Next Article in Journal
Investigation of Ground Surface Temperature Increases in Urban Textures with Different Characteristics: The Case of Denizli City
Previous Article in Journal
Will Road Infrastructure Become the New Engine of Urban Growth? A Consideration of the Economic Externalities
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Sustainability
Volume 17
Issue 15
10.3390/su17156817
sustainability-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Assessing Two Decades of Organic Farming: Effects on Soil Heavy Metal Concentrations and Biodiversity for Sustainable Management

by
Yizhi Chen
1,
Jianning Guo
1,
Hanyue Zhao
1,
Guangyu Qu
2,
Siqi Han
2 and
Caide Huang
2,*
1
International Curriculum Centre, Renmin University of China, Beijing 100872, China
2
School of Environmental, Tsinghua University, Beijing 100084, China
*
Author to whom correspondence should be addressed.
Sustainability 2025, 17(15), 6817; https://doi.org/10.3390/su17156817
Submission received: 24 June 2025 / Revised: 23 July 2025 / Accepted: 25 July 2025 / Published: 27 July 2025
(This article belongs to the Section Sustainable Agriculture)
Browse Figures
Versions Notes

Abstract

Organic farming is widely recognized as a promising practice for sustainable agriculture, yet its long-term ecological impacts remain insufficiently investigated. In this study, we evaluated these impacts by comparing heavy metal concentrations, soil invertebrate communities, and microbial profiles between long-term organic and conventional farming systems. A comparative analysis was conducted on 24 plot soils from two paired organic and conventional farm systems in Beijing, each managed continuously for over 20 years. Our results revealed that soils under organic management consistently contained 10.8% to 73.7% lower heavy metals, along with reduced geo-accumulation indices (Igeo, a standardized metric for soil contamination assessment), indicating decreased contamination risks. In terms of soil fauna, while conventional soils showed higher Collembola abundance, organic farming significantly enhanced Collembola richness and diversity by 20.6% to 55.0%. Microbial sequencing likewise revealed enhanced richness and diversity of bacteria and fungi in organic soils. These microbial communities also displayed shifts in dominant taxa and more stable co-occurrence networks under organic management. Principal component analysis and Mantel tests identified soil pH and nutrients as key drivers of soil biodiversity, while heavy metals also imposed negative influences. Collectively, these findings demonstrate that long-term organic farming not only mitigates environmental risks associated with soil contaminants but also promotes belowground ecological integrity by supporting biodiversity of soil fauna and microbiota. This study highlights the ecological significance of sustained organic practices and provides critical insights for advancing sustainable agricultural developments.

Graphical Abstract

1. Introduction

The intensification of modern agriculture has triggered a global sustainability crisis marked by widespread agrochemical pollution, soil degradation, and biodiversity loss [1,2]. It is estimated that 33% of global topsoil is moderately to severely degraded due to erosion and compaction, with farming practices, particularly the excessive use of synthetic fertilizers and pesticides, being primary contributors [3,4]. These unsustainable practices have heightened global concerns regarding agricultural non-point source pollution (ANPSP), including the contamination of soils, rivers, lakes, and groundwater, all of which threaten both food security and human health [5,6]. A major concern is the accumulation of heavy metals, such as cadmium (Cd) and arsenic (As), in agricultural soils, a direct consequence of decades-long phosphate fertilizer application and pesticide overuse [7,8]. These agricultural contaminants not only degrade soil quality but also enter the human food chain through bioaccumulation, posing serious public health risks [9]. In light of the escalating challenges of sustainable food production, it is imperative to assess innovative agricultural approaches that can reduce environmental impacts while maintaining soil health and ensuring stable crop yields.
Organic farming has been widely promoted as a more environmentally sustainable alternative to conventional agriculture [10]. It relies on natural inputs, crop rotations, composts, and biological pest control to maintain soil fertility and ecosystem services by eliminating synthetic agrochemicals and fertilizers [11,12]. Organic soils typically exhibit improved structure, enhanced chemical properties, higher organic carbon, and lower agrochemical residues [13]. However, despite its growing global adoption, the long-term ecological consequences of organic management remain incompletely understood, particularly with respect to soil biodiversity and heavy metal dynamics. While most studies suggest that organic farming reduces chemical inputs due to limited use of synthetic product applications, some have indicated that organic amendments (e.g., manure, compost) may introduce metals and lead to continued accumulation [14,15]. Moreover, it is important to recognize that most existing studies on soil quality and pollutant dynamics under organic management are based on relatively short-term field experiments, which may introduce uncertainties into their findings [16]. Long-term data spanning decades remain scarce, primarily due to the financial challenges of maintaining consistent management over such extended periods. Therefore, studies based on 20-year continuous organic farming systems are particularly valuable, as they provide rare and robust insights into the cumulative impacts of organic practices and enable meaningful comparisons with conventional systems over ecologically relevant timescales.
Soil biodiversity is essential to maintaining sustainable ecosystem functions, such as organic matter decomposition, nutrient cycling, and contaminant mitigation [17]. Soil invertebrates and microbiota communities are highly responsive to environmental shifts and agricultural practices [18]. Among the soil fauna, the microarthropod Collembola, also known as springtails, serves as a vital decomposer and serves as a bioindicator of the health of soil ecosystems. Collembola represent a significant part of soil mesofauna across a wide range of terrestrial habitats and thrive in both moist and arid environments ranging from natural forests to agricultural fields, adapting to diverse ecological conditions [19]. Previous studies had reported that Collembola assemblages are sensitive to the intensity of land tillage and fertilization practices [20]. Additionally, microbial diversity and the stability of bacterial and fungal communities also critically influence soil health and ecosystem services, particularly by ensuring soil functional redundancy and resilience to agricultural disturbances [21,22]. Therefore, evaluating Collembola and microbial abundance as biodiversity provides valuable insights into the long-term ecological impacts of organic farming practices.
To address these knowledge gaps, this study aimed to assess the long-term ecological effects of organic farming on soil heavy metal accumulation and biodiversity. We conducted a comparative analysis of 24 composited soil samples from two well-established, paired organic and conventional farm systems in Northern China, Beijing, which have been managed under consistent cropping for over 20 years. Specifically, we analyzed concentrations of key heavy metals, soil Collembola communities, and microbial diversity using high-throughput sequencing. Our objectives were to (1) determine whether continuous organic farming reduces heavy metal contamination risks, (2) assess how long-term organic management affects soil fauna and microbial diversity, and (3) identify key environmental factors shaping soil biodiversity. It was hypothesized that long-term organic farming reduces soil heavy metal contamination and enhances the biodiversity of soil invertebrates and microbes compared to conventional farming systems. The findings are expected to improve our understanding of the ecological performance of organic farming and offer insights for developing sustainable land management strategies in agroecosystems.

