Antifungal and Antiaflatoxigenic Activities of Different Plant Extracts against Aspergillus flavus
Abstract
1. Introduction
2. Materials and Methods
2.1. Source of the Fungus and Maize Grains Used in the Study
2.2. Preparation of Extracts
2.3. Total Phenolic Content Estimation in Plant Peels
2.4. Radical Scavenging Capacity of Plant Extracts
2.5. Plant Extracts Effects on Fungi Growth and Production of AFB1
2.5.1. Antifungal Growth Estimations
2.5.2. Effect of Different Plant Extracts on the Storage of Maize Grains
2.5.3. Extraction of Aflatoxin B1 from Samples
2.5.4. HPLC Analysis of AFB1
2.5.5. Real-Time PCR Assay
2.6. Statistical Analysis
3. Results and Discussion
3.1. Effect of Plant Extracts on the Growth of A. flavus and Production of AFB1
3.2. Maize Storage Experiment
3.2.1. Effect of Plant Extracts on Production of AFB1
3.2.2. Effect of Plant Extracts on Grain Shape and Smell
3.3. RT-qPCR Analysis of AFB1 Biosynthetic Genes
3.4. Total Phenolic Content (TPC) of the Studied Plant Extracts
3.5. Antioxidant Activities of the Extracts
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wu, F.; Bhatnagar, D.; Bui-Klimke, T.; Carbone, I.; Hellmich, R.; Munkvold, G.; Paul, P.; Payne, G.; Takle, E. Climate change impacts on mycotoxin risks in US maize. World Mycotoxin J. 2011, 4, 79–93. [Google Scholar] [CrossRef]
- Perrone, G.; Haidukowski, M.; Stea, G.; Epifani, F.; Bandyopadhyay, R.; Leslie, J.F.; Logrieco, A. Population structure and Aflatoxin production by Aspergillus Sect. Flavi from maize in Nigeria and Ghana. Food Microbiol. 2014, 41, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Asters, M.C.; Williams, W.P.; Perkins, A.D.; Mylroie, J.E.; Windham, G.L.; Shan, X. Relating significance and relations of differentially expressed genes in response to Aspergillus flavus infection in maize. Sci. Rep. 2014, 4, 4815. [Google Scholar] [CrossRef] [PubMed]
- Adhikari, B.N.; Bandyopadhyay, R.; Cotty, P.J. Degeneration of aflatoxin gene clusters in Aspergillus flavus from Africa and North America. Amb Express 2016, 6, 62. [Google Scholar] [CrossRef] [PubMed]
- Suleiman, M.N.; Omafe, O.M. Activity of three medicinal plants on fungi isolated from stored maize seeds (Zea mays (L.). Glob. J. Med. Plant Res. 2013, 1, 77–81. [Google Scholar]
- Pietri, A.; Bertuzzi, T.; Pallaroni, L.; Piva, G. Occurrence of mycotoxins and ergosterol in maize harvested over 5 years in Northern Italy. Food Addit. Contam. 2004, 21, 479–487. [Google Scholar] [CrossRef]
- Galvano, F.; Ritieni, A.; Piva, G.; Pietri, A. Mycotoxins in the human food chain. In The Mycotoxin Blue Book; Context Products: Los Angeles, CA, USA, 2005; Volume 1, pp. 187–224. [Google Scholar]
- Strosnider, H.; Azziz-Baumgartner, E.; Banziger, M.; Bhat, R.V.; Breiman, R.; Brune, M.-N.; DeCock, K.; Dilley, A.; Groopman, J.; Hell, K. Workgroup report: Public health strategies for reducing aflatoxin exposure in developing countries. Environ. Health Perspect. 2006, 114, 1898–1903. [Google Scholar] [CrossRef]
- Ogodo, A.C.; Ugbogu, O.C. Public health significance of aflatoxin in food industry—A review. Eur. J. Clin. Biomed. Sci. 2016, 2, 51–58. [Google Scholar]
