Low Concentrations of Sulfoxaflor Do Not Adversely Affect mRNA Levels in Various Testicular Cells When Administered to Either Mature or Immature Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Dose Selection
2.3. Intake of Chemicals
2.4. Experimental Design
2.5. Histochemistry
2.6. Supercritical Fluid—Mass Spectrometry (SFC-MS/MS)
2.7. Real-Time Reverse Transcription Polymerase Chain Reaction (RT-PCR)
2.8. Statistical Analysis
3. Results
3.1. Physical Data of Mice in 4 and 8 Weeks After Treatment with Sulfoxaflor
3.2. Histochemical Observation
3.3. Average Sulfoxaflor Intake and Average Content of Sulfoxaflor in the Serum and Testis
3.4. Effects of Sulfoxaflor on the Testis and Pituitary mRNA
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| nAChRs | Nicotinic acetylcholine receptors |
| NOAEL | Non-Observed Adverse Effect Level |
| LOAEL | Low observable adverse effect level |
| SFCMS/MS | Supercritical fluid—Mass Spectrometry |
| Star | Steroidogenic acute regulatory protein |
| P450scc | Choleserol side-chain cleavage cytochrome P450 |
| P450c17 | 17 α-hydoroxylase/17, 20 lyase |
| 3β-HSD | 3β-Hydroxysteroid dehydrogenase |
| 17-HSD | 17β-Hydroxysteroid dehydrogenase |
| LHR | Luteinizing hormone receptor |
| FSHR | Follicle-stimulating hormone receptor |
| InhA | Inhibin-A |
| Shbg | Sex hormone-binding globulin |
| Top2a | Topoisomerase 2-alpha |
| Sycp3 | Synaptonemal complex protein 3 |
| Mlh1 | MutL homolog 1 |
| Acr | Acrosin |
| Tnp1 | Transition protein 1 |
| FasL | Fas ligand |
| GPx | Glutathione peroxidase |
| CAT | Catalase |
| SOD | Superoxide dismutase |
| Trx1 | Thioredoxin 1 |
| TXNIP | Thioredoxin-interacting protein |
| Nrf | Nuclear factor E2-related factor |
| OGG1 | 8-oxoguanine DNA glycosylase 1 |
| ABCD | Adrenoleukodystrophy protein belongs to the sub-family D |
| GRP78 | Glucose-regulated protein, 78kDa |
| PGC-1 | Peroxisome proliferators-activated receptor-γ co-activator-1α |
| Tfam | Mitochondrial transcription factor A |
| Drp1 | Dynamin-related protein 1 |
| Fis1 | Mitochondrial fission 1 protein |
| Mfn1 | Mitofusin 1 |
| Opa1 | Optic atrophy protein 1 |
| LH | Luteinizing hormone |
| FSH | Follicle stimulating hormone |
| IL | interleukin |
References
- Iwafune, T.; Inao, K.; Horio, T.; Iwasaki, N.; Yokoyama, A.; Nagai, T. Behavior of paddy pesticides and major metabolites in the Sakura River, Ibaraki, Japan. J. Pestic. Sci. 2010, 35, 114–123. [Google Scholar] [CrossRef][Green Version]
- Terayama, H.; Sakabe, K.; Kiyoshima, D.; Qu, N.; Sato, T.; Suyama, K.; Hayashi, S.; Sakurai, K.; Todaka, E.; Mori, C. Effect of Neonicotinoid Pesticides on Japanese Water Systems: Review with Focus on Reproductive Toxicity. Int. J. Mol. Sci. 2022, 23, 11567. [Google Scholar] [CrossRef]
- Gill, R.J.; Ramos-Rodriguez, O.; Raine, N.E. Combined pesticide exposure severely affects individual- and colony-level traits in bees. Nature 2012, 491, 105–108. [Google Scholar] [CrossRef] [PubMed]
- Whitehorn, P.R.; O’Connor, S.; Wackers, F.L.; Goulson, D. Neonicotinoid pesticide reduces bumble bee colony growth and queen production. Science 2012, 336, 351–352. [Google Scholar] [CrossRef] [PubMed]
- Taira, K. Health effects of neonicotinoid insecticides-Part 1: Physicochemical characteristics and case reports. Jpn. J. Clin. Ecol. 2012, 21, 24–34. [Google Scholar]
- Kimura-Kuroda, J.; Nishito, Y.; Yanagisawa, H.; Kuroda, Y.; Komuta, Y.; Kawano, H.; Hayashi, M. Neonicotinoid Insecticides Alter the Gene Expression Profile of Neuron-Enriched Cultures from Neonatal Rat Cerebellum. Int. J. Environ. Res. Public Health 2016, 13, 987. [Google Scholar] [CrossRef] [PubMed]
- Kimura-Kuroda, J.; Komuta, Y.; Kuroda, Y.; Hayashi, M.; Kawano, H. Nicotine-like effects of the neonicotinoid insecticides acetamiprid and imidacloprid on cerebellar neurons from neonatal rats. PLoS ONE 2012, 7, e32432. [Google Scholar] [CrossRef]
- Terayama, H.; Qu, N.; Endo, H.; Ito, M.; Tsukamoto, H.; Umemoto, K.; Kawakami, S.; Fujino, Y.; Tatemichi, M.; Sakabe, K. Effect of acetamiprid on the immature murine testes. Int. J. Environ. Health Res. 2018, 28, 683–696. [Google Scholar] [CrossRef]
- Terayama, H.; Endo, H.; Tsukamoto, H.; Matsumoto, K.; Umezu, M.; Kanazawa, T.; Ito, M.; Sato, T.; Naito, M.; Kawakami, S.; et al. Acetamiprid Accumulates in Different Amounts in Murine Brain Regions. Int. J. Environ. Res. Public Health 2016, 13, 937. [Google Scholar] [CrossRef]
- Ministry of Agriculture, Forestry and Fisheries. Review Report: Sulfoxaflor (In Japanese). Available online: https://www.maff.go.jp/j/nouyaku/n_sinsa/attach/pdf/index-24.pdf (accessed on 27 October 2025).
- National Institute for Environmental Studies. Sulfoxaflor. Webkis-Plus (In Japanese). Available online: https://www.nies.go.jp/kisplus/dtl/chem/NOU01441 (accessed on 27 October 2025).
- Sparks, T.C. Insecticide discovery: An evaluation and analysis. Pestic. Biochem. Physiol. 2013, 107, 8–17. [Google Scholar] [CrossRef]
- Giorio, C.; Safer, A.; Sanchez-Bayo, F.; Tapparo, A.; Lentola, A.; Girolami, V.; van Lexmond, M.B.; Bonmatin, J.M. An update of the Worldwide Integrated Assessment (WIA) on systemic insecticides. Part 1: New molecules, metabolism, fate, and transport. Environ. Sci. Pollut. Res. Int. 2021, 28, 11716–11748. [Google Scholar] [CrossRef] [PubMed]
- Sparks, T.C.; Crossthwaite, A.J.; Nauen, R.; Banba, S.; Cordova, D.; Earley, F.; Ebbinghaus-Kintscher, U.; Fujioka, S.; Hirao, A.; Karmon, D.; et al. Insecticides, biologics and nematicides: Updates to IRAC’s mode of action classification—A tool for resistance management. Pestic. Biochem. Physiol. 2020, 167, 104587. [Google Scholar] [CrossRef]
- Tijani, A.S.; Daba, T.M.; Ubong, I.A.; Olufunke, O.; Ani, E.J.; Farombi, E.O. Co-administration of thymol and sulfoxaflor impedes the expression of reproductive toxicity in male rats. Drug Chem. Toxicol. 2024, 47, 618–632. [Google Scholar] [CrossRef]
- Said, N.I.; Abd-Elrazek, A.M.; El-Dash, H.A. The protective role of resveratrol against sulfoxaflor-induced toxicity in testis of adult male rats. Environ. Toxicol. 2021, 36, 2105–2115. [Google Scholar] [CrossRef]
- Mohamed, W.H.; Ali, M.F.; Yahia, D.; Hussein, H.A. Reproductive effects of sulfoxaflor in male Sprague Dawley rats. Environ. Sci. Pollut. Res. Int. 2022, 29, 45751–45762. [Google Scholar] [CrossRef] [PubMed]
- Ge, R.S.; Dong, Q.; Sottas, C.M.; Chen, H.; Zirkin, B.R.; Hardy, M.P. Gene expression in rat leydig cells during development from the progenitor to adult stage: A cluster analysis. Biol. Reprod. 2005, 72, 1405–1415. [Google Scholar] [CrossRef] [PubMed]
- Schirmer, S.U.; Eckhardt, I.; Lau, H.; Klein, J.; DeGraaf, Y.C.; Lips, K.S.; Pineau, C.; Gibbins, I.L.; Kummer, W.; Meinhardt, A.; et al. The cholinergic system in rat testis is of non-neuronal origin. Reproduction 2011, 142, 157–166. [Google Scholar] [CrossRef]
- Kumar, P.; Meizel, S. Nicotinic acetylcholine receptor subunits and associated proteins in human sperm. J. Biol. Chem. 2005, 280, 25928–25935. [Google Scholar] [CrossRef]
- Abdel-Rahman Mohamed, A.; Mohamed, W.A.M.; Khater, S.I. Imidacloprid induces various toxicological effects related to the expression of 3beta-HSD, NR5A1, and OGG1 genes in mature and immature rats. Environ. Pollut. 2017, 221, 15–25. [Google Scholar] [CrossRef]
- Yanai, S.; Hirano, T.; Omotehara, T.; Takada, T.; Yoneda, N.; Kubota, N.; Yamamoto, A.; Mantani, Y.; Yokoyama, T.; Kitagawa, H.; et al. Prenatal and early postnatal NOAEL-dose clothianidin exposure leads to a reduction of germ cells in juvenile male mice. J. Vet Med. Sci. 2017, 79, 1196–1203. [Google Scholar] [CrossRef]
- Food Safety Commission of Japan. Sulfoxaflor (In Japanese). Available online: https://www.fsc.go.jp/fsciis/evaluationDocument/show/kya20210630144 (accessed on 27 October 2025).
- CLEA Japan, Inc. CE-2 (In Japanese). Available online: https://www.clea-japan.com/en/products/general_diet/item_d0030 (accessed on 27 October 2025).
- Tada, Y.; Yano, N.; Takahashi, H.; Yuzawa, K.; Ando, H.; Kubo, Y.; Nagasawa, A.; Ogata, A.; Nakae, D.; Uehara, S. Considerations on Hepatic Fatty Changes in Control ICR Mice. Annu. Rep. Tokyo Metrop. Inst. Public Health 2007, 58. [Google Scholar]
- Matsumura, T.; Katagiri, K.; Yao, T.; Ishikawa-Yamauchi, Y.; Nagata, S.; Hashimoto, K.; Sato, T.; Kimura, H.; Shinohara, T.; Sanbo, M.; et al. Generation of rat offspring using spermatids produced through in vitro spermatogenesis. Sci. Rep. 2023, 13, 12105. [Google Scholar] [CrossRef]
- Miyano, Y.; Tahara, S.; Sakata, I.; Sakai, T.; Abe, H.; Kimura, S.; Kurotani, R. Regulation of LH/FSH expression by secretoglobin 3A2 in the mouse pituitary gland. Cell Tissue Res. 2014, 356, 253–260. [Google Scholar] [CrossRef] [PubMed]
- Odet, F.; Verot, A.; Le Magueresse-Battistoni, B. The mouse testis is the source of various serine proteases and serine proteinase inhibitors (SERPINs): Serine proteases and SERPINs identified in Leydig cells are under gonadotropin regulation. Endocrinology 2006, 147, 4374–4383. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Yang, Y.; Yang, T.; Liu, S.; Cao, Z.; Zhao, Y.; Su, X.; Liao, Z.; Teng, X.; Hua, J. Concentrated ambient PM(2.5) exposure affects mice sperm quality and testosterone biosynthesis. PeerJ 2019, 7, e8109. [Google Scholar] [CrossRef]
- Kakuta, H.; Iguchi, T.; Sato, T. The Involvement of Granulosa Cells in the Regulation by Gonadotropins of Cyp17a1 in Theca Cells. In Vivo 2018, 32, 1387–1401. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.F.; Zhang, T.; Wang, L.; Zhang, H.Y.; Chen, Y.D.; Qin, X.S.; Feng, Y.M.; Feng, Y.N.; Shen, W.; Li, L. Effects of diethylhexyl phthalate (DEHP) given neonatally on spermatogenesis of mice. Mol. Biol. Rep. 2013, 40, 6509–6517. [Google Scholar] [CrossRef]
- Cai, K.; Hua, G.; Ahmad, S.; Liang, A.; Han, L.; Wu, C.; Yang, F.; Yang, L. Action mechanism of inhibin alpha-subunit on the development of Sertoli cells and first wave of spermatogenesis in mice. PLoS ONE 2011, 6, e25585. [Google Scholar] [CrossRef]
- Jeyaraj, D.A.; Grossman, G.; Petrusz, P. Altered bioavailability of testosterone in androgen-binding protein-transgenic mice. Steroids 2005, 70, 704–714. [Google Scholar] [CrossRef]
- Xu, J.; Fang, J.; Cheng, Z.; Fan, L.; Hu, W.; Zhou, F.; Shen, H. Overexpression of the Kininogen-1 inhibits proliferation and induces apoptosis of glioma cells. J. Exp. Clin. Cancer Res. 2018, 37, 180. [Google Scholar] [CrossRef]
- Qin, S.; Huang, X.; Wang, D.; Hu, X.; Yuan, Y.; Sun, X.; Tan, Z.; Gu, Y.; Cheng, X.; He, C.; et al. Identification of characteristic genes distinguishing neural stem cells from astrocytes. Gene 2019, 681, 26–35. [Google Scholar] [CrossRef] [PubMed]
- Majidi Gharenaz, N.; Movahedin, M.; Mazaheri, Z. Three-Dimensional Culture of Mouse Spermatogonial Stem Cells Using A Decellularised Testicular Scaffold. Cell J. 2020, 21, 410–418. [Google Scholar] [CrossRef]
- Hu, M.; Lou, Y.; Liu, S.; Mao, Y.; Le, F.; Wang, L.; Li, L.; Wang, Q.; Li, H.; Lou, H.; et al. Altered expression of DNA damage repair genes in the brain tissue of mice conceived by in vitro fertilization. Mol. Hum. Reprod. 2020, 26, 141–153. [Google Scholar] [CrossRef]
- Ibtisham, F.; Zhao, Y.; Nawab, A.; Wu, J.; Mei, X.; Honaramooz, A.; An, L. In vitro production of haploid germ cells from murine spermatogonial stem cells using a two-dimensional cell culture system. Theriogenology 2021, 162, 84–94. [Google Scholar] [CrossRef] [PubMed]
- Bai, S.; Fu, K.; Yin, H.; Cui, Y.; Yue, Q.; Li, W.; Cheng, L.; Tan, H.; Liu, X.; Guo, Y.; et al. Sox30 initiates transcription of haploid genes during late meiosis and spermiogenesis in mouse testes. Development 2018, 145, dev164855. [Google Scholar] [CrossRef]
- Bien, K.; Zmigrodzka, M.; Orlowski, P.; Fruba, A.; Szymanski, L.; Stankiewicz, W.; Nowak, Z.; Malewski, T.; Krzyzowska, M. Involvement of Fas/FasL pathway in the murine model of atopic dermatitis. Inflamm. Res. 2017, 66, 679–690. [Google Scholar] [CrossRef]
- Vahdat-Lasemi, M.; Hosseini, S.; Jajarmi, V.; Kazemi, B.; Salehi, M. Intraovarian injection of miR-224 as a marker of polycystic ovarian syndrome declines oocyte competency and embryo development. J. Cell Physiol. 2019, 234, 13858–13866. [Google Scholar] [CrossRef]
- Zhang, J.W.; Xu, D.Q.; Feng, X.Z. The toxic effects and possible mechanisms of glyphosate on mouse oocytes. Chemosphere 2019, 237, 124435. [Google Scholar] [CrossRef]
- Lim, J.Y.; Lee, J.H.; Yun, D.H.; Lee, Y.M.; Kim, D.K. Inhibitory effects of nodakenin on inflammation and cell death in lipopolysaccharide-induced liver injury mice. Phytomedicine 2021, 81, 153411. [Google Scholar] [CrossRef]
- Nie, X.; Dai, Y.; Zheng, Y.; Bao, D.; Chen, Q.; Yin, Y.; Fu, H.; Hou, D. Establishment of a Mouse Model of Premature Ovarian Failure Using Consecutive Superovulation. Cell Physiol. Biochem. 2018, 51, 2341–2358. [Google Scholar] [CrossRef] [PubMed]
- Abdelsaid, M.A.; Matragoon, S.; Ergul, A.; El-Remessy, A.B. Deletion of thioredoxin interacting protein (TXNIP) augments hyperoxia-induced vaso-obliteration in a mouse model of oxygen induced-retinopathy. PLoS ONE 2014, 9, e110388. [Google Scholar] [CrossRef]
- Zhang, Y.; Cui, Y.; Dai, S.; Deng, W.; Wang, H.; Qin, W.; Yang, H.; Liu, H.; Yue, J.; Wu, D.; et al. Isorhynchophylline enhances Nrf2 and inhibits MAPK pathway in cardiac hypertrophy. Naunyn. Schmiedebergs. Arch. Pharmacol. 2020, 393, 203–212. [Google Scholar] [CrossRef]
- Bigot, K.; Leemput, J.; Vacher, M.; Campalans, A.; Radicella, J.P.; Lacassagne, E.; Provost, A.; Masson, C.; Menasche, M.; Abitbol, M. Expression of 8-oxoguanine DNA glycosylase (Ogg1) in mouse retina. Mol. Vis. 2009, 15, 1139–1152. [Google Scholar]
- Xiao, Y.; Karnati, S.; Qian, G.; Nenicu, A.; Fan, W.; Tchatalbachev, S.; Holand, A.; Hossain, H.; Guillou, F.; Luers, G.H.; et al. Cre-mediated stress affects sirtuin expression levels, peroxisome biogenesis and metabolism, antioxidant and proinflammatory signaling pathways. PLoS ONE 2012, 7, e41097. [Google Scholar] [CrossRef]
- Hanchang, W.; Semprasert, N.; Limjindaporn, T.; Yenchitsomanus, P.T.; Kooptiwut, S. Testosterone protects against glucotoxicity-induced apoptosis of pancreatic beta-cells (INS-1) and male mouse pancreatic islets. Endocrinology 2013, 154, 4058–4067. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhang, M.; Dong, W.; Li, Z.; Xiao, Z.; Xie, Z.; Ye, Z.; Liu, S.; Li, R.; Chen, Y.; Zhang, L.; et al. Effect of forkhead box O1 in renal tubular epithelial cells on endotoxin-induced acute kidney injury. Am. J. Physiol. Renal. Physiol. 2021, 320, F262–F272. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Liu, Q.; Li, Y.; Tang, Q.; Wu, T.; Chen, L.; Pu, S.; Zhao, Y.; Zhang, G.; Huang, C.; et al. The diabetes medication canagliflozin promotes mitochondrial remodelling of adipocyte via the AMPK-Sirt1-Pgc-1alpha signalling pathway. Adipocyte 2020, 9, 484–494. [Google Scholar] [CrossRef]
- Kandimalla, R.; Manczak, M.; Fry, D.; Suneetha, Y.; Sesaki, H.; Reddy, P.H. Reduced dynamin-related protein 1 protects against phosphorylated Tau-induced mitochondrial dysfunction and synaptic damage in Alzheimer’s disease. Hum. Mol. Genet. 2016, 25, 4881–4897. [Google Scholar] [CrossRef] [PubMed]
- Nomura, H.; Terayama, H.; Kiyoshima, D.; Qu, N.; Shirose, K.; Tetsu, S.; Hayashi, S.; Sakabe, K.; Suzuki, T. Effects of Dexmedetomidine on the Localization of α2A-Adrenergic and Imidazoline Receptors in Mouse Testis. Appl. Sci. 2022, 12, 10409. [Google Scholar] [CrossRef]
- Fang, Y.; Lv, S.; Xiao, S.; Hou, H.; Yao, J.; Cao, Y.; He, B.; Liu, X.; Wang, P.; Liu, D.; et al. Enantioselective bioaccumulation and toxicological effects of chiral neonicotinoid sulfoxaflor in rats. Chemosphere 2024, 358, 142065. [Google Scholar] [CrossRef]
- Taira, K. Health effects of neonicotinoid insecticides-Part 2: Pharmacology [Application]. Regulation, and Discussion. Jpn. J. Clin. Ecol. 2012, 21, 35–45. [Google Scholar]
- Piner Benli, P.; Kaya, M.; Daglioglu, Y.K. Fucoidan Protects against Acute Sulfoxaflor-Induced Hematological/Biochemical Alterations and Oxidative Stress in Male Mice. Pharmaceuticals 2021, 15, 16. [Google Scholar] [CrossRef]
- Piner Benli, P.; Kaya, M.; Coskun, C. Fucoidan Modulated Oxidative Stress and Caspase-3 mRNA Expression Induced by Sulfoxaflor in the Brain of Mice. Neurotox. Res. 2021, 39, 1908–1919. [Google Scholar] [CrossRef]
- Ellis-Hutchings, R.G.; Rasoulpour, R.J.; Terry, C.; Carney, E.W.; Billington, R. Human relevance framework evaluation of a novel rat developmental toxicity mode of action induced by sulfoxaflor. Crit. Rev. Toxicol. 2014, 44 (Suppl. S2), 45–62. [Google Scholar] [CrossRef]
- Rasoulpour, R.J.; Ellis-Hutchings, R.G.; Terry, C.; Millar, N.S.; Zablotny, C.L.; Gibb, A.; Marshall, V.; Collins, T.; Carney, E.W.; Billington, R. A novel mode-of-action mediated by the fetal muscle nicotinic acetylcholine receptor resulting in developmental toxicity in rats. Toxicol. Sci. 2012, 127, 522–534. [Google Scholar] [CrossRef] [PubMed]
- LeBaron, M.J.; Gollapudi, B.B.; Terry, C.; Billington, R.; Rasoulpour, R.J. Human relevance framework for rodent liver tumors induced by the insecticide sulfoxaflor. Crit. Rev. Toxicol. 2014, 44 (Suppl. S2), 15–24. [Google Scholar] [CrossRef]
- Yuan, X.; Shen, J.; Zhang, X.; Tu, W.; Fu, Z.; Jin, Y. Imidacloprid disrupts the endocrine system by interacting with androgen receptor in male mice. Sci. Total Environ. 2020, 708, 135163. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Dick, R.A.; Ford, K.A.; Casida, J.E. Enzymes and inhibitors in neonicotinoid insecticide metabolism. J. Agric. Food Chem. 2009, 57, 4861–4866. [Google Scholar] [CrossRef] [PubMed]
- Martignoni, M.; Groothuis, G.M.; de Kanter, R. Species differences between mouse, rat, dog, monkey and human CYP-mediated drug metabolism, inhibition and induction. Expert Opin. Drug Metab. Toxicol. 2006, 2, 875–894. [Google Scholar] [CrossRef]
- Khidkhan, K.; Ikenaka, Y.; Ichise, T.; Nakayama, S.M.M.; Mizukawa, H.; Nomiyama, K.; Iwata, H.; Arizono, K.; Takahashi, K.; Kato, K.; et al. Interspecies differences in cytochrome P450-mediated metabolism of neonicotinoids among cats, dogs, rats, and humans. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2021, 239, 108898. [Google Scholar] [CrossRef]
- Swenson, T.L. Neonicotinoid Insecticide Metabolism and Mechanisms of Toxicity in Mammals. Ph.D. Thesis, UC Berkeley, Berkeley, CA, USA, 2013. [Google Scholar]
- Bal, R.; Naziroğlu, M.; Turk, G.; Yilmaz, O.; Kuloglu, T.; Etem, E.; Baydas, G. Insecticide imidacloprid induces morphological and DNA damage through oxidative toxicity on the reproductive organs of developing male rats. Cell Biochem. Funct. 2012, 30, 492–499. [Google Scholar] [CrossRef]
- Bal, R.; Turk, G.; Tuzcu, M.; Yilmaz, O.; Kuloglu, T.; Gundogdu, R.; Gur, S.; Agca, A.; Ulas, M.; Cambay, Z.; et al. Assessment of imidacloprid toxicity on reproductive organ system of adult male rats. J. Environ. Sci. Health B 2012, 47, 434–444. [Google Scholar] [CrossRef]
- Bal, R.; Turk, G.; Yilmaz, O.; Etem, E.; Kuloglu, T.; Baydas, G.; Naziroğlu, M. Effects of clothianidin exposure on sperm quality, testicular apoptosis and fatty acid composition in developing male rats. Cell Biol. Toxicol. 2012, 28, 187–200. [Google Scholar] [CrossRef]
- Bal, R.; Turk, G.; Tuzcu, M.; Yilmaz, O.; Kuloglu, T.; Baydas, G.; Naziroğlu, M.; Yener, Z.; Etem, E.; Tuzcu, Z. Effects of the neonicotinoid insecticide, clothianidin, on the reproductive organ system in adult male rats. Drug Chem. Toxicol. 2013, 36, 421–429. [Google Scholar] [CrossRef]
- Kong, D.; Zhang, J.; Hou, X.; Zhang, S.; Tan, J.; Chen, Y.; Yang, W.; Zeng, J.; Han, Y.; Liu, X.; et al. Acetamiprid inhibits testosterone synthesis by affecting the mitochondrial function and cytoplasmic adenosine triphosphate production in rat Leydig cells. Biol. Reprod. 2017, 96, 254–265. [Google Scholar] [CrossRef] [PubMed]











| Marker | Name | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Reference |
|---|---|---|---|---|
| Pituitary gland | LH | CTGAGCCCAAGTGTGGTGT | CACAGATGCTGGTGGTGAAG | [27] |
| FSH | AAGTC ATCCAGCTTTGCAT | TCCCTGGTGTAGCAGTAGCC | [27] | |
| Leydig cell | Star | GCATACTCAACAACCAGGAAGG | CTGGTTGATGATTGTCTTCGGC | [28] |
| P450scc | AGGTCCTTCAATGAGATCCCTT | TCCCTGTAAATGGGGCCATAC | [29] | |
| P450c17 | GATCGGTTTATGCCTGAGCG | TCCGAAGGGCAAATAACTGG | [30] | |
| 3βHSD | CCTCCGCCTTGATACCAGC | TTGTTTCCAATCTCCCTGTGC | [29] | |
| 17βHSD | ACTTGGCTGTTCGCCTAGC | GAGGGCATCCTTGAGTCCTG | [29] | |
| LHR | CCTTGTTCTCAAAAGAGATGTTGAA | TGACCAGAAACTGGAGAAGATGATA | [31] | |
| Sertoli cell | FSHR | ATTTTCTCCAGGTCCCCAAA | TCTCCTTGCTGGCATTCTTG | [31] |
| Inha | CTCGAAGACATGCCGTTGG | AGCT GGCTGGTCCTCACAG | [32] | |
| Shbg | GCC CTG AGA CAC ATT GAC CCT | CAG GGC AGG CAG GAG CG | [33] | |
| Germ cell | Ki67 | CCATATGCCTGTGGAGTGGAA | CCACCCTTAGCGTGCTCTTGA | [34] |
| Top2A | CAACTGGAACATATACTGCTCCG | GGGTCCCTTTGTTTGTTATCAGC | [35] | |
| Pachytene spermatocyte | Sycp3 | TCAGCAGAGAGCTTGGTCGG | GATGTTTGCTCAGCGGCTCC | [36] |
| Mlh1 | TTCTACCTATGGCTTTCGTGGTGA | TGCCTGCACAGGGTTTAGGAG | [37] | |
| Round spermatids | Acr | TCCTGAAGGCAAGATTGACACC | TAGACTCCGGGACGCTTAGCAC | [38] |
| Tnp1 | ACCAGCCGCAAGCTAAAGAC | TTTCCTACTTTTCAGGACGCTC | [39] | |
| Apoptosis | Fas | CAGACATGCTGTGGATCTGG | CACAGTGTTCACAGCCAGGA | [40] |
| Fas ligand | GCTCTTCCACCTGCAGAAG | ATTCCTCAAAATTGATCAGAGAGAG | [40] | |
| Bax | CACCAAGAAGCTGAGCGAGT | GCCCCAGTTGAAGTTGCCAT | [41] | |
| Bcl-2 | CTGAGTACCTGAACCGGCATC | AGAAATCAAACAGAGGTCGCAT | [41] | |
| Caspase3 | AAAGGCTGGAACCCTTGTTT | GCACCTTGCCTTCAATGAGT | [42] | |
| Antioxidant | GPx | TTGAGAAAGGAGATGTGAACGG | CAAAGTTCCAGCGGATGTCA | [42] |
| CAT | CTCAGGTGCGGACATTCTATAC | GACTCCATCCAGCGATGATTAC | [43] | |
| SOD1 | GCTGTACCAGTGCAGGACCTCAT | CTCTCCTGAGAGTGAGATCACACGA | [44] | |
| SOD2 | ATGGTGGGGGACATATT | GAACCTTGGACTCCCACAGA | [44] | |
| Trx1 | TCAAGCCCTTCTTCCATTCC | GTCGGCATGCATTTGACTTC | [45] | |
| Trx2 | CGCGGCTAGAGAAGATGGTC | TTGATGGCTAGCACGGTAGG | [45] | |
| TXNIP | AAGCTGTCCTCAGTCAGAGGCAAT | ATGACTTTCTTGGAGCCAGGGACA | [45] | |
| Nrf2 | TCTCCTAGTTCTCCGCTGCT | GTTTGGGAATGTGGGCAACC | [46] | |
| Oxidizing substances | OGG1 | GATTGGACAGTGCCGTAA | GGAAGTGGGAGTCTACAG | [47] |
| ABCD1 | GAGGGAGGTTGGGAGGCAGT | GAGGGAGGTTGGGAGGCAGT | [48] | |
| ABCD3 | CTGGGCGTGAAATGACTAGATTGG | AGCTGCACATTGTCCAAGTACTCC | [48] | |
| GRP78 | AACCCAGATGAGGCTGTAGCA | ACATCAAGCAGAACCAGGTCAC | [49] | |
| Mitochondria damage | PGC-1α | AGGAAATCCGAGCGGAGCTGA | GCAAGAAGGCGACACATCGAA | [50] |
| Nrf1 | AGCACGGAGTGACCCAAAC | TGTACGTGGCTACATGGACCT | [51] | |
| Tfam | ATTCCGAAGTGTTTTTCCAGCA | TCTGAAAGTTTTGCATCTGGGT | [51] | |
| Drp1 | ATGCCAGCAAGTCCACAGAA | TGTTCTCGGGCAGACAGTTT | [52] | |
| Fis1 | CAAAGAGGAACAGCGGGACT | ACAGCCCTCGCACATACTTT | [52] | |
| Mfn1 | GCAGACAGCACATGGAGAGA | GATCCGATTCCGAGCTTCCG | [52] | |
| Opa1 | ACCTTGCCAGTTTAGCTCCC | TTGGGACCTGCAGTGAAGAA | [52] | |
| House keeping | GAPDH | TGAACGGGAAGCTCACTGG | TCCACCACCCTGTTGCTGTA | [40] |
| Drink (SD) | Intake (SD) | Serum (SD) | Testis (SD) | ||
|---|---|---|---|---|---|
| Term | Group | (mL/day) | (μg/g/day) | (μg/mL) | (μg/g) |
| 4 weeks | i0 | 7.9 (1.4) | - | N.D. | N.D. |
| i10 | 8.2 (1.3) | 13.3 (2.0) | 1.4 (0.5) | 1.3 (0.7) | |
| i100 | 7.2 (1.1) | 118.1 (18.8) | 12.7 (0.8) | 10.4 (2.4) | |
| m0 | 8.2 (1.8) | - | N.D. | N.D. | |
| m10 | 8.3 (1.4) | 12.5 (2.1) | 1.56 (0.4) | 1.47 (0.7) | |
| m100 | 6.2 (1.1) | 98.2 (16.6) | 14.04 (2.4) | 12.33 (2.8) | |
| 8 weeks | i0 | 7.5 (1.3) | - | N.D. | N.D. |
| i10 | 7.1 (1.3) | 9.9 (1.8) | 1.5 (0.4) | 1.3 (0.2) | |
| i100 | 7.0 (1.0) | 96.2 (13.8) | 14.2 (4.3) | 9.0 (4.6) | |
| m0 | 7.4 (1.1) | - | N.D. | N.D. | |
| m10 | 8.0 (1.1) | 10.8 (1.4) | 1.51 (0.6) | 1.2 (0.4) | |
| m100 | 5.6 (0.9) | 81.2 (13.2) | 10.2 (3.0) | 9.28 (0.9) |
| Gene | Group (Comparison) | p-Value | Effect Size |
|---|---|---|---|
| Pituitary LH | 4-im 4-m | 0.634 0.946 | η2 = 0.073 η2 = 0.011 |
| 8-im (i0 vs. i100) | 0.020 (p = 0.02) | η2 = 0.508 | |
| 8-m (m0 vs. m100) | 0.024 (p = 0.019) | η2 = 0.493 | |
| Pituitary FSH | 4-im | 0.609 | η2 = 0.079 |
| 4-m | 0.523 | η2 = 0.122 | |
| 8-im | 0.412 | η2 = 0.149 | |
| 8-m | 0.116 | η2 = 0.324 | |
| Star | 4-im | 0.494 | η2 = 0.111 |
| 4-m | 0.487 | η2 = 0.123 | |
| 8-im | 0.300 | η2 = 0.182 | |
| 8-m | 0.624 | η2 = 0.082 | |
| P450scc | 4-im | 0.099 | η2 = 0.320 |
| 4-m | 0.793 | η2 = 0.041 | |
| 8-im | 0.137 | r = 0.533 | |
| 8-m | 0.943 | η2 = 0.011 | |
| P450c17 | 4-im | 0.065 | η2 = 0.365 |
| 4-m | 0.469 | η2 = 0.129 | |
| 8-im | 0.374 | η2 = 0.151 | |
| 8-m | 0.283 | η2 = 0.205 | |
| 3β-HSD | 4-im | 0.122 | η2 = 0.296 |
| 4-m (m10 vs. m100) | 0.022 (p = 0.17) | η2 = 0.502 | |
| 8-im | 0.403 | r = 0.361 | |
| 8-m (m0 vs. m100) | 0.018 (p = 0.017) | η2 = 0.519 | |
| 17β-HSD | 4-im | 0.327 | η2 = 0.170 |
| 4-m | 0.577 | η2 = 0.095 | |
| 8-im | 0.461 | η2 = 0.121 | |
| 8-m | 0.427 | η2 = 0.143 | |
| LHR | 4-im | 0.076 | η2 = 0.350 |
| 4-m | 0.373 | η2 = 0.164 | |
| 8-im | 0.119 | η2 = 0.298 | |
| 8-m | 0.376 | η2 = 0.163 | |
| FSHR | 4-im | 0.263 | η2 = 0.199 |
| 4-m | 0.887 | η2 = 0.021 | |
| 8-im | 0.698 | r = 0.227 | |
| 8-m | 0.433 | η2 = 0.141 | |
| Inha | 4-im | 0.374 | η2 = 0.151 |
| 4-m (m0 vs. m100) | 0.025 (p = 0.024) | η2 = 0.487 | |
| 8-im | 0.226 | η2 = 0.220 | |
| 8-m | 0.190 | η2 = 0.261 | |
| Shbg | 4-im (i0 vs. i10) | 0.043 (p = 0.036) | η2 = 0.408 |
| 4-m | 0.077 | η2 = 0.373 | |
| 8-im | 0.691 | r = 0.227 | |
| 8-m | 0.069 | η2 = 0.385 | |
| Ki67 | 4-im | 0.107 | η2 = 0.310 |
| 4-m (m0 vs. m100) | 0.029 (p = 0.030) | η2 = 0.475 | |
| 8-im | 0.629 | η2 = 0.074 | |
| 8-m | 0.506 | η2 = 0.117 | |
| Top2a | 4-im | 0.492 | η2 = 0.112 |
| 4-m (m0 vs. m10, m0 vs. m100) | 0.002 (p = 0.042, 0.001) | η2 = 0.678 | |
| 8-im | 0.300 | η2 = 0.182 | |
| 8-m | 0.515 | η2 = 0.114 | |
| Sycp3 | 4-im | 0.799 | η2 = 0.037 |
| 4-m | 0.397 | r = 0.377 | |
| 8-im | 0.773 | η2 = 0.042 | |
| 8-m | 0.655 | η2 = 0.074 | |
| Mlh1 | 4-im | 0.220 | η2 = 0.223 |
| 4-m | 0.538 | η2 = 0.107 | |
| 8-im | 0.387 | η2 = 0.146 | |
| 8-m | 0.659 | η2 = 0.073 | |
| Acr | 4-im | 0.756 | η2 = 0.046 |
| 4-m | 0.073 | η2 = 0.378 | |
| 8-im | 0.398 | η2 = 0.142 | |
| 8-m | 0.370 | η2 = 0.166 | |
| Tnp1 | 4-im | 0.416 | η2 = 0.136 |
| 4-m | 0.205 | η2 = 0.250 | |
| 8-im | 0.871 | η2 = 0.023 | |
| 8-m | 0.374 | r = 0.389 | |
| Fas | 4-im | 0.887 | η2 = 0.020 |
| 4-m | 0.205 | η2 = 0.218 | |
| 8-im | 0.656 | η2 = 0.068 | |
| 8-m | 0.592 | r = 0.282 | |
| FasL | 4-im | 0.428 | η2 = 0.132 |
| 4-m | 0.797 | η2 = 0.040 | |
| 8-im | 0.468 | r = 0.330 | |
| 8-m | 0.364 | η2 = 0.394 | |
| Bax | 4-im | 0.753 | η2 = 0.046 |
| 4-m | 0.895 | η2 = 0.020 | |
| 8-im | 0.075 | r = 0.608 | |
| 8-m | 0.160 | η2 = 0.283 | |
| Bcl2 | 4-im | 0.368 | r = 0.378 |
| 4-m | 0.460 | η2 = 0.132 | |
| 8-im | 0.465 | η2 = 0.120 | |
| 8-m | 0.793 | η2 = 0.041 | |
| Caspase-3 | 4-im | 0.558 | η2 = 0.093 |
| 4-m | 0.270 | η2 = 0.212 | |
| 8-im | 0.980 | η2 = 0.003 | |
| 8-m | 0.654 | r = 0.256 | |
| GPx | 4-im | 0.551 | η2 = 0.095 |
| 4-m | 0.141 | η2 = 0.300 | |
| 8-im | 0.395 | r = 0.365 | |
| 8-m | 0.738 | r = 0.216 | |
| CAT | 4-im | 0.356 | η2 = 0.158 |
| 4-m | 0.392 | η2 = 0.157 | |
| 8-im | 0.498 | η2 = 0.110 | |
| 8-m | 0.920 | η2 = 0.015 | |
| SOD1 | 4-im | 0.694 | η2 = 0.059 |
| 4-m | 0.137 | η2 = 0.304 | |
| 8-im | 0.512 | r = 0.309 | |
| 8-m | 0.522 | r = 0.514 | |
| SOD2 | 4-im (i0 vs. i100, i10 vs. i100) | 0.012 (p = 0.013, 0.048) | η2 = 0.519 |
| 4-m (m0 vs. m100) | 0.022 (p = 0.018) | η2 = 0.501 | |
| 8-im | 0.504 | η2 = 0.108 | |
| 8-m | 0.736 | η2 = 0.054 | |
| Trx1 | 4-im | 0.297 | r = 0.417 |
| 4-m | 0.380 | η2 = 0.161 | |
| 8-im | 0.683 | r = 0.233 | |
| 8-m | 0.137 | r = 0.553 | |
| Trx2 | 4-im | 0.845 | η2 = 0.028 |
| 4-m | 0.620 | η2 = 0.083 | |
| 8-im | 0.515 | η2 = 0.105 | |
| 8-m | 0.708 | η2 = 0.061 | |
| TXNIP | 4-im | 0.944 | η2 = 0.010 |
| 4-m | <0.001 | η2 = 0.820 | |
| 8-im | 0.182 | η2 = 0.247 | |
| 8-m | 0.792 | η2 = 0.042 | |
| Nrf2 | 4-im | 0.184 | η2 = 0.246 |
| 4-m | 0.416 | η2 = 0.147 | |
| 8-im | 0.567 | η2 = 0.090 | |
| 8-m | 0.245 | η2 = 0.226 | |
| OGG1 | 4-im | 0.444 | r = 0.341 |
| 4-m | 0.062 | η2 = 0.397 | |
| 8-im | 0.395 | r = 0.365 | |
| 8-m | 0.180 | r = 0.514 | |
| ABCD1 | 4-im | 0.553 | η2 = 0.094 |
| 4-m | 0.081 | η2 = 0.367 | |
| 8-im | 0.231 | η2 = 0.217 | |
| 8-m | 0.411 | η2 = 0.149 | |
| ABCD3 | 4-im | 0.429 | η2 = 0.131 |
| 4-m (m0 vs. m10, m0 vs. m100) | 0.016 (p = 0.022, 0.031) | η2 = 0.527 | |
| 8-im | 0.383 | η2 = 0.148 | |
| 8-m | 0.621 | η2 = 0.083 | |
| GRP78 | 4-im | 0.997 | η2 = 0.000 |
| 4-m | 0.682 | η2 = 0.067 | |
| 8-im | 0.251 | η2 = 0.206 | |
| 8-m | 0.650 | η2 = 0.075 | |
| PGC-1α | 4-im | 0.330 | r = 0.398 |
| 4-m | 0.585 | r = 0.287 | |
| 8-im | 0.171 | η2 = 0.255 | |
| 8-m (m0 vs. m100) | 0.043 (p = 0.035) | η2 = 0.435 | |
| Nrf1 | 4-im | 0.115 | η2 = 0.303 |
| 4-m | 0.554 | η2 = 0.102 | |
| 8-im | 0.403 | r = 0.361 | |
| 8-m | 0.590 | η2 = 0.091 | |
| Tfam | 4-im (i0 vs. i100) | 0.048 (p = 0.039) | η2 = 0.397 |
| 4-m | 0.251 | η2 = 0.222 | |
| 8-im | 0.945 | η2 = 0.009 | |
| 8-m | 0.733 | η2 = 0.055 | |
| Drp1 | 4-im | 0.928 | η2 = 0.012 |
| 4-m | 0.123 | η2 = 0.317 | |
| 8-im | 0.610 | η2 = 0.079 | |
| 8-m | 0.651 | η2 = 0.075 | |
| Fis1 | 4-im (i0 vs. i100) | 0.016 (p = 0.013) | η2 = 0.498 |
| 4-m | 0.856 | η2 = 0.028 | |
| 8-im | 0.489 | r = 0.320 | |
| 8-m | 0.624 | r = 0.269 | |
| Mfn1 | 4-im | 0.378 | η2 = 0.150 |
| 4-m | 0.182 | η2 = 0.267 | |
| 8-im | 0.641 | η2 = 0.071 | |
| 8-m | 0.077 | r = 0.629 | |
| Opa1 | 4-im | 0.727 | r = 0.214 |
| 4-m | 0.740 | r = 0.215 | |
| 8-im | 0.382 | η2 = 0.148 | |
| 8-m | 0.290 | r = 0.436 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Terayama, H.; Nagahori, K.; Kiyoshima, D.; Sato, T.; Ueda, Y.; Yamamoto, M.; Suyama, K.; Tanaka, T.; Yamamoto, M.; Eguchi, A.; et al. Low Concentrations of Sulfoxaflor Do Not Adversely Affect mRNA Levels in Various Testicular Cells When Administered to Either Mature or Immature Mice. J. Xenobiot. 2025, 15, 189. https://doi.org/10.3390/jox15060189
Terayama H, Nagahori K, Kiyoshima D, Sato T, Ueda Y, Yamamoto M, Suyama K, Tanaka T, Yamamoto M, Eguchi A, et al. Low Concentrations of Sulfoxaflor Do Not Adversely Affect mRNA Levels in Various Testicular Cells When Administered to Either Mature or Immature Mice. Journal of Xenobiotics. 2025; 15(6):189. https://doi.org/10.3390/jox15060189
Chicago/Turabian StyleTerayama, Hayato, Kenta Nagahori, Daisuke Kiyoshima, Tsutomu Sato, Yoko Ueda, Masahito Yamamoto, Kaori Suyama, Tomoko Tanaka, Midori Yamamoto, Akifumi Eguchi, and et al. 2025. "Low Concentrations of Sulfoxaflor Do Not Adversely Affect mRNA Levels in Various Testicular Cells When Administered to Either Mature or Immature Mice" Journal of Xenobiotics 15, no. 6: 189. https://doi.org/10.3390/jox15060189
APA StyleTerayama, H., Nagahori, K., Kiyoshima, D., Sato, T., Ueda, Y., Yamamoto, M., Suyama, K., Tanaka, T., Yamamoto, M., Eguchi, A., Todaka, E., Sakurai, K., Hayashi, S., Yamada, H., & Sakabe, K. (2025). Low Concentrations of Sulfoxaflor Do Not Adversely Affect mRNA Levels in Various Testicular Cells When Administered to Either Mature or Immature Mice. Journal of Xenobiotics, 15(6), 189. https://doi.org/10.3390/jox15060189