2. Materials and Methods

2.1. Studying and Sampling Farms

Beijing, the political, cultural, and technological hub of China, spans 16,400 km2 and has a permanent population of 21.542 million. Its strong economy and large population provide a solid foundation for the development of suburban organic farms, offering both financial stability and significant market potential. As one of the first cities in China to promote green agriculture, Beijing is now home to more than 300 organic farms. To investigate the long-term effects of continuous organic management on soil health, we selected two of Beijing’s oldest certified organic farms (ORG1 and ORG2), each with over 20 years of consistent organic practices (Figure 1). The selection criteria included farm age, history of continuous management, and data accessibility. The first farm (named ORG1), established in 2003, is located in Chaoyang District (39°99′79″, 116°63′80″), while the second (named ORG2), founded in 2001, is situated in Huairou District (40°26′47″, 116°64′14″). With over two decades of organic cultivation, both farms have obtained official organic certification in China and are among the first recognized “China Eco-Farms”. These two organic farms were ever certified by CHCC China and ECOCERT China, respectively, both of which conducted regular inspections and residue testing to ensure compliance with Chinese or EU organic regulations.
To ensure comparability and minimize environmental variability, two conventional farms (CON1 and CON2) were selected as controls. These farms are located within 500 m of their corresponding organic farms and are managed under similar climatic and soil-type conditions. This close proximity helps reduce spatial heterogeneity in soil conditions between each farm pair. All farms grow leafy vegetables under a similar crop rotation system that includes amaranth, mustard, and Chinese cabbage, thereby reducing the potential confounding effects of crop type on soil properties. The organic farms strictly comply with certification standards, completely avoiding pesticide use and relying on tested and approved sheep manure as the primary fertilizer source. In contrast, conventional farms follow standard agricultural practices, primarily utilizing chemical fertilizers.

2.2. Soil Sampling

Soil sampling was conducted in October 2024, generally following the China Technical Regulations for Arable Land Productivity Survey and Quality Evaluation. Each of the four farms contained six sampling plots (10 cm × 10 cm × 20 cm), serving as six experimental replicates per site. These replicates were established to minimize the influence of soil heterogeneity on the analysis of chemical properties and microbiota. Soil from each plot was thoroughly mixed, impurities were removed, and the samples were placed in plastic bags and transported to the laboratory at 4 °C for sub-sampling. From each composite sample, 500 g of soil was randomly mixed and weighed for Collembola separation, while 10 g of fresh soil was stored at −80 °C for microbial sequencing analysis. The remaining soil was air-dried under ambient conditions and passed through a 2 mm sieve for further physicochemical property testing.

2.3. Soil Properties and Heavy Metal Analysis

Soil pH was determined in a 1:2.5 (w/v) soil-to-water suspension. Soil organic carbon (SOC) was quantified using the dichromate oxidation method (K2Cr2O7) [23], while total nitrogen (TN) was analyzed using the Kjeldahl digestion technique, following established procedures [24]. Available phosphorus (AP) was extracted and measured using Olsen’s method [25]. Available potassium (AK) was determined through ammonium acetate (NH4OAc, pH 7.0) extraction followed by flame photometry. Cation exchange capacity (CEC) was evaluated using the ammonium acetate exchange method. Water stable aggregates (WSAs) of soils were separated and quantified using the standard wet-sieving technique [26].
Approximately 0.1000 g of sieved and air-dried soil from each farm was weighed into clean polytetrafluoroethylene (PTFE) crucibles. A mixed acid solution consisting of HNO3, HF, and HClO4 in a volume ratio of 2:2:1 was then added for microwave digestion. After complete digestion, the concentrations of total heavy metals (Cd, Cu, Zn, Pb, As, Cr, and Ni) were measured using the inductively coupled plasma mass spectrometry (ICP-MS, Thermo Fisher, Waltham, MA, USA) [27,28]. The limit of detection (LOD) of soil metals reached 0.05 μg/kg using ICP-MS.

2.4. Collembola Extraction and Identification

Collembolas were extracted from farm composite soils using a modified Berlese–Tullgren method with a self-developed device (Figure 2). This device created a bright a bright, heated environment above the soil samples, prompting Collembola to move downward and fall into a collection bottle containing ethanol (Figure 2A). After a 48 h separation period, all Collembolans were collected in anhydrous ethanol and stored under refrigerated conditions until identification. Morphological characteristics of each individual were observed and photographed using a stereomicroscope (Zeiss, Oberkochen, BW, Germany). To minimize potential bias from manual species-level identification, all Collembolas were identified to the genus level. Taxonomic classification followed the guidelines of Yin (1998) and the Collembola checklist available at https://www.collembola.org, accessed on 10 February 2025 [29,30]. It is important to note, however, that genus-level identification may obscure the finer-scale ecological patterns and species-specific responses for soil invertebrates due to this taxonomic resolution limitation.

2.5. Soil Microbial Analysis

Genomic DNA was extracted from soil samples from organic and conventional farm soil samples using the FastDNATM Spin Kit (MP Biomedicals, Irvine, CA, USA), following the manufacturer’s protocol. DNA concentrations were measured using a NanoDrop spectrophotometer (Thermo, Waltham, MA, USA), and the integrity of PCR amplicons was confirmed by 2% agarose gel electrophoresis. For bacterial community analysis, the V3–V4 region of the 16S rRNA gene was amplified using primers 515F (GTGCCAGCMGCCGCGG) and 907R (CCGTCAATTCMTTTRAGTTT). Fungal communities were assessed by targeting the ITS1 region and amplified with the primer sets ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATCGATGC). PCR amplification and sequencing were conducted by Beijing Novogene Technology Co., Ltd. (Beijing, China), utilizing the Illumina MiSeq PE300 platform. Raw sequencing data were processed and analyzed using the online tools provided on the Novogene Cloud Platform.