- Abdel-Kareem, M.M.; Rasmey, A.M.; Zohri, A.A. The action mechanism and biocontrol potentiality of novel isolates of Saccharomyces cerevisiae against the aflatoxigenic Aspergillus flavus. Lett. Appl. Microbiol. 2019, 68, 104–111. [Google Scholar] [CrossRef]
- Gauthier, L.; Bonnin-Verdal, M.-N.; Marchegay, G.; Pinson-Gadais, L.; Ducos, C.; Richard-Forget, F.; Atanasova-Penichon, V. Fungal biotransformation of chlorogenic and caffeic acids by Fusarium graminearum: New insights in the contribution of phenolic acids to resistance to deoxynivalenol accumulation in cereals. Int. J. Food Microbiol. 2016, 221, 61–68. [Google Scholar] [CrossRef]
- LAGOGIANNI, C.; TSITSIGIANNIS, D. Effective chemical management for prevention of aflatoxins in maize. Phytopathol. Mediterr. 2018, 57, 186–197. [Google Scholar]
- Kaur, R.; Kaur, H. The Antimicrobial activity of essential oil and plant extracts of Woodfordia fruticosa. Arch. Appl. Sci. Res. 2010, 2, 302–309. [Google Scholar]
- Ashmawy, N.A.; Behiry, S.I.; Ali, H.M.; Salem, M.Z.M. Evaluation of Tecoma stans and Callistemon viminalis extracts against potato soft rot bacteria in vitro. J. Pure Appl. Microbiol. 2014, 8, 667–673. [Google Scholar]
- Behiry, S.I.; Soliman, S.A.; Al-Askar, A.A.; Alotibi, F.O.; Basile, A.; Abdelkhalek, A.; Elsharkawy, M.M.; Salem, M.Z.M.; Hafez, E.E.; Heflish, A.A. Plantago lagopus extract as a green fungicide induces systemic resistance against Rhizoctonia root rot disease in tomato plants. Front. Plant Sci. 2022, 13, 2818. [Google Scholar] [CrossRef]
- Ferrochio, L.; Cendoya, E.; Farnochi, M.C.; Massad, W.; Ramirez, M.L. Evaluation of ability of ferulic acid to control growth and fumonisin production of Fusarium verticillioides and Fusarium proliferatum on maize based media. Int. J. Food Microbiol. 2013, 167, 215–220. [Google Scholar] [CrossRef]
- Tagne, A.; Feujio, T.P.; Sonna, C. Essential oil and plant extracts as potential substitutes to synthetic fungicides in the control of fungi. In Proceedings of the International Conference Diversifying Crop Protection, La Grande-Motte, France, 12–15 October 2008; pp. 12–15. [Google Scholar]
- Abd El-Rahim, W.M.; Khalil, W.K.B.; Eshak, M.G. Genotoxicity studies on the removal of a direct textile dye by a fungal strain, in vivo, using micronucleus and RAPD-PCR techniques on male rats. J. Appl. Toxicol. 2008, 28, 484–490. [Google Scholar] [CrossRef]
- Abd El-Rahim, W.M.; Moawad, H.; Khalafallah, M. Enhancing the growth of promising fungal strains for rapid dye removal. Fresenius Environ. Bull. 2003, 12, 764–770. [Google Scholar]
- Martin, J.G.P.; Porto, E.; Corrêa, C.B.; Alencar, S.M.; Gloria, E.M.; Cabral, I.S.R.; Aquino, L.M. Antimicrobial potential and chemical composition of agro-industrial wastes. J. Nat. Prod. 2012, 5, 27–36. [Google Scholar]
- Stabnikova, O.; Wang, J.-Y.; Ding, H.B. Biotransformation of vegetable and fruit processing wastes into yeast biomass enriched with selenium. Bioresour. Technol. 2005, 96, 747–751. [Google Scholar] [CrossRef]
- García-Marino, M.; Rivas-Gonzalo, J.C.; Ibáñez, E.; García-Moreno, C. Recovery of catechins and proanthocyanidins from winery by-products using subcritical water extraction. Anal. Chim. Acta 2006, 563, 44–50. [Google Scholar] [CrossRef]
- Mohamed, S.; Hassan, Z.; Hamid, N.A. Antimicrobial activity of some tropical fruit wastes (guava, starfruit, banana, papaya, passionfruit, langsat, duku, rambutan and rambai). Pertanika 1994, 17, 219. [Google Scholar]
- Hossain, M.A.; Ngo, H.H.; Guo, W.S.; Nguyen, T. V Removal of copper from water by adsorption onto banana peel as bioadsorbent. Int. J. Geomate 2012, 2, 227–234. [Google Scholar] [CrossRef]
- Oliveira, L.; Freire, C.S.R.; Silvestre, A.J.D.; Cordeiro, N. Lipophilic extracts from banana fruit residues: A source of valuable phytosterols. J. Agric. Food Chem. 2008, 56, 9520–9524. [Google Scholar] [CrossRef] [PubMed]
- Lim, Y.Y.; Lim, T.T.; Tee, J.J. Antioxidant properties of several tropical fruits: A comparative study. Food Chem. 2007, 103, 1003–1008. [Google Scholar] [CrossRef]
- Chabuck, Z.A.G.; Al-Charrakh, A.H.; Hindi, N.K.K.; Hindi, S.K.K. Antimicrobial effect of aqueous banana peel extract, Iraq. Res. Gate. Pharm. Sci. 2013, 1, 73–75. [Google Scholar]
- Singh, J.P.; Kaur, A.; Shevkani, K.; Singh, N. Influence of jambolan (Syzygium cumini) and xanthan gum incorporation on the physicochemical, antioxidant and sensory properties of gluten-free eggless rice muffins. Int. J. Food Sci. Technol. 2015, 50, 1190–1197. [Google Scholar] [CrossRef]
- Praveena, M.; Prabha, M.S.; Ravi, I.; Vaganan, M.M. Anti-colorectal cancer properties of Hill banana (cv. Virupakshi AAB) fruits: An in vitro assay. Indian J. Nat. Sci. 2018, 8, 13226–13233. [Google Scholar]
- Bouchra, C.; Mohamed, A.; Mina, I.H.; Hmamouchi, M. Antifungal activity of essential oils from several medicinal plants against four postharvest citrus pathogens. Phytopathol. Mediterr. 2003, 42, 251–256. [Google Scholar]
- Shehata, M.G.; Badr, A.N.; El Sohaimy, S.A.; Asker, D.; Awad, T.S. Characterization of antifungal metabolites produced by novel lactic acid bacterium and their potential application as food biopreservatives. Ann. Agric. Sci. 2019, 64, 71–78. [Google Scholar] [CrossRef]
- Walters, D.; Raynor, L.; Mitchell, A.; Walker, R.; Walker, K. Antifungal activities of four fatty acids against plant pathogenic fungi. Mycopathologia 2004, 157, 87–90. [Google Scholar]
- Yu, J. Current understanding on aflatoxin biosynthesis and future perspective in reducing aflatoxin contamination. Toxins 2012, 4, 1024–1057. [Google Scholar] [CrossRef] [PubMed]
- Roze, L.V.; Hong, S.-Y.; Linz, J.E. Aflatoxin biosynthesis: Current frontiers. Annu. Rev. Food Sci. Technol. 2013, 4, 293–311. [Google Scholar] [CrossRef] [PubMed]
- Ehrlich, K.C. Predicted roles of the uncharacterized clustered genes in aflatoxin biosynthesis. Toxins 2009, 1, 37–58. [Google Scholar] [CrossRef] [PubMed]
- Liang, D.; Xing, F.; Selvaraj, J.N.; Liu, X.; Wang, L.; Hua, H.; Zhou, L.; Zhao, Y.; Wang, Y.; Liu, Y. Inhibitory effect of cinnamaldehyde, citral, and eugenol on aflatoxin biosynthetic gene expression and aflatoxin B1 biosynthesis in Aspergillus flavus. J. Food Sci. 2015, 80, M2917–M2924. [Google Scholar] [CrossRef]
- Caceres, I.; El Khoury, R.; Medina, Á.; Lippi, Y.; Naylies, C.; Atoui, A.; El Khoury, A.; Oswald, I.P.; Bailly, J.-D.; Puel, O. Deciphering the anti-aflatoxinogenic properties of eugenol using a large-scale q-PCR approach. Toxins 2016, 8, 123. [Google Scholar] [CrossRef]
- El Khoury, R.; Caceres, I.; Puel, O.; Bailly, S.; Atoui, A.; Oswald, I.P.; El Khoury, A.; Bailly, J.-D. Identification of the anti-aflatoxinogenic activity of Micromeria graeca and elucidation of its molecular mechanism in Aspergillus flavus. Toxins 2017, 9, 87. [Google Scholar] [CrossRef]
- Salem, M.Z.M.; Behiry, S.I.; EL-Hefny, M. Inhibition of Fusarium culmorum, Penicillium chrysogenum and Rhizoctonia solani by n-hexane extracts of three plant species as a wood-treated oil fungicide. J. Appl. Microbiol. 2019, 126, 1683–1699. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Behiry, S.I.; Al-Askar, A.A. Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus. Agronomy 2020, 10, 1312. [Google Scholar] [CrossRef]
- Salem, M.Z.M.; Behiry, S.I.; Salem, A.Z.M. Effectiveness of root-bark extract from Salvadora persica against the growth of certain molecularly identified pathogenic bacteria. Microb. Pathog. 2018, 117, 320–326. [Google Scholar] [CrossRef]
- Turkmen, N.; Sari, F.; Velioglu, Y.S. Effects of extraction solvents on concentration and antioxidant activity of black and black mate tea polyphenols determined by ferrous tartrate and Folin–Ciocalteu methods. Food Chem. 2006, 99, 835–841. [Google Scholar] [CrossRef]
- Farahmandfar, R.; Asnaashari, M.; Sayyad, R. Comparison antioxidant activity of Tarom Mahali rice bran extracted from different extraction methods and its effect on canola oil stabilization. J. Food Sci. Technol. 2015, 52, 6385–6394. [Google Scholar] [CrossRef] [PubMed]
- Asnaashari, M.; Farhoosh, R.; Sharif, A. Antioxidant activity of gallic acid and methyl gallate in triacylglycerols of Kilka fish oil and its oil-in-water emulsion. Food Chem. 2014, 159, 439–444. [Google Scholar] [CrossRef] [PubMed]
- Velluti, A.; Sanchis, V.; Ramos, A.J.; Egido, J.; Marın, S. Inhibitory effect of cinnamon, clove, lemongrass, oregano and palmarose essential oils on growth and fumonisin B1 production by Fusarium proliferatum in maize grain. Int. J. Food Microbiol. 2003, 89, 145–154. [Google Scholar] [CrossRef]
- Alshannaq, A.F.; Gibbons, J.G.; Lee, M.-K.; Han, K.-H.; Hong, S.-B.; Yu, J.-H. Controlling aflatoxin contamination and propagation of Aspergillus flavus by a soy-fermenting Aspergillus oryzae strain. Sci. Rep. 2018, 8, 16871. [Google Scholar] [CrossRef]
- Hoeltz, M.; Welke, J.E.; Noll, I.B.; Dottori, H.A. Photometric procedure for quantitative analysis of aflatoxin B1 in peanuts by thin-layer chromatography using charge coupled device detector. Quim. Nova 2010, 33, 43–47. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Sanan-Mishra, N. Differential expression profiles of tomato miRNAs induced by tobacco mosaic virus. J. Agric. Sci. Technol. 2019, 21, 475–485. [Google Scholar]
- AbdEl-Rahim, W.M.; Khalil, W.K.B.; Eshak, M.G. Evaluation of the gene expression changes in Nile tilapia (Oreochromis niloticus) as affected by the bio-removal of toxic textile dyes from aqueous solution in small-scale bioreactor. Environmentalist 2010, 30, 242–253. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Ismail, I.A.I.A.; Dessoky, E.S.E.S.; El-Hallous, E.I.E.I.; Hafez, E. A tomato kinesin-like protein is associated with Tobacco mosaic virus infection. Biotechnol. Biotechnol. Equip. 2019, 33, 1424–1433. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Dessoky, E.S.; Hafez, E. Polyphenolic genes expression pattern and their role in viral resistance in tomato plant infected with Tobacco mosaic virus. Biosci. Res. 2018, 15, 3349–3356. [Google Scholar]
- Abdelkhalek, A.; Al-Askar, A.A.; Hafez, E. Differential induction and suppression of the potato innate immune system in response to Alfalfa mosaic virus infection. Physiol. Mol. Plant Pathol. 2020, 110, 101485. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Gomez, K.A.; Gomez, A.A. Statistical Procedures for Agricultural Research; John Wiley & Sons: Hoboken, NJ, USA, 1984; ISBN 0471870927. [Google Scholar]
- McDonald, J.H. Handbook of Biological Statistics; Sparky House Publishing: Baltimore, MD, USA, 2009; Volume 2. [Google Scholar]
- Hu, Y.; Zhang, J.; Kong, W.; Zhao, G.; Yang, M. Mechanisms of antifungal and anti-aflatoxigenic properties of essential oil derived from turmeric (Curcuma longa L.) on Aspergillus flavus. Food Chem. 2017, 220, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Hojo, H.; Sato, J. Antifungal activity of licorice (Glycyrrhiza glabra) and potential applications in beverage. Foods Food Ingred. J. Jpn. 2002, 203, 27–33. [Google Scholar]
- Mohseni, R.; Noorbakhsh, F.; Moazeni, M.; Omran, A.N.; Rezaie, S. Antitoxin characteristic of licorice extract: The inhibitory effect on aflatoxin production in. J. Food Saf. 2014, 34, 119–125. [Google Scholar] [CrossRef]
- Borges, C.V.; de Oliveira Amorim, V.B.; Ramlov, F.; da Silva Ledo, C.A.; Donato, M.; Maraschin, M.; Amorim, E.P. Characterisation of metabolic profile of banana genotypes, aiming at biofortified Musa spp. cultivars. Food Chem. 2014, 145, 496–504. [Google Scholar] [CrossRef]
- Naik, P.; Wedel, M.; Bacon, L.; Bodapati, A.; Bradlow, E.; Kamakura, W.; Kreulen, J.; Lenk, P.; Madigan, D.M.; Montgomery, A. Challenges and opportunities in high-dimensional choice data analyses. Mark. Lett. 2008, 19, 201–213. [Google Scholar] [CrossRef]
- Bernardo, J.S.; Sagum, R.S. Eggplant (Solanum melongena L.) peel as a potential functional ingredient in pan de sal. J. Nutr. Food Sci. 2016, 6, 68. [Google Scholar]
- Adom, K.K.; Sorrells, M.E.; Liu, R.H. Phytochemicals and antioxidant activity of milled fractions of different wheat varieties. J. Agric. Food Chem. 2005, 53, 2297–2306. [Google Scholar] [CrossRef]
- Laddomada, B.; Caretto, S.; Mita, G. Wheat bran phenolic acids: Bioavailability and stability in whole wheat-based foods. Molecules 2015, 20, 15666–15685. [Google Scholar] [CrossRef]
- Gemeda, N.; Woldeamanuel, Y.; Asrat, D.; Debella, A. Effect of essential oils on Aspergillus spore germination, growth and mycotoxin production: A potential source of botanical food preservative. Asian Pac. J. Trop. Biomed. 2014, 4, S373–S381. [Google Scholar] [CrossRef]
- El-Aziz, A.; Abeer, R.M.; Mahmoud, M.A.; Al-Othman, M.R.; Al-Gahtani, M.F. Use of selected essential oils to control aflatoxin contaminated stored cashew and detection of aflatoxin biosynthesis gene. Sci. World J. 2015, 2015, 958192. [Google Scholar] [CrossRef] [PubMed]
- Mabrouk, S.S.; El-Shayeb, N.M.A. Isolation of inhibitors of Aspergillus flavus from lentils (Lens culinris Medicus). In Proceedings of the Fifth International Symposium on Mycotoxins and Phycotoxins, Vienna, Austria, 1–3 September 1982. [Google Scholar]
- Yazdani, D.; Ahmad, Z.A.M.; How, T.Y.; Jaganath, I.B.; Shahnazi, S. Inhibition of aflatoxin biosynthesis in Aspergillus flavus by phenolic compounds extracted of Piper betle L. Iran. J. Microbiol. 2013, 5, 428. [Google Scholar]
- Cleveland, T.E.; Yu, J.; Fedorova, N.; Bhatnagar, D.; Payne, G.A.; Nierman, W.C.; Bennett, J.W. Potential of Aspergillus flavus genomics for applications in biotechnology. Trends Biotechnol. 2009, 27, 151–157. [Google Scholar] [CrossRef]
- Yu, J.; Fedorova, N.D.; Montalbano, B.G.; Bhatnagar, D.; Cleveland, T.E.; Bennett, J.W.; Nierman, W.C. Tight control of mycotoxin biosynthesis gene expression in Aspergillus flavus by temperature as revealed by RNA-Seq. FEMS Microbiol. Lett. 2011, 322, 145–149. [Google Scholar] [CrossRef] [PubMed]
- Lappa, I.K.; Dionysopoulou, A.M.; Paramithiotis, S.; Georgiadou, M.; Drosinos, E.H. Dual Transcriptional Profile of Aspergillus flavus during Co-Culture with Listeria monocytogenes and Aflatoxin B1 Production: A Pathogen–Pathogen Interaction. Pathogens 2019, 8, 198. [Google Scholar] [CrossRef] [PubMed]
- Ullah, N.; Akhtar, K.P.; ul Hassan, S.W.; Asi, M.R.; Sadef, Y. First report of molecular characterization of Aspergillus flavus from maize in Pakistan. J. Plant Pathol. 2019, 101, 1289–1290. [Google Scholar] [CrossRef]
- Papa, K.E. Norsolorinic acid mutant of Aspergillus flavus. Microbiology 1982, 128, 1345–1348. [Google Scholar] [CrossRef]
- Bhatnagar, D.; Ehrlich, K.C.; Cleveland, T.E. Molecular genetic analysis and regulation of aflatoxin biosynthesis. Appl. Microbiol. Biotechnol. 2003, 61, 83–93. [Google Scholar] [CrossRef]
- Mayer, Z.; Färber, P.; Geisen, R. Monitoring the production of aflatoxin B1 in wheat by measuring the concentration of nor-1 mRNA. Appl. Environ. Microbiol. 2003, 69, 1154–1158. [Google Scholar] [CrossRef]
- Rodrigues, P.; Venâncio, A.; Kozakiewicz, Z.; Lima, N. A polyphasic approach to the identification of aflatoxigenic and non-aflatoxigenic strains of Aspergillus section Flavi isolated from Portuguese almonds. Int. J. Food Microbiol. 2009, 129, 187–193. [Google Scholar] [CrossRef]
- Scherm, B.; Palomba, M.; Serra, D.; Marcello, A.; Migheli, Q. Detection of transcripts of the aflatoxin genes aflD, aflO, and aflP by reverse transcription–polymerase chain reaction allows differentiation of aflatoxin-producing and non-producing isolates of Aspergillus flavus and Aspergillus parasiticus. Int. J. Food Microbiol. 2005, 98, 201–210. [Google Scholar] [CrossRef] [PubMed]
- Sweeney, M.J.; Pàmies, P.; Dobson, A.D.W. The use of reverse transcription-polymerase chain reaction (RT-PCR) for monitoring aflatoxin production in Aspergillus parasiticus 439. Int. J. Food Microbiol. 2000, 56, 97–103. [Google Scholar] [CrossRef]
- Degola, F.; Berni, E.; Spotti, E.; Ferrero, I.; Restivo, F.M. Facing the problem of “false positives”: Re-assessment and improvement of a multiplex RT-PCR procedure for the diagnosis of A. flavus mycotoxin producers. Int. J. Food Microbiol. 2009, 129, 300–305. [Google Scholar] [CrossRef] [PubMed]
- Dai, J.; Mumper, R.J. Plant Phenolics: Extraction, Analysis and Their Antioxidant and Anticancer Properties. Molecules 2010, 15, 7313–7352. [Google Scholar] [CrossRef] [PubMed]
- Blois, M. Antioxidant determinations by the use of a stable free radical. Nature 1958, 181, 1199–1200. [Google Scholar] [CrossRef]
- González-Montelongo, R.; Lobo, M.G.; González, M. Antioxidant activity in banana peel extracts: Testing extraction conditions and related bioactive compounds. Food Chem. 2010, 119, 1030–1039. [Google Scholar] [CrossRef]
- Fatemeh, S.R.; Saifullah, R.; Abbas, F.M.A.; Azhar, M.E. Total phenolics, flavonoids and antioxidant activity of banana pulp and peel flours: Influence of variety and stage of ripeness. Int. Food Res. J. 2012, 19, 1041. [Google Scholar]
- Tanvir, E.M.; Hossen, M.; Hossain, M.; Afroz, R.; Gan, S.H.; Khalil, M.; Karim, N. Antioxidant properties of popular turmeric (Curcuma longa) varieties from Bangladesh. J. Food Qual. 2017, 2017, 8471785. [Google Scholar] [CrossRef]
- Sadhasivam, S.; Shapiro, O.H.; Ziv, C.; Barda, O.; Zakin, V.; Sionov, E. Synergistic inhibition of mycotoxigenic fungi and mycotoxin production by combination of pomegranate peel extract and azole fungicide. Front. Microbiol. 2019, 10, 1919. [Google Scholar] [CrossRef]
- Hua, S.; Grosjean, O.; Baker, J.L. Inhibition of aflatoxin biosynthesis by phenolic compounds. Lett. Appl. Microbiol. 1999, 29, 289–291. [Google Scholar] [CrossRef]
- Youssef, N.H.; Qari, S.H.; Behiry, S.I.; Dessoky, E.S.; El-Hallous, E.I.; Elshaer, M.M.; Kordy, A.; Maresca, V.; Abdelkhalek, A.; Heflish, A.A. Antimycotoxigenic Activity of Beetroot Extracts against Altenaria alternata Mycotoxins on Potato Crop. Appl. Sci. 2021, 11, 4239. [Google Scholar] [CrossRef]


| Grain Shape Change | Odor Change | Approving | Scale |
|---|---|---|---|
| Whole grains (no change in shape) | No smell | Highly approved | 5 |
| Very simple | very simple | Very very approved | 4 |
| Moderate | Moderate | Very approved | 3 |
| Great | Great | Approved | 2 |
| Sever | Pungent | Unapproved | 1 |
| Target Gene | Sequences (5′-3′) | Function in the Biosynthetic Pathway | Target Size (bp) |
|---|---|---|---|
| β-tubulin (benA) | Forward: CTTGTTGACCAGGTTGTGGAT Reverse: GTCGCAGCCCTCAGCCT | Reference housekeeping gene | 51 |
| aflD (nor-1) | Forward: GTCCAAGCAACAGGCCAAGT Reverse: TCGTGCATGTTGGTGATGGT | Norsolorinic acid (NOR) → Averantin 9 (AVN) | 66 |
| aflP (omtA) | Forward: GGCCGCCGCTTTGATCTAGG Reverse: ACCACGACCGCCGCC | Sterigmatocystin (ST) → O-methylsterigmatocystin (OMST) | 123 |
| aflQ (ordA) | Forward: GTGTCCGCAGTGTCTAGCTT Reverse: GCTCAAAGGTCGCCAGAGTA | O-methylsterigmatocystin (OMST) → aflatoxin B1 (AFB1) | 115 |
| aflR | Forward: CTCAAGGTGCTGGCATGGTA Reverse: CAGCTGCCACTGTTGGTTTC | Pathway regulator | 86 |
| aflS | Forward: CTGCAGCTATATTGCCCACA Reverse: TAAACCCAGGCAGAGTTGGT | Pathway regulator | 117 |
| Treatments | Solvent Concentration | AFB1 (ppb) | PI% | PR% |
|---|---|---|---|---|
| Healthy moistened control | - | 0.00 | - | - |
| Infected control | - | 425 | - | 100 |
| Wheat bran | Acetone 25% | 51.18 | 87.96 | 12.04 |
| Turmeric | Ethanol 25% | 4.46 | 98.95 | 1.05 |
| Taro | Acetone 25% | 69.01 | 83.76 | 16.24 |
| Topsin | 2.5 mg/mL | 143.92 | 66.14 | 43.96 |
| Treatments | Solvent Concentration | Grain Shape | Smell | Granted Grade |
|---|---|---|---|---|
| Healthy moistened control | - | 5 | 0 | 5 |
| Infected control | - | 0 | 5 | 0 |
| Wheat bran | Acetone 25% | 4 | 3 | 4 |
| Turmeric | Ethanol 25% | 5 | 1 | 5 |
| Taro | Acetone 25% | 4 | 1 | 4 |
| Topsin | 2.5 mg/mL | 1 | 5 | 1 |
| Plant Extract | Solvent Concentration | TPC (mgGAE/g dry Extract wt) ± SD | AA (μg/mL) |
|---|---|---|---|
| Ascorbic acid | - | - | 4.28 |
| Wheat bran | Acetone 25% | 46.08 ± 0.54 | 59.41 |
| Turmeric | Ethanol 25% | 49.82 ± 1.99 | 74.16 |
| Taro | Acetone 25% | 61.28 ± 0.64 | 7.45 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Behiry, S.I.; Hamad, N.A.; Alotibi, F.O.; Al-Askar, A.A.; Arishi, A.A.; Kenawy, A.M.; Elsamra, I.A.; Youssef, N.H.; Elsharkawy, M.M.; Abdelkhalek, A.; et al. Antifungal and Antiaflatoxigenic Activities of Different Plant Extracts against Aspergillus flavus. Sustainability 2022, 14, 12908. https://doi.org/10.3390/su141912908
Behiry SI, Hamad NA, Alotibi FO, Al-Askar AA, Arishi AA, Kenawy AM, Elsamra IA, Youssef NH, Elsharkawy MM, Abdelkhalek A, et al. Antifungal and Antiaflatoxigenic Activities of Different Plant Extracts against Aspergillus flavus. Sustainability. 2022; 14(19):12908. https://doi.org/10.3390/su141912908
Chicago/Turabian StyleBehiry, Said I., Najwa A. Hamad, Fatimah O. Alotibi, Abdulaziz A. Al-Askar, Amr A. Arishi, Ahmed M. Kenawy, Ibrahim A. Elsamra, Nesrine H. Youssef, Mohsen Mohamed Elsharkawy, Ahmed Abdelkhalek, and et al. 2022. "Antifungal and Antiaflatoxigenic Activities of Different Plant Extracts against Aspergillus flavus" Sustainability 14, no. 19: 12908. https://doi.org/10.3390/su141912908
APA StyleBehiry, S. I., Hamad, N. A., Alotibi, F. O., Al-Askar, A. A., Arishi, A. A., Kenawy, A. M., Elsamra, I. A., Youssef, N. H., Elsharkawy, M. M., Abdelkhalek, A., & Heflish, A. A. (2022). Antifungal and Antiaflatoxigenic Activities of Different Plant Extracts against Aspergillus flavus. Sustainability, 14(19), 12908. https://doi.org/10.3390/su141912908

