Sfm Fimbriae Play an Important Role in the Pathogenicity of Escherichia coli CE129
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Plasmids, and Cell Lines
2.2. Construction of Recombinant Strains
2.3. Transmission Electron Microscopy (TEM) Observation
2.4. Sfm Fimbrial Extraction and Validation
2.5. Growth Curve Assays
2.6. Serum Bactericidal Assays
2.7. Bacterial Adherence Assays
2.8. Chicken Macrophage Engulfment and Survival Assays
2.9. Biofilm Formation Assays
2.10. mRNA Level of Important Virulence Factors
2.11. Statistical Analyses
3. Results
3.1. Construction of Recombinant Strains
3.2. Bacterial Adhesion Assays
3.3. Bacterial Survival-Related Assays
3.4. Relative mRNA Expression Levels
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Song, X.; Hou, M.; Jiang, H.; Shen, X.; Xue, M.; Shao, Y.; Wang, L.; He, Q.; Zheng, L.; Tu, J.; et al. Hcp2a of type VI secretion system contributes to IL8 and IL1β expression of chicken tracheal epithelium by affecting APEC colonization. Res. Vet. Sci. 2020, 132, 279–284. [Google Scholar] [CrossRef] [Scilit]
- Kathayat, D.; Lokesh, D.; Ranjit, S.; Rajashekara, G. Avian Pathogenic Escherichia coli (APEC): An Overview of Virulence and Pathogenesis Factors, Zoonotic Potential, and Control Strategies. Pathogens 2021, 10, 467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Pace, F.; Nakazato, G.; Pacheco, A.; Boldrin De Paiva, J.; Sperandio, V.; Dias Da Silveira, W. Type VI Secretion System Plays a Role in Type 1 Fimbria Expression and Pathogenesis of an Avian Pathogenic Escherichia coli Strain. Infect. Immun. 2010, 78, 4990–4998. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Avalos Vizcarra, I.; Hosseini, V.; Kollmannsberger, P.; Meier, S.; Weber, S.S.; Arnoldini, M.; Ackermann, M.; Vogel, V. How type 1 fimbriae help Escherichia coli to evade extracellular antibiotics. Sci. Rep. 2016, 6, 18109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, Q.; Zhou, M.; Zhu, X.; Bao, W.; Wu, S.; Ruan, X.; Zhang, W.; Yang, Y.; Zhu, J.; Zhu, G. The flagella of F18ab Escherichia coli is a virulence factor that contributes to infection in a IPEC-J2 cell model in vitro. Vet. Microbiol. 2012, 160, 132–140. [Google Scholar] [CrossRef] [Scilit]
- Wolfson, E.B.; Elvidge, J.; Tahoun, A.; Gillespie, T.; Mantell, J.; McAteer, S.P.; Rossez, Y.; Paxton, E.; Lane, F.; Shaw, D.J.; et al. The interaction of Escherichia coli O157:H7 and Salmonella Typhimurium flagella with host cell membranes and cytoskeletal components. Microbiology 2020, 166, 947–965. [Google Scholar] [CrossRef] [Scilit]
- Nuccio, S.P.; Baumler, A.J. Evolution of the chaperone/usher assembly pathway: Fimbrial classification goes Greek. Microbiol. Mol. Biol. Rev. 2007, 71, 551–575. [Google Scholar] [CrossRef] [Scilit]
- Mikolajczyk-Martinez, A.; Ugorski, M. Unraveling the role of type 1 fimbriae in Salmonella pathogenesis: Insights from a comparative analysis of Salmonella Enteritidis and Salmonella Gallinarum. Poult. Sci. 2023, 102, 102833. [Google Scholar] [CrossRef] [Scilit]
- Wurpel, D.J.; Beatson, S.A.; Totsika, M.; Petty, N.K.; Schembri, M.A.; Wandersman, C. Chaperone-usher fimbriae of Escherichia coli. PLoS ONE 2013, 8, e52835. [Google Scholar] [CrossRef] [Scilit]
- Zav’Yalov, V.; Zavialov, A.; Zav’Yalova, G.; Korpela, T. Adhesive organelles of Gram-negative pathogens assembled with the classical chaperone/usher machinery: Structure and function from a clinical standpoint. FEMS Microbiol. Rev. 2010, 34, 317–378. [Google Scholar] [CrossRef] [Scilit]
- Korea, C.; Badouraly, R.; Prevost, M.; Ghigo, J.; Beloin, C. Escherichia coli K-12 possesses multiple cryptic but functional chaperone-usher fimbriae with distinct surface specificities. Environ. Microbiol. 2010, 12, 1957–1977. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, X.; Zhang, Q.; Wang, H.; Quan, G.; Zhang, D.; Ren, W.; Liao, Y.; Xia, P.; Zhu, G. The different roles of hcp1 and hcp2 of the type VI secretion system in Escherichia coli strain CE129. J. Basic Microbiol. 2018, 58, 938–946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gu, X.; Hou, Q.; Liu, J.; Xia, P.; Duan, Q.; Zhu, G. Sef fimbria operon construction, expression, and function for direct rapid detection of Salmonella Enteritidis. Appl. Microbiol. Biotechnol. 2021, 105, 5631–5641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, Q.; Zhou, M.; Zhu, X.; Yang, Y.; Zhu, J.; Bao, W.; Wu, S.; Ruan, X.; Zhang, W.; Zhu, G. Flagella from F18+Escherichia coli play a role in adhesion to pig epithelial cell lines. Microb. Pathog. 2013, 55, 32–38. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Zhang, X.; Zhang, B.; Zhou, M.; Duan, Q.; Li, Z.; Zhang, X.; Zhu, G. Quorum sensing-1 signaling of N-hexanoyl-l-homoserine lactone contributes to virulence in avian pathogenic Escherichia coli. Arch. Microbiol. 2021, 203, 6079–6089. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Yao, F.; Zhou, M.; Zhu, J.; Zhang, X.; Bao, W.; Wu, S.; Hardwidge, P.R.; Zhu, G. F18ab Escherichia coli flagella expression is regulated by acyl-homoserine lactone and contributes to bacterial virulence. Vet. Microbiol. 2013, 165, 378–383. [Google Scholar] [CrossRef] [Scilit]
- Nguyet, L.T.Y.; Ounjai, P.; Kaeoket, K.; Ngamwongsatit, N. Feasibility of crude F4 fimbriae extract as a vaccine candidate for preventing Escherichia coli-induced diarrhea in piglets. Vet. World 2023, 16, 2063–2070. [Google Scholar] [CrossRef] [Scilit]
- Zhou, M.; Guo, Z.; Yang, Y.; Duan, Q.; Zhang, Q.; Yao, F.; Zhu, J.; Zhang, X.; Hardwidge, P.R.; Zhu, G. Flagellin and F4 fimbriae have opposite effects on biofilm formation and quorum sensing in F4ac+ enterotoxigenic Escherichia coli. Vet. Microbiol. 2014, 168, 148–153. [Google Scholar] [CrossRef] [Scilit]
- Vilas Boas, D.; Castro, J.; Araujo, D.; Nobrega, F.L.; Keevil, C.W.; Azevedo, N.F.; Vieira, M.J.; Almeida, C. The Role of Flagellum and Flagellum-Based Motility on Salmonella Enteritidis and Escherichia coli Biofilm Formation. Microorganisms 2024, 12, 232. [Google Scholar] [CrossRef] [Scilit]
- Palaniyandi, S.; Mitra, A.; Herren, C.D.; Zhu, X.; Mukhopadhyay, S. LuxS contributes to virulence in avian pathogenic Escherichia coli O78:K80:H9. Vet. Microbiol. 2013, 166, 567–575. [Google Scholar] [CrossRef] [Scilit]
- Han, X.; Bai, H.; Liu, L.; Dong, H.; Liu, R.; Song, J.; Ding, C.; Qi, K.; Liu, H.; Yu, S. The luxS gene functions in the pathogenesis of avian pathogenic Escherichia coli. Microb. Pathog. 2013, 55, 21–27. [Google Scholar] [CrossRef] [Scilit]
- Meng, X.; Meng, X.; Wang, J.; Wang, H.; Zhu, C.; Ni, J.; Zhu, G. Small non-coding RNA STnc640 regulates expression of fimA fimbrial gene and virulence of Salmonella enterica serovar Enteritidis. BMC Vet. Res. 2019, 15, 319. [Google Scholar] [CrossRef] [Scilit]
- Meng, X.; He, M.; Chen, B.; Xia, P.; Wang, J.; Zhu, C.; Wang, H.; Zhu, G. RyhB Paralogs Downregulate the Expressions of Multiple Survival-Associated Genes and Attenuate the Survival of Salmonella Enteritidis in the Chicken Macrophage HD11. Microorganisms 2023, 11, 214. [Google Scholar] [CrossRef] [Scilit]
- Kallas, P.; Haugen, H.J.; Gadegaard, N.; Stormonth-Darling, J.; Hulander, M.; Andersson, M.; Valen, H. Adhesion of Escherichia coli to Nanostructured Surfaces and the Role of Type 1 Fimbriae. Nanomaterials 2020, 10, 2247. [Google Scholar] [CrossRef] [Scilit]
- Alonso-Caballero, A.; Schonfelder, J.; Poly, S.; Corsetti, F.; De Sancho, D.; Artacho, E.; Perez-Jimenez, R. Mechanical architecture and folding of E. coli type 1 pilus domains. Nat. Commun. 2018, 9, 2758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, J.; Afayibo, D.; Zhang, B.; Zhu, H.; Yao, L.; Guo, W.; Wang, X.; Wang, Z.; Wang, D.; Peng, H.; et al. Characteristics, pathogenic mechanism, zoonotic potential, drug resistance, and prevention of avian pathogenic Escherichia coli (APEC). Front. Microbiol. 2022, 13, 1049391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Golpasand, T.; Keshvari, M.; Behzadi, P. Distribution of chaperone-usher fimbriae and curli fimbriae among uropathogenic Escherichia coli. BMC Microbiol. 2024, 24, 344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Isidro-Coxca, M.I.; Ortiz-Jimenez, S.; Puente, J.L. Type 1 fimbria and P pili: Regulatory mechanisms of the prototypical members of the chaperone-usher fimbrial family. Arch. Microbiol. 2024, 206, 373. [Google Scholar] [CrossRef] [Scilit]
- Xue, M.; Raheem, M.A.; Gu, Y.; Lu, H.; Song, X.; Tu, J.; Xue, T.; Qi, K. The KdpD/KdpE two-component system contributes to the motility and virulence of avian pathogenic Escherichia coli. Res. Vet. Sci. 2020, 131, 24–30. [Google Scholar] [CrossRef] [Scilit]
- Wang, P.; Meng, X.; Li, J.; Chen, Y.; Zhang, D.; Zhong, H.; Xia, P.; Cui, L.; Zhu, G.; Wang, H. Transcriptome profiling of avian pathogenic Escherichia coli and the mouse microvascular endothelial cell line bEnd.3 during interaction. PeerJ 2020, 8, e9172. [Google Scholar]
- Yu, L.; Wang, H.; Zhang, X.; Xue, T. Oxidative stress response in avian pathogenic Escherichia coli. Res. Vet. Sci. 2024, 180, 105426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quan, G.; Xia, P.; Zhao, J.; Zhu, C.; Meng, X.; Yang, Y.; Wang, Y.; Tian, Y.; Ding, X.; Zhu, G. Fimbriae and related receptors for Salmonella Enteritidis. Microb. Pathog. 2019, 126, 357–362. [Google Scholar] [CrossRef] [Scilit]
- Kondakindi, V.R.; Nalam, R.S.S.; Pabbati, R.; Maddela, N.R. Quorum quenching a sustainable biofilm mitigation strategy. Res. J. Biotechnol. 2022, 17, 200–202. [Google Scholar] [CrossRef] [Scilit]
- Sharma, G.; Sharma, S.; Sharma, P.; Chandola, D.; Dang, S.; Gupta, S.; Gabrani, R. Escherichia coli biofilm: Development and therapeutic strategies. J. Appl. Microbiol. 2016, 121, 309–319. [Google Scholar] [CrossRef] [Scilit]
- Pakbin, B.; Brück, W.M.; Rossen, J.W.A. Virulence Factors of Enteric Pathogenic Escherichia coli: A Review. Int. J. Mol. Sci. 2021, 22, 9922. [Google Scholar] [CrossRef] [Scilit]
- Feenstra, T.; Thogersen, M.S.; Wieser, E.; Peschel, A.; Ball, M.J.; Brandes, R.; Satchell, S.C.; Stockner, T.; Aarestrup, F.M.; Rees, A.J.; et al. Adhesion of Escherichia coli under flow conditions reveals potential novel effects of FimH mutations. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 467–478. [Google Scholar] [CrossRef] [Scilit]




| Strains and Plasmids | Description | Source |
|---|---|---|
| Strains | ||
| E. coli CE129 | Wild-type Avian pathogenic E. coli O139:H1:F18ab, Stx2e | [12] |
| E. coli CE129ΔsfmA | sfmA deletion mutant | This study |
| E. coli CE129ΔsfmA/psfmA | CE129ΔsfmA carrying pBR-sfmA | This study |
| E. coli SE5000 | A genetically engineered strain | [13] |
| E. coli SE5000 (pBR322-sfm) | SE5000 carrying pBR322-sfm | This study |
| E. coli SE5000 (pBR322) | SE5000 carrying pBR322 | This study |
| Plasmids | ||
| pBR322 | Expression vector, Ampr | Takara Ltd. (Tokyo, Japan) |
| pKD3 | Cmr; Cm cassette template | [14] |
| pKD46 | Ampr, λRed recombinase expression | [14] |
| pCP20 | Ampr, Cmr; Flp recombinase expression | [14] |
| Primer | Sequences (5′-3′) |
|---|---|
| sfm-Operon-F | CAGGCTAGCATGAAATTAAGATTTATTTCGTCTG |
| sfm-Operon-R | CAGCGTCGACTAATATTAATTATAATTGATCATAA |
| sfmA-1 | CGGATGTGGAGTCGATAAA |
| sfmA-2 | TTCAGACAACCGGTACATT |
| ΔsfmA-1 | ATGAAATTAAGATTTATTTCGTCTGCGCTGGCTGCCGCACTATTCGCCGCTGTGTAGGCTGGAGCTGCTTCG |
| ΔsfmA-2 | TTATTCATATCTCATAATAAAAGTCGCGTCAGCATTTGCTTGCCCTGCTGCATATGAATATCCTCCTTAG |
| gapA-RT-F | CGTTAAAGGCGCTAACTTCG |
| gapA-RT-R | ACGGTGGTCATCAGACCTTC |
| fimA-RT-F | GCACAGGAAGGAGCAACCA |
| flimA-RT-R | GGCAACAGCGGCTTTAGATG |
| fliC-H18-RT-F | TGACAAAGCCGTCGCAAGTA |
| fliC-H18-RT-R | AGCTGCACCAAAACCAACATC |
| papC-RT-F | AACGGGCGTGGTGACTGA |
| papC-RT-R | CGGGTTGCTTCCACATCATC |
| tsh-RT-F | CACGGGTTGTGGGATTCAG |
| tsh-RT-R | TTACGTGCAACCTGGTAACCAT |
| ompA-RT-F | AAGGTATCCCGGCAGACAAAA |
| ompA-RT-R | GATCCGGAGCCAGGCAAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Y.; Chen, M.; Han, Z.; Zhu, C.; Wu, Z.; Li, J.; Zhu, G. Sfm Fimbriae Play an Important Role in the Pathogenicity of Escherichia coli CE129. Microbiol. Res. 2025, 16, 160. https://doi.org/10.3390/microbiolres16070160
Yang Y, Chen M, Han Z, Zhu C, Wu Z, Li J, Zhu G. Sfm Fimbriae Play an Important Role in the Pathogenicity of Escherichia coli CE129. Microbiology Research. 2025; 16(7):160. https://doi.org/10.3390/microbiolres16070160
Chicago/Turabian StyleYang, Yang, Mingliang Chen, Zixin Han, Congrui Zhu, Ziyan Wu, Junpeng Li, and Guoqiang Zhu. 2025. "Sfm Fimbriae Play an Important Role in the Pathogenicity of Escherichia coli CE129" Microbiology Research 16, no. 7: 160. https://doi.org/10.3390/microbiolres16070160
APA StyleYang, Y., Chen, M., Han, Z., Zhu, C., Wu, Z., Li, J., & Zhu, G. (2025). Sfm Fimbriae Play an Important Role in the Pathogenicity of Escherichia coli CE129. Microbiology Research, 16(7), 160. https://doi.org/10.3390/microbiolres16070160