2.6. Statistical Analysis

2.6.1. Heavy Metal Risk Assessment

The geo-accumulation index (Igeo), a widely used method for evaluating heavy metal contamination in agricultural soils, was calculated using the formula proposed by Alamgir (1969) [31]:
I g e o = l o g 2   C n 1.5 × B n
where Igeo represents the geo-accumulation index, and Cn is the measured concentrations of heavy metals in farm soils (mg/kg), while Bn denotes the geochemical background values (mg/kg). The background value for Beijing soils for Cd, Cu, Zn, Pb, As, Cr, and Ni was 0.12, 18.7, 57.5, 24.6, 7.7, 29.8, and 24.7, respectively [32]. Igeo ≤ 0 indicates that the soil is practically uncontaminated, while 0 ≤ Igeo ≤ 1 suggests moderate contamination.

2.6.2. Collembola Biodiversity Index

The Shannon–Wiener index was used to determine the diversity of soil Collembola in each plot from organic and conventional farms based on the following the formula [33]:
H ′ = − ∑ i = 1 i = S P i × L n P i  
where H′ represents the Shannon–Wiener diversity index, S is the total number of species observed, and Pi means the proportion of certain species i. Higher H′ values of this index indicate greater Collembola diversity.

2.6.3. Data Processing

Statistical analyses were performed using IBM SPSS Statistics 20.0, and figures were generated in Origin 2024. Principal Component Analysis (PCA) was conducted to identify key soil properties and microbial factors contributing to data variance. The Mantel test was conducted using the linkET package (version: 0.0.7.4), and data visualization was carried out with the ggplot2 package (version: 3.5.2) in R Studio (version: 2025.08.0) to explore the correlations between soil parameters and soil biodiversity.

3. Results

3.1. Soil Properties of Organic and Conventional Farms

The physicochemical properties of soils under different farming practices are summarized in Table 1. The soil pH ranged from 7.92 to 8.45, with CON2 exhibiting the highest value. The highest SOC content was observed in ORG1 soil (21.3 ± 4.00 g/kg), followed by CON1, both significantly exceeding the values recorded in ORG2 and CON2 (p ≤ 0.05). Similarly, ORG1 and CON1 displayed significantly higher soil nutrient levels compared to ORG2 and CON2, particularly in terms of TN and AK concentrations. CEC values were significantly greater in ORG1 (16.8 ± 1.10 cmol/kg) and CON1 (18.1 ± 4.80 cmol/kg) than in ORG2 and CON2 (p ≤ 0.05). Additionally, WSA was highest in ORG2 (20.2 ± 2.90%) and lowest in CON2 (11.0 ± 0.59%), suggesting that organic management contributes to improved soil structure.

3.2. Heavy Metal Accumulation and Potential Risks

Figure 3 illustrates the concentrations of seven heavy metals in soils from both organic and conventional farms. In both farm pairs, heavy metal concentrations were consistently lower in the organic farms compared to their conventional counterparts. Specifically, the soil Cd concentrations in CON1 and CON2 were 1.67 and 1.76 times higher than those in ORG1 and ORG2, respectively (Figure 3A). For the remaining heavy metals—Cu, Zn, Pb, Cr, Ni, and As—the levels in CON1 were 1.31, 1.63, 1.17, 1.37, 1.17, and 1.18 times higher than those in ORG1 (Figure 3B–G), indicating significantly reduced heavy metal accumulation under organic management (p ≤ 0.05). Between the two farm pairs, both organic and conventional farms in Chaoyang showed relatively higher soil metal concentrations than those in Huairou, particularly for Cd, Cu, Zn, and As.
The potential risks associated with soil heavy metal contamination are illustrated in the radar chart of the geo-accumulation index (Figure 3H). Among all measured heavy metal elements, only selected samples of Cd, Cu, Zn, and Cr exhibited Igeo values greater than 0, indicating a moderate level of contamination risk. However, none of the measured concentrations exceeded the thresholds specified in China’s Soil Environmental Quality Risk Control Standard for Agricultural Land. Notably, in both farm pairs, the radar plots showed that data points from conventional farms were entirely enclosed within those from organic farms. This pattern suggests that organic farming plays a significant role in reducing heavy metal accumulation in soils.

3.3. Soil Collembola Diversity of Organic and Conventional Farms

A total of 696 Collembolas were extracted and identified from 24 composite soil samples collected across the four farms. These specimens were classified into six genera: Entomobrya sp., Isotoma sp., Tullbergia sp., Onychiurus sp., Xenylla sp., and Hypogastrura sp. Overall, conventional farms exhibited significantly higher Collembola abundance than organic farms, with CON1 exhibiting the greatest abundance among all sites (Figure 4A). In contrast, Collembolan richness and diversity followed an opposite pattern. On average, 5.17 and 4.33 genera of Collembolas were recorded in ORG1 and ORG2, respectively, both significantly exceeding those in CON1 and CON2 (Figure 4B) (p ≤ 0.05). Furthermore, the Shannon index values in ORG1 (1.64) and ORG2 (1.53) were markedly higher than in CON1 (1.36) and CON2 (1.05) (Figure 4C) (p ≤ 0.05). These findings suggest that organic management more effectively supports higher species richness and diversity of soil fauna.

3.4. Soil Microbial Diversity and Community of Organic and Conventional Farms

Microbial diversity, richness, community composition, and interactions are exhibited in Figure 5. Based on the sequencing results, the bacterial ASV counts for CON1, ORG1, CON2, and ORG2 soils were 11,285, 11,219, 10,433, and 11,698, while the corresponding fungal ASV counts were 1923, 1992, 1509, and 1732, respectively. On average, both bacterial diversity and richness were higher in organic farms compared to conventional farms. For instance, compared to CON1 and CON2, soil bacterial biodiversity increased by 0.67% in ORG1 and 3.01% in ORG2, although these differences were not statistically significant (Figure 5A). Similarly, soil fungal richness in ORG1 and ORG2 was 1.19 and 1.09 times higher than in CON1 and CON2, respectively (Figure 5D). These results indicate a trend toward greater microbial diversity in organic farming systems.
According to species annotation results, Proteobacteria, Actinobacteriota, Acidobacteriota, and Gemmatimonadota were the most abundant bacterial phyla in both organic and conventional farm soils (Figure 5E). Organic soils exhibited an overall increase in the relative abundance of Acidobacteriota, Crenarchaeota, and Myxococcota compared to conventional farms in both ORG1 and ORG2 groups. Among fungal communities, Ascomycota, Basidiomycota, Mortierellomycota, and Chytridiomycota were the dominant phyla across all soils (Figure 5F). Notably, Basidiomycota and Mortierellomycota were more abundant in organic soils, whereas Ascomycota and Mortierellomycota displayed a decline in organic soils. These shifts contributed to distinct microbial community structures between organic and conventional systems (Figure 5G). The co-occurrence networks illustrate microbial interactions and community stability across the different soil types (Figure 5H). Organic soils consistently exhibited more stable and complex networks compared to conventional soils, characterized by a significant increase in the number of nodes and edges. These features reflect enhanced ecological interactions, such as parasitism, commensalism, and competition, among microbial taxa under organic management.

3.5. Soil Factors Impacting the Soil Biodiversity

PCA and Mantel analyses were conducted to clarify the influence of agricultural management practices and soil parameters in shaping soil biodiversity (Figure 6). The PCA biplot showed that PC1 and PC2 accounted for 36.5% and 28.0% of the total variance, respectively. Biologically, PC1 primarily reflected a gradient of soil physicochemical properties and management practices, which PC2 captured variation in fungal and Collembola communities. Samples from organic and conventional farms were spatially separated along the horizontal axis, corresponding to differences in the richness and biodiversity of bacteria, fungi, and Collembola (Figure 6A). Soil physicochemical properties and heavy metal accumulation exhibited complex interactions with bacterial, fungal, and Collembola communities. Notably, soil pH significantly influenced fungal and Collembola biodiversity and richness and showed strong correlations with heavy metals such as As and Ni (p ≤ 0.05). Soil nutrients, particularly total nitrogen (TN) and available phosphorus (AP), significantly affected microbial communities, including both bacteria and fungi. Furthermore, all measured heavy metals displayed strong intercorrelations and exerted varying degrees of negative effects on the diversity of soil bacteria, fungi, and Collembola (Figure 6B).

4. Discussion

4.1. Influence of Organic Practice on Reducing Heavy Metal Accumulation

The present study demonstrates that organic farming systems exhibit significantly lower concentrations of heavy metals in soil compared to conventional systems. This trend aligns with previous research indicating that organic management practices can effectively reduce the accumulation of toxic elements in agricultural soils [34,35,36]. This reduction is likely due to the restricted use of synthetic agrochemicals, such as phosphate fertilizers, pesticides, and sewage sludge, that are major sources of heavy metal inputs in conventional agriculture [37]. Furthermore, the use of composted organic matter and crop rotation not only reduces exogenous heavy metal inputs but also improves soil physicochemical properties, thereby enhancing metal immobilization and reducing bioavailability [38]. Enhanced soil structure under organic management, as indicated by higher water-stable aggregate contents, may further stabilize heavy metals by promoting their sequestration within aggregates [39].
The geo-accumulation index radar profiles further confirmed that conventional farms exhibit broader contamination risks. Notably, the reliance of conventional farming on chemical fertilizers introduces self-reinforcing contamination cycles: Phosphate fertilizers elevate soil Cd and As, while repeated manure applications in both systems risk Cu/Zn overload if sourced from polluted regions [40]. Organic management mitigates these through microbial activation and physicochemical stabilization. For example, previous research reported 20–40% lower ecological risk indices in organic soils, attributed to enhanced microbial detoxification and metal immobilization by humic complexes [41]. Spatial variation between the two sites (Chaoyang vs. Huairou) suggests that regional factors such as urbanization, industrial proximity, and atmospheric deposition may interact with the management type to influence heavy metal profiles in soils [42]. These findings underscore the broader environmental value of organic farming for soil health and food safety. Future research should incorporate long-term monitoring and metal speciation analyses to further clarify the mechanisms by which organic practices mediate heavy metal dynamics in soils.

4.2. Influence of Organic Practice on Harnessing Soil Biodiversity

Our findings suggest a significant restructuring of soil biodiversity under organic management, characterized by enhanced Collembola richness and microbial community complexity. The greater genus-level diversity of Collembola under organic systems aligns with their role in promoting habitat heterogeneity [43,44]. Organic systems typically avoid synthetic pesticides and mineral fertilizers, which impose toxic pressures on microarthropods and simplify microhabitat structures [45]. Additionally, organic amendments (e.g., compost, cover crops) create spatially heterogeneous resources and pore networks, enabling niche partitioning among soil invertebrates. For example, Liu et al. (2023) documented similar shifts in conservation tillage systems, where reduced disturbance increased Collembola-associated bacterial diversity over 20%, reflecting bottom–up control of faunal diversity [46]. In contrast, conventional systems may favor a few disturbance-tolerant species due to frequent fertilizer and irrigation inputs, leading to high abundance but reduced taxonomic diversity. Thus, the more stable and heterogeneous soil environment under organic management likely supports a wider range of ecological niches, thus promoting species diversity despite the lower overall abundance.
The increased relative abundance of specific bacterial phyla in organic soils highlights a shift towards oligotrophic and symbiotic consortia. Acidobacteriota, which are well adapted to low-nutrient high-SOC conditions typical of organic systems, thrive in these soils [47]. Meanwhile, the dominance of Basidiomycota can drive lignin decomposition and promote mycorrhizal associations, both of which play pivotal roles in soil aggregation and carbon sequestration [48]. Co-occurrence network analysis further revealed more interconnected microbial communities in organic soils, with higher node and edge density indicating intensified mutualistic interactions. This finding aligns with the “insurance hypothesis”, whereby diverse microbial networks buffer environmental stresses through functional redundancy and metabolic flexibility [49]. In addition, the increased abundance of fungi Basidiomycota and Mortierellomycota in organic fields also suggested enhanced organic matter decomposition potential and improved nutrient turnover [50]. Collectively, these shifts finally enhance ecosystem multifunctionality (EMF), as the correlation between microbial diversity and EMF strengthens under organic management, which plays the dual microbiota roles in carbon stabilization and nutrient cycling.
Furthermore, the strong correlations between soil properties and biodiversity further exhibited the role of organic practices in mitigating environmental stressors (Figure 6). Notably, soil nutrients (e.g., TN, AP) exhibited stronger associations with microbial communities than heavy metals, aligning with findings that nutrient availability governs microbial biomass and functional diversity [51]. Conversely, the negative correlations between biodiversity and heavy metals, particularly Cd and Pb, highlight their toxic effects and are consistent with reports of the metal-induced suppression of microbial activity [52]. These findings corroborate that organic practices help mitigate biotic homogenization by alleviating abiotic stressors, emphasizing their potential in sustainable soil management.

4.3. Implications for Sustainable Agricultural Management

The findings of the current study highlight the vital role of organic farming systems in achieving sustainable agriculture while minimizing environmental degradation. By effectively reducing heavy metal accumulation and enhancing soil biodiversity, organic practices provide a viable pathway to harmonize agricultural productivity with ecological conservation. The observed reduction in heavy metal contamination highlighted the urgent need to transition away from conventional, agrochemical-dependent systems, particularly in regions burdened by severe soil pollution and biodiversity loss. Policymakers should prioritize incentivizing organic transition programs, particularly in peri-urban and industrial zones where heavy metal contamination is acute or in rapidly urbanizing areas like Beijing. These results align directly with the goals of SDG 2 (Zero Hunger) and SDG 15 (Life on Land) by promoting food security through healthier soils and protecting terrestrial ecosystems. Integrating long-term organic management into national soil remediation strategies could support China’s sustainable development while also contributing to the global 2030 Agenda.
Nevertheless, several limitations of this study should be acknowledged to guide future research. First, the assessment focused solely on total heavy metal concentrations, leaving uncertainties regarding their bioavailability and speciation, which are critical for evaluating ecological risks. Second, the functional roles and trophic interactions of soil fauna were not explicitly characterized, which constrains our understanding of biological contributions to soil health and metal dynamics under organic management. Additionally, the lack of historical baseline data on initial soil conditions prior to the 20 years of organic management constrains our ability to fully attribute the observed differences solely to management practices
To address these limitations, future research should incorporate sequential extraction techniques or isotopic tracing to better characterize metal mobility, speciation, and plant uptake dynamics. In addition, employing metagenomic and other multi-omics approaches could elucidate how specific microbial and faunal taxa contribute to metal resistance, nutrient cycling, and overall ecosystem functioning. Such efforts would deepen our understanding of metal–microbe–plant interactions in organic systems and enhance the predictive capacity and effectiveness of sustainable agricultural practices.

5. Conclusions

This study systematically demonstrated that, over 20 years, organic farming significantly reduced heavy metal accumulation and enhanced soil biodiversity compared to conventional systems. Organic management notably decreased concentrations of soil Cd, Cu, Zn, and As, along with lower geo-accumulation indices for multiple heavy metals, highlighting its potential to mitigate soil chemical contamination. Furthermore, organic practices promoted greater Collembola diversity and increased microbial richness, diversity, and co-occurrence network complexity. Key taxa such as Acidobacteriota, Crenarchaeota, and Basidiomycota were enriched in organic soils, potentially contributing to soil nutrient cycling and carbon sequestration. However, several limitations warrant further investigation. Techniques like sequential extraction are needed to clarify metal bioavailability, while advanced multi-omics methods could be applied to investigate microbial functionality and their roles in soil health. Overall, this research strongly validated continuous organic practices as an effective strategy for soil ecological restoration, underscoring their critical role in enhancing agricultural sustainability and supporting the achievement of the United Nations Sustainable Development Goals (SDG2) by 2030.

Author Contributions

Conceptualization, Y.C. and C.H.; methodology, Y.C., J.G. and H.Z.; formal analysis, Y.C.; investigation, Y.C., S.H. and G.Q.; visualization, Y.C., S.H. and G.Q.; writing—original draft preparation, Y.C., J.G. and H.Z.; writing—review and editing, C.H.; supervision, C.H. All authors have read and agreed to the published version of the manuscript.

Funding

No funding supported.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available upon request from the corresponding author.

Acknowledgments

We would like to thank the owners of the organic and conventional farms who helped us with the field survey and sampling.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kopittke, P.M.; Menzies, N.W.; Wang, P.; McKenna, B.A.; Lombi, E. Soil and the intensification of agriculture for global food security. Environ. Int. 2019, 132, 105078. [Google Scholar] [CrossRef]
  2. Abudulai, M.; Nboyine, J.A.; Quandahor, P.; Seidu, A.; Traore, F.; Abudulai, M. Agricultural intensification causes decline in insect biodiversity. Glob. Decline Insects 2022, 1, 43–64. [Google Scholar]
  3. Sonderegger, T.; Pfister, S. Global assessment of agricultural productivity losses from soil compaction and water erosion. Environ. Sci. Technol. 2021, 55, 12162–12171. [Google Scholar] [CrossRef]
  4. Gomiero, T. Soil degradation, land scarcity and food security: Reviewing a complex challenge. Sustainability 2016, 8, 281. [Google Scholar] [CrossRef]
  5. Wen, W.; Zhuang, Y.; Jiang, T.; Li, W.; Li, H.; Cai, W.; Xu, D.; Zhang, L. “Period-area-source” hierarchical management for agricultural non-point source pollution in typical watershed with integrated planting and breeding. J. Hydrol. 2024, 635, 131198. [Google Scholar] [CrossRef]
  6. Zhao, Y.; Hu, Z.; Lu, Y.; Shan, S.; Zhuang, H.; Gong, C.; Cui, X.; Zhang, F.; Li, P. Facilitating mitigation of agricultural non-point source pollution and improving soil nutrient conditions: The role of low temperature co-pyrolysis biochar in nitrogen and phosphorus distribution. Bioresour. Technol. 2024, 394, 130179. [Google Scholar] [CrossRef]
  7. Pérez-Lucas, G.; Navarro, G.; Navarro, S. Adapting agriculture and pesticide use in Mediterranean regions under climate change scenarios: A comprehensive review. Eur. J. Agron. 2024, 161, 127337. [Google Scholar] [CrossRef]
  8. Hou, D.; Jia, X.; Wang, L.; McGrath, S.P.; Zhu, Y.-G.; Hu, Q.; Zhao, F.-J.; Bank, M.S.; O’Connor, D.; Nriagu, J. Global soil pollution by toxic metals threatens agriculture and human health. Science 2025, 388, 316–321. [Google Scholar] [CrossRef]
  9. Sarker, A.; Kim, J.-E.; Islam, A.R.M.T.; Bilal, M.; Rakib, M.R.J.; Nandi, R.; Rahman, M.M.; Islam, T. Heavy metals contamination and associated health risks in food webs—A review focuses on food safety and environmental sustainability in Bangladesh. Environ. Sci. Pollut. Res. 2022, 29, 3230–3245. [Google Scholar] [CrossRef]
  10. Gamage, A.; Gangahagedara, R.; Gamage, J.; Jayasinghe, N.; Kodikara, N.; Suraweera, P.; Merah, O. Role of organic farming for achieving sustainability in agriculture. Farming Syst. 2023, 1, 100005. [Google Scholar] [CrossRef]
  11. Muller, A.; Schader, C.; El-Hage Scialabba, N.; Brüggemann, J.; Isensee, A.; Erb, K.-H.; Smith, P.; Klocke, P.; Leiber, F.; Stolze, M.; et al. Strategies for feeding the world more sustainably with organic agriculture. Nat. Commun. 2017, 8, 1290. [Google Scholar] [CrossRef]
  12. Reganold, J.P.; Wachter, J.M. Organic agriculture in the twenty-first century. Nat. Plants 2016, 2, 15221. [Google Scholar] [CrossRef]
  13. Blanco-Canqui, H.; Ruis, S.J.; Francis, C.A. Do organic farming practices improve soil physical properties? Soil Use Manag. 2024, 40, e12999. [Google Scholar] [CrossRef]
  14. Gao, J.; Han, H.; Gao, C.; Wang, Y.; Dong, B.; Xu, Z. Organic amendments for in situ immobilization of heavy metals in soil: A review. Chemosphere 2023, 335, 139088. [Google Scholar] [CrossRef]
  15. Wu, P.; Guo, Z.; Hua, K.; Wang, D. Long-term application of organic amendments changes heavy metals accumulation in wheat grains by affecting soil chemical properties and wheat yields. J. Soils Sediments 2023, 23, 2136–2147. [Google Scholar] [CrossRef]
  16. Bai, Z.; Caspari, T.; Gonzalez, M.R.; Batjes, N.H.; Mäder, P.; Bünemann, E.K.; de Goede, R.; Brussaard, L.; Xu, M.; Ferreira, C.S.S. Effects of agricultural management practices on soil quality: A review of long-term experiments for Europe and China. Agric. Ecosyst. Environ. 2018, 265, 1–7. [Google Scholar] [CrossRef]
  17. Wagg, C.; Bender, S.F.; Widmer, F.; Van Der Heijden, M.G. Soil biodiversity and soil community composition determine ecosystem multifunctionality. Proc. Natl. Acad. Sci. USA 2014, 111, 5266–5270. [Google Scholar] [CrossRef]
  18. Ponge, J.-F.; Pérès, G.; Guernion, M.; Ruiz-Camacho, N.; Cortet, J.; Pernin, C.; Villenave, C.; Chaussod, R.; Martin-Laurent, F.; Bispo, A. The impact of agricultural practices on soil biota: A regional study. Soil Biol. Biochem. 2013, 67, 271–284. [Google Scholar] [CrossRef]
  19. Filser, J.; Mebes, K.-H.; Winter, K.; Lang, A.; Kampichler, C. Long-term dynamics and interrelationships of soil Collembola and microorganisms in an arable landscape following land use change. Geoderma 2002, 105, 201–221. [Google Scholar] [CrossRef]
  20. Coulibaly, S.F.M.; Coudrain, V.; Hedde, M.; Brunet, N.; Mary, B.; Recous, S.; Chauvat, M. Effect of different crop management practices on soil Collembola assemblages: A 4-year follow-up. Appl. Soil Ecol. 2017, 119, 354–366. [Google Scholar] [CrossRef]
  21. Sauma-Sánchez, T.; Alcorta, J.; Tamayo-Leiva, J.; Díez, B.; Bezuidenhout, H.; Cowan, D.A.; Ramond, J.-B. Functional redundancy buffers the effect of poly-extreme environmental conditions on southern African dryland soil microbial communities. FEMS Microbiol. Ecol. 2024, 100, fiae157. [Google Scholar] [CrossRef]
  22. Delgado-Baquerizo, M.; Maestre, F.T.; Reich, P.B.; Jeffries, T.C.; Gaitan, J.J.; Encinar, D.; Berdugo, M.; Campbell, C.D.; Singh, B.K. Microbial diversity drives multifunctionality in terrestrial ecosystems. Nat. Commun. 2016, 7, 10541. [Google Scholar] [CrossRef]
  23. Nelson, D.W.; Sommers, L.E. Total carbon, organic carbon, and organic matter. In Methods of Soil Analysis: Part 2 Chemical and Microbiological Properties, 2nd ed.; American Society of Agronomy and Soil Science Society of America: Madison, WI, USA, 1982; Volume 9, pp. 539–579. [Google Scholar]
  24. Bremner, J.M.; Mulvaney, C. Nitrogen—Total. In Methods of Soil Analysis: Part 2 Chemical and Microbiological Properties; American Society of Agronomy and Soil Science Society of America: Madison, WI, USA, 1982; Volume 9, pp. 595–624. [Google Scholar]
  25. Olsen, S.R. Estimation of Available Phosphorus in Soils by Extraction with Sodium Bicarbonate; USDA Circular No. 939; U.S. Government Printing Office: Washington, DC, USA, 1954.
  26. Elliott, E. Aggregate structure and carbon, nitrogen, and phosphorus in native and cultivated soils. Soil Sci. Soc. Am. J. 1986, 50, 627–633. [Google Scholar] [CrossRef]
  27. Liu, Y.; Wang, Z.; Tan, X.; Hou, D.; Fang, L.; Lin, A.; Li, F.; Duan, G. Long-term effectiveness of heavy metal (loid) stabilization: Development of an assessing method. Environ. Pollut. 2025, 368, 125798. [Google Scholar] [CrossRef]
  28. Li, X.; Wang, L.; Huang, C.; Hou, R.; Hou, D. Long-term soil remediation using layered double hydroxides: Field evidence for simultaneous immobilization of both cations and oxyanions. Environ. Pollut. 2025, 366, 125417. [Google Scholar] [CrossRef]
  29. Yin, W. Pictorical Keys to Soil Animals of China; Science Press: Beijing, China, 2000. [Google Scholar]
  30. Qiao, Z.; Liu, D.; Gong, X.; Schädler, M.; Zhang, S.; Yan, Q.; Liu, X.; Xie, Z.; Chang, L.; Wu, D.; et al. Land-use change reshapes communities and guild structure of Collembola across a wide geographic range of the temperate zone. Appl. Soil Ecol. 2025, 209, 106036. [Google Scholar] [CrossRef]
  31. Alamgir, M.; Islam, M.; Hossain, N.; Kibria, M.; Rahman, M. Assessment of heavy metal contamination in urban soils of Chittagong City, Bangladesh. Int. J. Plant Soil Sci. 2015, 7, 362–372. [Google Scholar] [CrossRef]
  32. Yuan, D.; Li, P.; Yan, C.; Wang, J.; Bai, X.; Wei, Y.; Wang, C.; Kou, Y. Risk Assessment of Heavy Metals in Road-Deposited Sediments and Correlation Distribution of DOM and Heavy Metals in Beijing, China. Toxics 2025, 13, 308. [Google Scholar] [CrossRef]
  33. Dickman, M. Some indices of diversity. Ecology 1968, 49, 1191–1193. [Google Scholar] [CrossRef]
  34. Gomiero, T.; Pimentel, D.; Paoletti, M.G. Environmental impact of different agricultural management practices: Conventional vs. organic agriculture. Crit. Rev. Plant Sci. 2011, 30, 95–124. [Google Scholar] [CrossRef]
  35. Weissengruber, L.; Möller, K.; Puschenreiter, M.; Friedel, J.K. Long-term soil accumulation of potentially toxic elements and selected organic pollutants through application of recycled phosphorus fertilizers for organic farming conditions. Nutr. Cycl. Agroecosystems 2018, 110, 427–449. [Google Scholar] [CrossRef]
  36. Ghani, J.; Nawab, J.; Khan, S.; Khan, M.A.; Ahmad, I.; Ali, H.M.; Siddiqui, M.H.; Funari, V.; Dinelli, E. Organic amendments minimize the migration of potentially toxic elements in soil–plant system in degraded agricultural lands. Biomass Convers. Biorefinery 2024, 14, 6547–6565. [Google Scholar] [CrossRef]
  37. Alengebawy, A.; Abdelkhalek, S.T.; Qureshi, S.R.; Wang, M.-Q. Heavy metals and pesticides toxicity in agricultural soil and plants: Ecological risks and human health implications. Toxics 2021, 9, 42. [Google Scholar] [CrossRef]
  38. Baloch, M.Y.J.; Zhang, W.; Sultana, T.; Akram, M.; Al Shoumik, B.A.; Khan, M.Z.; Farooq, M.A. Utilization of sewage sludge to manage saline–alkali soil and increase crop production: Is it safe or not? Environ. Technol. Innov. 2023, 32, 103266. [Google Scholar] [CrossRef]
  39. Fang, X.; Zhong, X.; Cui, Z.; Zhang, Y.; Du, L.; Yang, Y.; Lv, J. Distribution and remediation techniques of heavy metals in soil aggregates perspective: A review. Water Air Soil Pollut. 2023, 234, 631. [Google Scholar] [CrossRef]
  40. Jiao, W.; Chen, W.; Chang, A.C.; Page, A.L. Environmental risks of trace elements associated with long-term phosphate fertilizers applications: A review. Environ. Pollut. 2012, 168, 44–53. [Google Scholar] [CrossRef]
  41. JIANG, R.; LYU, Y.; SHEN, S. Assessment of heavy metal content and pollution in organic and conventional farming soils in North China. Chin. J. Eco-Agric. 2015, 23, 877–885. [Google Scholar]
  42. Zhou, X.-Y.; Wang, X.-R. Impact of industrial activities on heavy metal contamination in soils in three major urban agglomerations of China. J. Clean. Prod. 2019, 230, 1–10. [Google Scholar] [CrossRef]
  43. Bengtsson, J.; Ahnström, J.; Weibull, A.C. The effects of organic agriculture on biodiversity and abundance: A meta-analysis. J. Appl. Ecol. 2005, 42, 261–269. [Google Scholar] [CrossRef]
  44. Liu, H.; Meng, J.; Bo, W.; Cheng, D.; Li, Y.; Guo, L.; Li, C.; Zheng, Y.; Liu, M.; Ning, T. Biodiversity management of organic farming enhances agricultural sustainability. Sci. Rep. 2016, 6, 23816. [Google Scholar] [CrossRef]
  45. Menta, C.; Remelli, S. Soil health and arthropods: From complex system to worthwhile investigation. Insects 2020, 11, 54. [Google Scholar] [CrossRef]
  46. Liu, S.; Hao, C.; Xie, Z.; Wu, Y.; Liang, A.; Chang, L.; Wu, D.; Chen, T.-W. Conservation tillage impacts on soil biodiversity: Additional insights from the Collembola-associated bacteria. Agric. Ecosyst. Environ. 2024, 362, 108827. [Google Scholar] [CrossRef]
  47. Zhang, L.; Lei, S.; Qian, R.; Ochoa-Hueso, R.; Wang, X.; Wang, J.; Liao, L.; Liu, G.; Li, Q.; Zhang, C. Plant and microbial β diversities are better predictors of ecosystem functioning than their α diversities, but aridity weakens these associations. Plant Soil 2024, 1–20. [Google Scholar] [CrossRef]
  48. Hu, Y.; Chen, J.; Olesen, J.E.; van Groenigen, K.J.; Hui, D.; He, X.; Chen, G.; Deng, Q. Mycorrhizal association controls soil carbon-degrading enzyme activities and soil carbon dynamics under nitrogen addition: A systematic review. Sci. Total Environ. 2024, 948, 175008. [Google Scholar] [CrossRef]
  49. Awasthi, A.; Singh, M.; Soni, S.K.; Singh, R.; Kalra, A. Biodiversity acts as insurance of productivity of bacterial communities under abiotic perturbations. ISME J. 2014, 8, 2445–2452. [Google Scholar] [CrossRef]
  50. Chen, X.; Shi, C.; Han, X.; Wang, X.; Guo, Z.; Lu, X.; Zou, W.; Yan, J. Microbial responses of soil fertility to depth of tillage and incorporation of straw in a haplic chernozem in northeast China. Chin. Geogr. Sci. 2023, 33, 693–707. [Google Scholar] [CrossRef]
  51. Runnel, K.; Tedersoo, L.; Krah, F.-S.; Piepenbring, M.; Scheepens, J.; Hollert, H.; Johann, S.; Meyer, N.; Bässler, C. Toward harnessing biodiversity–ecosystem function relationships in fungi. Trends Ecol. Evol. 2025, 40, 180–190. [Google Scholar] [CrossRef]
  52. Hagmann, D.F.; Goodey, N.M.; Mathieu, C.; Evans, J.; Aronson, M.F.; Gallagher, F.; Krumins, J.A. Effect of metal contamination on microbial enzymatic activity in soil. Soil Biol. Biochem. 2015, 91, 291–297. [Google Scholar] [CrossRef]
Sustainability 17 06817 g001
Figure 1. Geographical location of the typic organic farms for experimental sampling.
Figure 1. Geographical location of the typic organic farms for experimental sampling.
Sustainability 17 06817 g001
Sustainability 17 06817 g002
Figure 2. Berlese–Tullgren method used for Collembola separation and collection. (A) A schematic diagram of the Berlese–Tullgren method; (B) Self-developed device for batch separation in our own lab.
Figure 2. Berlese–Tullgren method used for Collembola separation and collection. (A) A schematic diagram of the Berlese–Tullgren method; (B) Self-developed device for batch separation in our own lab.
Sustainability 17 06817 g002
Sustainability 17 06817 g003
Figure 3. Heavy metal accumulation in soils from different farms and its environmental risks (n = 6). (A–G) The contents of soil Cd, Cu, Zn, Pb, Cr, Ni, and As, respectively (mg/kg dry soil); (H) Radar chart showing the index of geo-accumulation (Igeo) to reveal the risks of heavy metals in various farm soils. Different letters represent statistically significant differences (p ≤ 0.05).
Figure 3. Heavy metal accumulation in soils from different farms and its environmental risks (n = 6). (A–G) The contents of soil Cd, Cu, Zn, Pb, Cr, Ni, and As, respectively (mg/kg dry soil); (H) Radar chart showing the index of geo-accumulation (Igeo) to reveal the risks of heavy metals in various farm soils. Different letters represent statistically significant differences (p ≤ 0.05).
Sustainability 17 06817 g003
Sustainability 17 06817 g004
Figure 4. Collembola abundance, richness, and diversity in different farm soils (n = 6). (A) Average Collembola abundance in each site (inds/site); (B) Collembola richness; (C) Collembola diversity revealed by Shannon index. Different letters represent statistically significant differences (p ≤ 0.05).
Figure 4. Collembola abundance, richness, and diversity in different farm soils (n = 6). (A) Average Collembola abundance in each site (inds/site); (B) Collembola richness; (C) Collembola diversity revealed by Shannon index. Different letters represent statistically significant differences (p ≤ 0.05).
Sustainability 17 06817 g004
Sustainability 17 06817 g005
Figure 5. Bacterial and fungal diversity, community composition, and interactions in soils from different farms (n = 6). (A–D) The indices for bacterial and fungal diversity, including the Shannon and Chao 1; (E,F) the top 10 abundant bacterial and fungal phyla, respectively; (G) PCA analysis showing the microbial community variance of different farm soils; (H) the microbial co-occurrence networks exhibiting bacterial and fungal interactions.
Figure 5. Bacterial and fungal diversity, community composition, and interactions in soils from different farms (n = 6). (A–D) The indices for bacterial and fungal diversity, including the Shannon and Chao 1; (E,F) the top 10 abundant bacterial and fungal phyla, respectively; (G) PCA analysis showing the microbial community variance of different farm soils; (H) the microbial co-occurrence networks exhibiting bacterial and fungal interactions.
Sustainability 17 06817 g005
Sustainability 17 06817 g006
Figure 6. Soil biodiversity of different farms and its impacting factors. (A) PCA analysis indicating the variance of soil biodiversity among the organic and conventional farms; (B) Mantel analysis showing the soil factors impacting soil biodiversity. Asterisks indicate levels of statistical significance: * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 6. Soil biodiversity of different farms and its impacting factors. (A) PCA analysis indicating the variance of soil biodiversity among the organic and conventional farms; (B) Mantel analysis showing the soil factors impacting soil biodiversity. Asterisks indicate levels of statistical significance: * p < 0.05, ** p < 0.01, *** p < 0.001.
Sustainability 17 06817 g006
Table 1. Soil properties of the typic organic farms vs. conventional farms (number = 6).
Table 1. Soil properties of the typic organic farms vs. conventional farms (number = 6).
FarmpHSOC
(g/kg)		TN
(g/kg)		AP
(g/kg)		AK
(g/kg)		CEC (cmol/kg)WSA
(%)
ORG18.00 ± 0.16 b21.3 ± 4.00 a2.33 ± 0.50 a0.28 ± 0.17 a0.51 ± 0.04 a16.8 ± 1.10 ab17.5 ± 2.84 ab
CON17.94 ± 0.21 b20.5 ± 12.2 a2.42 ± 1.10 a0.33 ± 0.19 a0.41 ± 0.06 b18.1 ± 4.80 a14.7 ± 3.23 b
ORG27.92 ± 0.17 b10.5 ± 0.44 b1.22 ± 0.10 b0.24 ± 0.01 a0.34 ± 0.00 c14.3 ± 0.72 bc20.2 ± 2.90 a
CON28.45 ± 0.16 a12.2 ± 1.36 b1.16 ± 0.42 b0.27 ± 0.05 a0.37 ± 0.05 bc12.9 ± 1.75 c11.0 ± 0.59 c
Note: SOC—soil organic carbon; TN—total nitrogen; AP—available phosphorus; AK—available potassium; CEC—cation exchange capacity; WSAs—water stable aggregates. Different letters represent statistically significant differences (p ≤ 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, Y.; Guo, J.; Zhao, H.; Qu, G.; Han, S.; Huang, C. Assessing Two Decades of Organic Farming: Effects on Soil Heavy Metal Concentrations and Biodiversity for Sustainable Management. Sustainability 2025, 17, 6817. https://doi.org/10.3390/su17156817

AMA Style

Chen Y, Guo J, Zhao H, Qu G, Han S, Huang C. Assessing Two Decades of Organic Farming: Effects on Soil Heavy Metal Concentrations and Biodiversity for Sustainable Management. Sustainability. 2025; 17(15):6817. https://doi.org/10.3390/su17156817

Chicago/Turabian Style

Chen, Yizhi, Jianning Guo, Hanyue Zhao, Guangyu Qu, Siqi Han, and Caide Huang. 2025. "Assessing Two Decades of Organic Farming: Effects on Soil Heavy Metal Concentrations and Biodiversity for Sustainable Management" Sustainability 17, no. 15: 6817. https://doi.org/10.3390/su17156817

APA Style

Chen, Y., Guo, J., Zhao, H., Qu, G., Han, S., & Huang, C. (2025). Assessing Two Decades of Organic Farming: Effects on Soil Heavy Metal Concentrations and Biodiversity for Sustainable Management. Sustainability, 17(15), 6817. https://doi.org/10.3390/su17156817

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop