Metagenomic Analysis Reveals the Fate of Antibiotic Resistance Genes in a Full-Scale Wastewater Treatment Plant in Egypt
Round 1
Reviewer 1 Report
Antibiotic resistance genes (ARGs) and antibiotic-resistant bacteria (ARBs) in the environment are the hot topic worldwide. In this work, the authors finish metagenomics and resistome analysis from three wastewater treatment plants in Egypt. This paper well described the work and the experimental results is meaningful. However, some errors and inappropriate statements exist. Therefore, I recommend to accept it after major revision.
Detailed comments are as follows:
Abstract part:
In abstract, author mentioned ARGs and human pathogens, what’s the relationship between them?
Keywords: Each word should be separated by a comma or semicolon. Please choose one, comma or semicolon.
Introduction part:
I think the authors should put an emphasis on the importance or significance of this work. So far, the author just list some publications in this field, then tell reader no similar work in Egypt. I think this is not enough.
What did “latter” represented at last sentence in paragraph 2 of introduction ?
References citation format should be carefully checked.
Paragraph 2: “Conventional wastewater treatment is one of the most common methods worldwide” , please clarify detailed conventional wastewater treatment.
Materials and methods part
Sample collection and processing should be more detailed. For example, the sample date should be presented detailed dates, not just list the month.
All instruments and reagents should be listed detailed information, such as company, country…
Metagenomic sequencing and bioinformatic analysis should be given detailed sequencing primers.
Results and discussions part:
Is the sentence “… indicating that Tz-WWTP could be a potential hotspot for the spread of ARGs in the receiving environment” redundant because it is well known that WWTP has been one of ARGs’ sources ?
Author Response
Manuscript ID: sustainability-1378594
Title: Metagenomic and Resistome Analysis of Wastewater Treatment Plant in Egypt
Authors: Osama S Ali, Walaa G Hozayen, Abdulwahab S Almutairi, Sherif Edris, Aala
A Abulfaraj *, Amged A Ouf, Hamada M. Mahmoud
The detailed responses to reviewers’ comments
Reviewer 1:
Abstract part
Point 1: In the abstract, the author mentioned ARGs and human pathogens, what’s the relationship between them?
Response 1: The relationship between ARGs and human pathogens in the treated effluent can be explained as:
Firstly, the spread of ARGs among different bacteria takes place mainly by horizontal gene transfer (HGT) that include conjugation, transformation and transduction mechanisms. Mobile ARGs that can be transferred through HGT are those carried by mobile genetic elements (MGEs) on the same genomic context. MGEs are represented by plasmids, integrons, transposons and insertion sequences.
Moreover, bacterial hosts of ARGs are classified as reservoirs that include intrinsic resistant bacteria, carriers that can acquire ARGs through HGT but cannot infect humans, and vectors that also acquire ARGs but they are able to colonize and infect humans (Vaz-Moreira et al., 2014). Commensal bacteria and opportunistic pathogens are members of the vectors. Therefore, the potential human health risk is considered at its maximum level with the presence of mobile ARGs hosted by pathogenic bacteria.
Research evidence for ARG exchanges between carriers and vectors of different origins was reported. Raphael et al., 2011 and Ruimy et al., 2010 recovered ARGs encode for resistance against extended-spectrum beta-lactamases (ESBLs) which is one of the most important groups of clinically relevant resistance genes from DNA sequences derived from plant vectors namely Ranella aquantilis and Pseudomonas teessidea. On the other hand, ARG transfer from a fish vector Aeromonas salmonicida subsp. salmonidica to human pathogens such as Aeromonas hydrophila, E. coli, and Salmonella was reported by Heuer et al., 2009 and Rolain, 2013.
In conclusion, having ARGs in association with human pathogens in the effluent samples drags attention to a potential human health risk that might occur when the treated wastewater is discharged into the water currents. The same authors of the current study have another unpublished complimentary work to investigate the mobility potential and human health risk level of the ARGs recovered from the assembled contigs of the influent and treated effluent samples of this study.
Point 2: Keywords: Each word should be separated by a comma or semicolon. Please choose one, comma, or semicolon.
Response 2: Done (the comma was chosen)
Introduction part
Point 3: I think the authors should put an emphasis on the importance or significance of this work. So far, the author just lists some publications in this field, then tells the reader no similar work in Egypt. I think this is not enough.
Response 3: the introduction amendment in the manuscript to cover the missing part of how importance of this work.
Point 4: What did “latter” represented in the last sentence in paragraph 2 of the introduction?
Response 4: The sentence was rephrased:
“Although chlorine disinfection was used to eliminate fecal coliform bacteria from the treated effluent, multiple reports indicated that disinfection had a little to do with the removal of ARGs in WWTPs”
Point 5: References citation format should be carefully checked.
Response 5: Screen tips are adjusted to match hyperlink destination.
Point 6: Paragraph 2: “Conventional wastewater treatment is one of the most common methods worldwide”, please clarify detailed conventional wastewater treatment.
Response 6: done
“Wastewater treatment technologies are classified into two main categories: conventional and non-conventional (advanced). Conventional wastewater treatment is one of the most applied systems worldwide. In which, the treatment process consists of primary, secondary, and tertiary phases. The primary stage is mainly mechanical that aims to reduce solid particles such as grease, grit, sand, etc... However, secondary treatment is a biological phase that intends to reduce organic matter content using aerobic or anaerobic microbial degradation [6]. Conventional activated sludge (CAS) is the common method for the biological treatment stage which is used in the WWTP of this study. Finally, in case of tertiary phase is found, the treated wastewater is separated from the activated sludge and disinfected with chlorine or ultraviolet before discharging into water streams. Although this treatment process is relatively cheap and highly efficient in the removal of organic substances and a wide range of pathogenic bacteria, it fails to adequately eliminate ARBs and ARGs from wastewater [7]. This might pose an inevitable risk for the spread of antibiotic resistance phenotype among the surviving bacteria threatening human and environmental health. Although chlorine disinfection was used to eliminate fecal coliform bacteria from the treated effluent, multiple reports indicated that disinfection had little to do with the removal of ARGs in WWTPs [8-10]. On the other hand, non-conventional wastewater treatment uses advanced technologies such as membrane bioreactors (MBR), moving bed biofilm reactor (MBBR), fixed bed bioreactors (FBR), and a new class of nanomaterials. Although the non-conventional methods generate higher-quality treated wastewater, they are not economical enough for widespread applications especially in the developing countries.”
Materials and methods part
Point 7: Sample collection and processing should be more detailed. For example, the sample date should be presented detailed dates, not just list the month.
Response 7: Done
Point 8: All instruments and reagents should be listed in detailed information, such as company, country…
Response 8: Done
Point 9: Metagenomic sequencing and bioinformatic analysis should be given detailed sequencing primers.
Response 9:
BGI used Nextera™DNAFlex library preparation workflow cat. No. 20018704 with Nextera DNA CD Indexes cat. No. 20018707
Adapter Trimming
The following sequence is used for Read 1 and Read 2 adapter trimming.
CTGTCTCTTATACACATCT
llumina DNA PCR-Free Prep, Tagmentation Adapter Trimming
The following sequence includes two adapter sequences joined by a plus sign. When performing adapter trimming, the software independently assesses each adapter for trimming.
CTGTCTCTTATACACATCT+ATGTGTATAAGAGACA
Nextera Mate Pair Adapter Trimming
The following sequence includes two adapter sequences joined by a plus sign. When performing adapter trimming, the software independently assesses each adapter for trimming.
CTGTCTCTTATACACATCT+AGATGTGTATAAGAGACAG
The transposase adapters are used for Nextera tagmentation.
Read 1
5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Read 2
5′ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
PCR Primers
Index 1 Read
5′ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
Index 2 Read
5′ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC
Results and discussion’s part:
Point 10: Is the sentence “… indicating that Tz-WWTP could be a potential hotspot for the spread of ARGs in the receiving environment” redundant because it is well known that WWTP has been one of ARGs’ sources?
Response 10: Deleted and enhanced
Reviewer 2 Report
Manuscript ID: sustainability-1378594
Title: Metagenomic and Resistome Analysis of Wastewater Treatment Plant in Egypt
Reviewer Comments:
General comment:
This paper is regarding the metagenomic analysis conducted on the environmental samples collected from three treatment locations in Egypt. In this paper, the authors claimed that 67% of the ARGs detected in the influent persisted in the treated effluent and activated sludge; however, the total removal efficiency of ARGs in the WWTP was 97%. However, the writing and presentation of data is not of publication quality. There is some clarify needed to understand the processes carried out in this work. To conclude, this paper is still lack of assurance and a more structured content is needed to improve this manuscript. Hope below comments will be able to help to further improve the paper
- please make sure that the paper is checked by native English speaker, the language needs improvement.
- Please check Guides for Authors to make sure it is followed
- Whether there are too much figures in the manuscript, in order to reduce the published pages, several figures can be put into supplementary materials.
- The naming of samples are quite confusing
Abstract:
- Needs major revision prior to the amendment of the main content.
- An abstract is often presented separately from the article, so it must be able to stand alone. Hence the problem statement, aim, novelty and results of the study has all included in.
- Keywords must be different from title to enhance search ability and findability. Select words that describes the highlight/novelty of the research.
Introduction:
- State the objectives of the work and provide an adequate background, avoiding a detailed literature survey or a summary of the results.
- The last paragraph of the introduction section is very critical. A comprehensive explanation on how this work differs from the existing work should be explained and emphasized in the introduction.
Section 2. Materials & methods
- What is the sampling method?
- 2017? Quite old
- Please use SI units and SI-compliant symbols for widely used non-SI units. Make sure to leave a space between every value and its symbol for the measurement unit.
Results and discussion:
- Scientific name must be italic and after first mention can be abbreviated
- The overall structure needs to be improved, can have suitable paragraph lengths
- Please avoid lumps of citation and maintain an appropriate level of citation. Overcitation can be distracting and is unnecessary
- Many large sentences, kindly break them for better understanding
- Include a paragraph dealing with study limitations in the discussion section.
Conclusion
- Suggest to include future research studies and implications of this study to society
- There is no conclusion on difference of Summer and Winter samples?
Author Response
Manuscript ID: sustainability-1378594
Title: Metagenomic and Resistome Analysis of Wastewater Treatment Plant in Egypt
Authors: Osama S Ali, Walaa G Hozayen, Abdulwahab S Almutairi, Sherif Edris, Aala
A Abulfaraj *, Amged A Ouf, Hamada M. Mahmoud
The detailed responses to reviewers’ comments
Reviewer 2:
Reviewer Comments:
General comment:
This paper is regarding the metagenomic analysis conducted on the environmental samples collected from three treatment locations in Egypt. In this paper, the authors claimed that 67% of the ARGs detected in the influent persisted in the treated effluent and activated sludge; however, the total removal efficiency of ARGs in the WWTP was 97%. However, the writing and presentation of data are not of publication quality. There is some clarification needed to understand the processes carried out in this work. To conclude, this paper is still lacking assurance, and more structured content is needed to improve this manuscript. Hope below comments will be able to help to further improve the paper
- Point 1: please make sure that the paper is checked by a native English speakers, the language needs improvement.
- Response 1: Done
- Point 2: Please check Guides for Authors to make sure it is followed
- Response 2: Done
- Point 3: Whether there are too many figures in the manuscript, in order to reduce the published pages, several figures can be put into supplementary materials.
- Response 3: We reallocate some figures and tables into supplementary
- Point 4: The naming of samples is quite confusing
- Response 4: We explain it in more detail at the beginning of materials and methods to make it easy to follow
Abstract:
- Point 5: Needs major revision prior to the amendment of the main content.
- Response 5: We made deep modifications to it to be clear and informative
Abstract: Wastewater treatment plants (WWTPs) are recognized as hotspots for the dissemination of antibiotic resistance genes (ARGs) and antibiotic-resistant bacteria (ARBs) in the environment. Our study applied a high-throughput sequencing-based metagenomic analysis approach to examine the abundance profiles and removal efficiency of ARGs as well as, the microbial compositions in the raw sewage, treated effluent, and activated sludge samples of a full-scale WWTP in Egypt. As a result, 578 ARG subtypes (resistance genes) belonging to 18 ARG types (antibiotic resistance classes) were identified. ARGs encode for resistance against multidrug, aminoglycoside, bacitracin, beta-lactam, sulfonamide, and tetracycline antibiotics were the most abundant types. Furthermore, the total removal efficiency percentage of ARGs in the WWTP was around 97%; however, 67% of the ARGs in the influent were present in the treated effluent in lower abundances. This finding suggests that the persistent ARGs in the treated wastewater pose a potential threat to human health in case of disseminating into pathogenic bacteria reside in the receiving water bodies. Profiles of bacteria at the phylum level showed that Proteobacteria, Bacteroidetes, Firmicutes, and Actinobacteria were the most abundant phyla in all datasets. Although the relative abundance of several pathogenic bacteria in the influent declined to less than 1% in the effluent and sludge, the taxonomic assignments at the species level of the effluent and sludge included some human pathogens. Overall, the results of this study would hopefully enhance our knowledge about the abundance profiles of ARGs and their fate inside different wastewater treatment compartments that have never been examined before.
- Point 6: An abstract is often presented separately from the article, so it must be able to stand alone. Hence the problem statement, aim, novelty, and results of the study have all been included.
- Response 6: Covered in Response 5
- Point 7: Keywords must be different from the title to enhance searchability and findability. Select words that describe the highlight/novelty of the research.
- Response 7: Enhanced
Keywords: Shotgun sequencing analysis, Antibiotic resistance genes (ARGs), Antibiotic-resistant bacteria (ARBs), Resistome analysis, Wastewater microbiome, Wastewater treatment plant, and horizontal gene transfer (HGT).
Introduction:
- Point 8: State the objectives of the work and provide an adequate background, avoiding a detailed literature survey or a summary of the results.
- Response 8: Done
- Point 9: The last paragraph of the introduction section is very critical. A comprehensive explanation of how this work differs from the existing work should be explained and emphasized in the introduction.
- Response 9: enhanced as “The present study provides a valuable source for publicly available metagenomic datasets of a previously unexplored geographic area for future analysis approaches worldwide”.
Section 2. Materials & methods
- Point 10: What is the sampling method?
- Response 10: Manual grab sampling method
- Point 11: 2017? Quite old
- Response 11: it takes a little bet long time due to international pandemic and data analysis
- Point 12: Please use SI units and SI-compliant symbols for widely used non-SI units. Make sure to leave a space between every value and its symbol for the measurement unit.
- Response 12: Done
Results and discussion:
- Point 13: Scientific name must be italic and after the first mention can be abbreviated
- Response 13: Done
- Point 14: The overall structure needs to be improved, can have suitable paragraph lengths
- Response 14: Enhanced
- Point 15: Please avoid lumps of citation and maintain an appropriate level of citation. Overcitation can be distracting and is unnecessary
- Response 15: Noted and enhanced
- Point 16: Many large sentences, kindly break them for better understanding
- Response 16: Noted and enhanced
- Point 17: Include a paragraph dealing with study limitations in the discussion section.
- Response 17: in fact, there are some technical limitations due to limited recourses in computational analysis and dealing with large data, moreover a number of samples was challenging in statistical analysis
Conclusion
- Point 18: Suggest including future research studies and implications of this study to society
- Response 18: previously showed in the introduction (last sentence) as “The present study provides a valuable source for publicly available metagenomic datasets of a previously unexplored geographic area for future analysis approaches worldwide”.
- Point 19: There is no conclusion on the difference between Summer and Winter samples?
- Response 18: We add this sentence to the conclusion to address the difference of Summer and Winter samples “The abundance ratios of some ARG subtypes within the influent samples showed seasonal variations between summer and winter” and described in detail and result's part
Reviewer 3 Report
Paper titled “Metagenomic and Resistance Analysis of wastewater treatment Plant in Egypt” is a interesting and will help to to remove waste from wastewater. However before publication it needs some improvement.
Here I am writing some comments for improving.
- Abstract Line 3. (ARBS) in the environment worldwide… please remove the word environment or worldwide or either re-arrange the sentence.
- Abstract: In the current study? Please replace this word. You may write In this study.
- Abstract: Analysis was conducted on the environemtal samples collected from three treatment locations. What do you mean environmental samples? Water? Air? Solid? Please write chose some accurate wordings. And also re-arrange the complete sentence.
- Introduction line 3. Health problem worldwide in the current century? What do you mean current century? Please confirm like since last 2 decades or 4 decades etc.
- Introduction line 6. Middle icome countries that lack good sanitation system and… please select some suitable wordings instead of “that lack” and if possible re arrange the sentence.
- Please read it carefully and remove some grammatical mistkes from whole manuscript and I am accepting your paper with minor revision.
Author Response
the review report on antimicrobial resistance published by the UK government in collaboration with Wellcome Trust in May 2016 indicated that the rates of infectious diseases increased in low and middle-income countries with inefficient sanitation systems and safe water sources
Round 2
Reviewer 2 Report
The authors have adequately addressed all of the comments. The manuscript can be accepted for publication
