li. 2025. "Environmental Factors Influence Lichen Colonization and the Biodeterioration of Brick Carvings on Roof Ridges of Historic Buildings in Luoyang, China" Sustainability 17, no. 8: 3721. https://doi.org/10.3390/su17083721

APA Style

Li, Z., Ye, P., & Li, Y. (2025). Environmental Factors Influence Lichen Colonization and the Biodeterioration of Brick Carvings on Roof Ridges of Historic Buildings in Luoyang, China. Sustainability, 17(8), 3721. https://doi.org/10.3390/su17083721

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop