Antibiotic Resistance of Escherichia coli Isolated from Processing of Brewery Waste with the Addition of Bulking Agents
Abstract
:1. Introduction
2. Material and Methods
2.1. Preparation of the Substrate
- HT 100% treatment, air-flow rate: 10 dm3∙min−1;
- HT 100% treatment, air-flow rate: 5 dm3∙min−1;
- UFMSW 70 wt% + HT 30 wt%, air-flow rate: 10 dm3∙min−1;
- UFMSW 70 wt% + HT 30 wt%, air-flow rate: 5 dm3∙min−1;
- RDF 70 wt% + HT 30 wt%, air-flow rate: 10 dm3∙min−1;
- RDF 70 wt% + HT 30 wt%, air-flow rate: 5 dm3∙min−1.
2.2. Isolation and Identification of E. coli
2.3. Drug Resistance and ESBL Detection
2.4. DNA Extraction and Detection of ESBL-Determining Genes
3. Results and Discussion
3.1. E. coli Drug Resistance Profile
3.2. ESBL-Determining Genes
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Oladokun, O.; James, S.; Cowley, T.; Smart, K.; Hort, J.; Cook, D. Dry-hopping: The effects of temperature and hop variety on the bittering profiles and properties of resultant beers. Brew Sci. 2017, 70, 187–196. [Google Scholar] [CrossRef]
- Wolny-Koładka, K.; Mateusz, M.; Zdaniewicz, M. Energy and microbiological evaluation of the effects of adding bulking agents on biodrying of brewery hot trub. Food Bioprod Process 2021, in press. [Google Scholar] [CrossRef]
- Wolny-Koładka, K.; Lenart-Boroń, A. Antimicrobial resistance and the presence of extended-spectrum-beta-lactamase genes in Escherichia coli isolated from the environment of horse riding centers. Environ. Sci. Pollut. Res. 2018, 25, 21789–21800. [Google Scholar] [CrossRef] [PubMed]
- Scott, W.J. Antimicrobial resistance in companion animals. Anim. Health Res. Rev. 2008, 9, 169–176. [Google Scholar] [CrossRef] [PubMed]
- Malinowski, M.; Wolny-Koładka, K. Microbiological and energetic assessment of the effects of the biodrying of fuel produced from waste. Ecol. Chem. Eng. S 2017, 24, 551–564. [Google Scholar] [CrossRef] [Green Version]
- Wolny-Koładka, K.; Malinowski, M.; Żukowski, W. Impact of calcium oxide on hygienization and self-heating prevention of biologically contaminated polymer materials. Materials 2020, 13, 4012. [Google Scholar] [CrossRef]
- Paulshus, E.; Kühn, I.; Möllby, R.; Colque, P.; O’Sullivan, K.; Midtvedt, T.; Lingaas, E.; Holmstad, R.; Sørum, H. Diversity and antibiotic resistance among Escherichia coli populations in hospital and community wastewater compared to wastewater at the receiving urban treatment plant. Water Res. 2019, 161, 232–241. [Google Scholar] [CrossRef]
- Threedeach, S.; Chiemchaisri, W.; Watanabe, T.; Chiemchaisri, C.; Honda, R.; Yamamoto, K. Antibiotic resistance of Escherichia coli in leachates from municipal solid waste landfills: Comparison between semi-aerobic and anaerobic operations. Bioresour. Technol. 2012, 113, 253–258. [Google Scholar] [CrossRef] [PubMed]
- Watkinson, A.J.; Micalizzi, G.B.; Graham, G.M.; Bates, J.B.; Costanzo, S.D. Antibiotic-resistant Escherichia coli in wastewaters, surface waters, and oysters from an urban riverine system. Appl. Environ. Microbiol. 2007, 73, 5667–5670. [Google Scholar] [CrossRef] [Green Version]
- Zarfel, G.; Galler, H.; Feierl, G.; Haas, D.; Kittinger, C.; Leitner, E.; Grisold, A.J.; Mascher, F.; Posch, J.; Pertschy, B.; et al. Comparison of extended-spectrum-β-lactamase (ESBL) carrying Escherichia coli from sewage sludge and human urinary tract infection. Environ. Pollut. 2013, 173, 192–199. [Google Scholar] [CrossRef]
- Ahmed, M.O.; Clegg, P.D.; Williams, N.J.; Baptiste, K.E.; Bennett, M. Antimicrobial resistance in equine faecal Escherichia coli isolates from North West England. Ann. Clin. Microbiol. Antimicrob. 2010, 7, 12. [Google Scholar] [CrossRef] [Green Version]
- Wellington, E.M.H.; Boxall, A.B.A.; Cross, P.; Feil, E.J.; Gaze, W.H. The role of the natural environment in the emergence of antibiotic resistance in Gram-negative bacteria. Lancet Infect Dis. 2013, 13, 155–165. [Google Scholar] [CrossRef]
- Picozzi, S.C.M.; Casellato, S.; Rossini, M.; Paola, G.; Tejada, M.; Costa, E.; Carmignani, L. Extended-spectrum beta-lactamasepositive Escherichia coli causing complicated upper urinary tract infection: Urologist should act in time. Urol. Ann. 2014, 6, 107–112. [Google Scholar] [CrossRef] [PubMed]
- Marcade, G.; Deschamps, C.; Boyd, A.; Gautier, V.; Picard, B.; Branger, C.; Denamur, E.; Arlet, G. Replicon typing of plasmids in Escherichia coli producing extended-spectrum β-lactamases. J. Antimicrob. Chemother. 2019, 63, 67–71. [Google Scholar] [CrossRef] [Green Version]
- Bohme, K.; Fernandez-No, I.C.; Barros-Velazquez, J.; Gallardo, J.M.; Calo-Mata, P.; Cañas, B. Species differentiation of seafood spoilage and pathogenic Gram-negative bacteria by MALDI-TOF mass fingerprinting. J. Proteome Res. 2010, 9, 3169–3183. [Google Scholar] [CrossRef] [PubMed]
- Croxatto, A.; Prod’hom, G.; Greub, G. Applications of MALDI-TOF mass spectrometry in clinical diagnostic microbiology. FEMS Microbiol. Rev. 2012, 36, 380–407. [Google Scholar] [CrossRef]
- Seng, P.; Rolain, J.M.; Fournier, P.E.; La Scola, B.; Drancourt, M.; Raoult, D. MALDI-TOF-mass spectrometry applications in clinical microbiology. Future Microbiol. 2010, 5, 1733–1754. [Google Scholar] [CrossRef]
- European Committee on Antimicrobial Susceptibility Testing Breakpoint Tables for Interpretation of MICs and Zone Diameters Version 11.0. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_11.0_Breakpoint_Tables.pdf (accessed on 1 January 2021).
- Kronvall, G.; Petersson, A.C.; Ljunggren, K.; Soltesz, V. Single-strain regression analysis for quality control of cephalotin-susceptibility testing and determination of interpretive breakpoints. Acta Pathol. Microbiol. Immunol. Scand B 1984, 92, 13–22. [Google Scholar] [CrossRef]
- Turnidge, J.D. Cefazolin and Enterobacteriaceae: Rationale for revised susceptibility testing breakpoints. Clin. Infect Dis. 2011, 52, 917–924. [Google Scholar] [CrossRef] [Green Version]
- Barry, A.L.; Jones, R.N.; Thornsberry, C. Evaluation of the cefonicid disk criteria, including disk quality control guidelines. J. Clin. Microbiol. 1983, 17, 232–239. [Google Scholar] [CrossRef] [Green Version]
- Sader, H.S.; Ferraro, M.J.; Reller, B.; Schreckenberger, P.C.; Swenson, J.M.; Jones, R.N. Reevaluation of clinical and laboratory standards institute disk diffusion breakpoints for tetracyclines for testing Enterobacteriaceae. J. Clin. Microbiol. 2007, 45, 1640–1643. [Google Scholar] [CrossRef] [Green Version]
- Drieux, L.; Brossier, F.; Sougakoff, W.; Jarlier, V. Phenotypic detection of extended-spectrum beta-lactamase production in Enterobacteriaceae: Review and bench guide. Clin. Microbiol. Infect. 2008, 14, 90–103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Costa, D.; Poeta, P.; Sáenz, Y.; Vinué, L.; Rojo-Bezares, B.; Jouini, A.; Zarazaga, M.; Rodrigues, J.; Torres, C. Detection of Escherichia coli harbouring extendedspectrum β-lactamases of the CTX-M, TEM and SHV classes in faecal samples of wild animals in Portugal. J. Antimicrob. Chemother. 2006, 58, 1311–1312. [Google Scholar] [CrossRef]
- Simarro, E.; Navarro, F.; Ruiz, J.; Miró, E.; Gómez, J.; Mirelis, B. Salmonella enterica serovar Virchow with CTXM-like β-lactamase in Spain. J. Clin. Microbiol. 2000, 38, 4676–4678. [Google Scholar] [CrossRef] [Green Version]
- Sáenz, Y.; Brinas, L.; Dominguez, E.; Ruiz, J.; Zarazaga, M.; Vila, J.; Torres, C. Mechanisms of resistance in multiple-antibiotic-resistant Escherichia coli strains of human, animal, and food origins. Antimicrob. Agents Chemother. 2004, 48, 3996–4001. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moges, F.; Endris, M.; Belyhun, Y.; Worku, W. Isolation and characterization of multiple drug resistance bacterial pathogens from waste water in hospital and non-hospital environments, Northwest Ethiopia. BMC Res. Notes 2014, 7, 215. [Google Scholar] [CrossRef]
- Odonkor, S.T.; Addo, K.K. Prevalence of Multidrug-Resistant Escherichia coli isolated from drinking water sources. Int. J. Microbiol. 2018, 2018, 7204013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maddox, T.W.; Clegg, P.D.; Diggle, P.J.; Wedley, A.L.; Dawson, S.; Pinchbeck, G.L.; Williams, N.J. Cross-sectional study of antimicrobial-resistant bacteria in horses. Part 1: Prevalence of antimicrobial-resistant Escherichia coli and methicillin-resistant Staphylococcus aureus. Equine Vet. J. 2012, 44, 289–296. [Google Scholar] [CrossRef]
- Adefisoye, M.A.; Okoh, A.I. Identification and antimicrobial resistance prevalence of pathogenic Escherichia coli strains from treated wastewater effluents in Eastern Cape, South Africa. Microbiologyopen 2016, 5, 143–151. [Google Scholar] [CrossRef] [Green Version]
- Bradford, P.A. Extended-spectrum b-lactamases in the twenty first century: Characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 2001, 14, 933–951. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baraniak, A. Molecular Epidemiology and Evolution of Enterobacteriaceae Strains Producing Extended Spectrum Blactamases (ESBL) in Poland. Ph.D. Dissertation, Faculty of Biology, Warsaw University, Warszawa, Poland, 2010. [Google Scholar]
- Brinas, L.; Zarazaga, M.; Saenz, Y.; Ruiz-Larrea, F.; Torres, C. Beta-lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob. Agents Chemother. 2002, 46, 3156–3163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanberger, H.; Arman, D.; Gill, H.; Jindrak, V.; Kalenic, S.; Kurcz, A.; Licker, M.; Naaber, P.; Scicluna, E.A.; Vanis, V.; et al. Surveillance of microbial resistance in European Intensive Care Units: A first report from the Care-ICU programme for improved infection control. Intensive Care Med. 2019, 35, 91–100. [Google Scholar] [CrossRef] [Green Version]
- Wolny-Koładka, K.; Lenart-Boroń, A. Phenotypic and molecular assessment of drug resistance profile and genetic diversity of waterborne Escherichia coli. Water Air Soil Pollut. 2016, 227, 146. [Google Scholar] [CrossRef] [Green Version]
- Gniadkowski, M.; Żabicka, D.; Hryniewicz, W. Recommendations for the Selection of Tests for Susceptibility of Bacteria to Antibiotics and Chemotherapeutics. Determination of the Susceptibility of Gramnegative Rods. 2009. Available online: www.korld.edu.pl (accessed on 2 December 2015).
Gene | 5′-3′ Sequence | Annealing Temperature (°C) | Product Length (bp) | Reference |
---|---|---|---|---|
blaCTXM-3 | F: GTTACAATGTGTGAGAAGCAG R: CCGTTTCCGCTATTACAAAC | 60 | 800 | [24] |
blaCTXM-9 | F: GTGACAAAGAGAGTGCAACGG R: ATGATTCTCGCCGCTGAAGCC | 54 | 860 | [25] |
blaOXA | F: ACACAATACATATCAACTTCGC R: AGTGTGTTTAGAATGGTGATC | 61 | 813 | [26] |
blaSHV | F: CACTCAAGGATGTATTGTG R: TTAGCGTTGCCAGTGCTCG | 52 | 885 | [26] |
blaTEM | F: ATTCTTGAAGACGAAAGGGC R: ACGCTCAGTGGAACGAAAAC | 60 | 1150 | [26] |
Antibiotic (Symbol, µg) | Limit Values (mm) | Number of Isolates n = 100 |
---|---|---|
Amikacin (AK, 30) | 18 [18] | 5 |
Amoxicillin / Clavulanic acid (AMC, 30) * | 19 [18] | 6 |
Ampicillin (AMP, 10) | 14 [18] | 23 |
Aztreonam (ATM, 30) | 26/21 [18] | 30 |
Cefamandole (MA, 30) | 18/14 [21] | 4 |
Cefepime (FEP, 30) | 27/24 [18] | 2 |
Cefotaxime (CTX, 30) * | 20/17 [18] | 5 |
Cefoxitin (FOX, 30) | 19 [18] | 8 |
Ceftazidime (CAZ, 30) * | 22/19 [18] | 21 |
Cefalotin (KF, 30) | 13 [19] | 10 |
Cefazolin (KZ, 30) | 23/19 [20] | 5 |
Ciprofloxacin (CIP, 5) | 25/22 [18] | 0 |
Gentamicin (CN, 10) | 17 [18] | 7 |
Netilmicin (NET, 30) | 15/12 [18] | 6 |
Piperacillin (PRL, 100) | 20/17 [18] | 6 |
Piperacillin/Tazobactam (TZP, 110) | 20/17 [18] | 0 |
Tetracycline (TE, 30) | 15/11 [22] | 25 |
Ticarcillin (TIC, 75) | 23/20 [18] | 22 |
Tobramycin (TOB, 10) | 16 [18] | 8 |
Trimethoprim/Sulfamethoxazole (SXT, 25) | 14/11 [18] | 11 |
ESBL | - | 14 |
blaTEM | - | 64 |
blaCTXM-3 | - | 25 |
blaCTXM-9 | - | 23 |
Isolate No. | Antibiotic Resistances | ESBL Genes |
---|---|---|
1. | AMC, AMP, ATM, CTX, FOX, CAZ, KZ, TIC, SXT | blaTEM, blaCTXM-3, blaCTXM-9 |
2. | KF, SXT | blaTEM, blaCTXM-3, blaCTXM-9 |
3. | CAZ, TIC | |
4. | AMP, ATM, KZ, CN, TIC | blaTEM, blaCTXM-3 |
5. | CTX, CAZ, TIC, SXT | blaTEM, blaCTXM-3 |
6. | AMC, AMP, ATM, KZ, TE, TIC | blaTEM, blaCTXM-9 |
7. | KF | blaTEM, blaCTXM-3 |
8. | KZ, TIC | |
9. | CN | |
10. | AMP, ATM, TE, TIC | blaTEM, blaCTXM-3, blaCTXM-9 |
11. | KZ | blaTEM, blaCTXM-9 |
12. | CAZ | |
13. | CN | |
14. | KF | blaTEM, blaCTXM-3 |
15. | AMP, ATM | blaTEM |
16. | blaTEM, blaCTXM-3 | |
17. | CAZ, KF, TIC | blaTEM |
18. | TOB | blaTEM, blaCTXM-3 |
19. | AMP | |
20. | AMP, ATM, TIC | blaTEM |
21. | ATM, SXT | blaTEM |
22. | TE, TIC | blaTEM, blaCTXM-3 |
23. | CAZ, TE | blaTEM |
24. | AMC, AMP, ATM, MA, CTX, FOX, TE, TIC | blaTEM |
25. | TE | blaTEM |
26. | ATM, FOX, TE, TIC | blaTEM, blaCTXM-3 |
27. | KF | |
28. | TE | blaTEM |
29. | AMP, ATM | blaTEM |
30. | AMP | |
31. | AMP, ATM | |
32. | MA | blaTEM, blaCTXM-9 |
33. | KF | blaTEM |
34. | CTX | |
35. | AMP, ATM, FOX, TE | blaTEM, blaCTXM-3 |
36. | MA | blaTEM |
37. | AMP, ATM, TE | blaTEM, blaCTXM-3, blaCTXM-9 |
38. | CAZ | blaTEM |
39. | ATM | blaTEM, blaCTXM-9 |
40. | ATM | |
41. | NET | blaTEM |
42. | AMP, ATM | blaTEM, blaCTXM-3, blaCTXM-9 |
43. | TE | blaTEM |
44. | AM, ATM, CTX, FOX, KF, NET, TE, TIC, TOB, SXT | blaTEM, blaCTXM-3 |
45. | blaTEM, blaCTXM-9 | |
46. | FEP | |
47. | SXT | blaTEM |
48. | ATM | |
49. | ATM, CAZ, TE, TIC, TOB | blaTEM, blaCTXM-9 |
50. | ||
51. | PRL, SXT | blaTEM, blaCTXM-9 |
52. | AMP, TIC | |
53. | CN, TE, TOB | blaTEM, blaCTXM-3 |
54. | ATM | |
55. | AMC, CAZ, KF, NET, TE, TIC | blaTEM, blaCTXM-9 |
56. | TE | |
57. | PRL | |
58. | ATM, CAZ | blaTEM, blaCTXM-9 |
59. | CAZ | |
60. | CN | blaTEM, blaCTXM-9 |
61. | AMP, TE, TIC | blaTEM, blaCTXM-9 |
62. | CAZ | |
63. | ATM | blaTEM |
64. | ||
65. | CAZ | blaTEM, blaCTXM-3 |
66. | AMP, TIC, TOB | |
67. | blaTEM | |
68. | CN, TOB | blaTEM |
69. | ||
70. | AMC, AMP, NET, TE, TIC | blaTEM, blaCTXM-3 |
71. | ||
72. | CAZ | |
73. | ATM | |
74. | ATM, CAZ, TE | |
75. | ATM | |
76. | blaTEM, blaCTXM-3 | |
77. | ATM | blaTEM, blaCTXM-3 |
78. | PRL, TE | |
79. | TE | |
80. | AMP, ATM, TIC, SXT | blaTEM |
81. | TE | |
82. | blaTEM | |
83. | KF, SXT | blaTEM, blaCTXM-3, blaCTXM-9 |
84. | blaTEM | |
85. | PRL, TOB | blaTEM, blaCTXM-9 |
86. | AMP, ATM, CAZ, KF, CN, TIC | blaTEM |
87. | NET, PRL | blaTEM, blaCTXM-3 |
88. | TIC | |
89. | CAZ, SXT | blaTEM |
90. | blaTEM, blaCTXM-9 | |
91. | AMP, ATM, FOX, CAZ, PRL, TOB | blaTEM, blaCTXM-9 |
92. | TE | blaTEM, blaCTXM-3 |
93. | TE | blaTEM, blaCTXM-3, blaCTXM-9 |
94. | ATM, FOX, CAZ | blaTEM, blaCTXM-3, blaCTXM-9 |
95. | FEP | |
96. | TE | blaTEM |
97. | AMP, CAZ | |
98. | NET | blaTEM, blaCTXM-9 |
99. | MA, CAZ | |
100. | AMP, FOX, SXT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wolny-Koładka, K.; Zdaniewicz, M. Antibiotic Resistance of Escherichia coli Isolated from Processing of Brewery Waste with the Addition of Bulking Agents. Sustainability 2021, 13, 10174. https://doi.org/10.3390/su131810174
Wolny-Koładka K, Zdaniewicz M. Antibiotic Resistance of Escherichia coli Isolated from Processing of Brewery Waste with the Addition of Bulking Agents. Sustainability. 2021; 13(18):10174. https://doi.org/10.3390/su131810174
Chicago/Turabian StyleWolny-Koładka, Katarzyna, and Marek Zdaniewicz. 2021. "Antibiotic Resistance of Escherichia coli Isolated from Processing of Brewery Waste with the Addition of Bulking Agents" Sustainability 13, no. 18: 10174. https://doi.org/10.3390/su131810174
APA StyleWolny-Koładka, K., & Zdaniewicz, M. (2021). Antibiotic Resistance of Escherichia coli Isolated from Processing of Brewery Waste with the Addition of Bulking Agents. Sustainability, 13(18), 10174. https://doi.org/10.3390/su131810174