Acinetobacter baumannii Co-Resistant to Extended Spectrum Beta-Lactamases and Carbapenemases in Six Peruvian Hospital Centers
Abstract
1. Introduction
2. Materials and Methods
2.1. Phenotypic Characterization
2.2. Molecular Characterization
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pérez, D.Q. Antimicrobial resistance: Evolution and current perspectives in the context of the “one health” approach. Rev. Cubana Med. Trop. 2017, 69, 1–17. [Google Scholar]
- Aslam, B.; Khurshid, M.; Arshad, M.I.; Muzammil, S.; Rasool, M.; Yasmeen, N.; Shah, T.; Chaudhry, T.H.; Rasool, M.H.; Shahid, A.; et al. Antibiotic Resistance: One Health One World Outlook. Front. Cell. Infect. Microbiol. 2021, 11, 771510. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, D.L.N.; Morais-Rodrigues, F.; Hurtado, R.; dos Santos, R.G.; Costa, D.C.; Barh, D.; Ghosh, P.; Alzahrani, K.J.; Soares, S.C.; Ramos, R.; et al. Pan-Resistome Insights into the Multidrug Resistance of Acinetobacter baumannii. Antibiotics 2021, 10, 596. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-López, J.; Cantón, R. Current status of ESKAPE microorganisms in Spain: Epidemiology and resistance phenotypes. Rev. Esp. Quimioter. 2019, 32 (Suppl. S2), 27–31. [Google Scholar] [PubMed]
- Rivera-Izquierdo, M.; Benavente-Fernández, A.; López-Gómez, J.; Láinez-Ramos-Bossini, A.J.; Rodríguez-Camacho, M.; Valero-Ubierna, M.d.C.; Martín-delosReyes, L.M.; Jiménez-Mejías, E.; Moreno-Roldán, E.; Lardelli-Claret, P.; et al. Prevalence of Multi-Resistant Microorganisms and Antibiotic Stewardship among Hospitalized Patients Living in Residential Care Homes in Spain: A Cross-Sectional Study. Antibiotics 2020, 9, 324. [Google Scholar] [CrossRef]
- Organización Panamericana de la Salud. Magnitud y Tendencias de la Resistencia a los Antimicrobianos en Latinoamérica. 2020. Available online: https://www.paho.org/en/topics/antimicrobial-resistance (accessed on 21 November 2024).
- Rada Cuentas, J. Acinetobacter un patógeno actual. Rev. Soc. Boliv. Pediatría 2016, 55, 29–48. [Google Scholar]
- Gómez, R.F.; Castillo, A.; Chávez-Vivas, M. Characterization of multidrug-resistant Acinetobacter ssp. strains isolated from medical intensive care units in Cali—Colombia. Colomb. Med. 2017, 48, 183–190. [Google Scholar] [CrossRef]
- Pan American Health Organization (PAHO). Americas Report Surge in Drug-Resistant Infections Due to Misuse of Antimicrobials During Pan-Demic. 2021. Available online: https://www.paho.org/en/news/17-11-2021-americas-report-surge-drug-resistant-infections-due-misuse-antimicrobials-during (accessed on 22 November 2024).
- Levy-Blitchtein, S.; Roca, I.; Plasencia-Rebata, S.; Vicente-Taboada, W.; Velásquez-Pomar, J.; Muñoz, L.; Moreno-Morales, J.; Pons, M.J.; Del Mendoza, J.; Vila, J. Emergence and spread of carbapenem-resistant Acinetobacter baumannii international clones II and III in Lima, Peru. Emerg. Microbes Infect. 2018, 7, 119. [Google Scholar] [CrossRef]
- Al-Hamad, A.; Pal, T.; Leskafi, H.; Abbas, H.; Hejles, H.; Alsubikhy, F.; Darwish, D.; Ghazawi, A.; Sonnevend, A. Molecular characterization of clinical and environmental carbapenem resistant Acinetobacter baumannii isolates in a hospital of the Eastern Region of Saudi Arabia. J. Infect. Public Health 2020, 13, 632–636. [Google Scholar] [CrossRef]
- Kurihara, M.N.L.; de Sales, R.O.; da Silva, K.E.; Maciel, W.G.; Simionatto, S. Multidrug-resistant Acinetobacter baumannii outbreaks: A global prob-lem in healthcare settings. Rev. Soc. Bras. Med. Trop. 2020, 53, e20200248. [Google Scholar] [CrossRef]
- CHROMagar mSuperCARBA. J. Chem. Inf. Model. 2019, 53, 1689–1699. Available online: https://www.chromagar.com/en/product/chromagar-msupercarba/ (accessed on 15 November 2024).
- Beckman, C. MicroScan. Manual de Procedimiento para Microorganismos Gramnegativos, LabPro Multirregional ≥ V4.42. 2019. Available online: https://bit.ly/307u5Tq (accessed on 15 November 2024).
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals; CLSI Supplement VET08; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- Jena, A.; Konrad-Zuse-Straße, A.G. Instructions for Use Life Science Kits & Assays innuPREP DNA Mini Kit. Available online: www.analytik-jena.com (accessed on 21 November 2024).
- MALBRAN. Protocolos de pcr Para la Deteccion de Carbapenemasas. Available online: http://antimicrobianos.com.ar/category/protocolos-de-metodos-moleculares/ (accessed on 21 November 2024).
- Arce, Z.; Llontop Nuñez, J.; Flores Clavo, R.; Fernández Valverde, D. Detection of CTX-M gene of Escherichia coli producing B-lactamase extended espectrum from the Regional Hospital of Lambayeque, Chiclayo, Peru: November 2012–July 2013. Rev. Cuerpo Médico Hosp. Nac. Almanzor Aguinaga Asenjo 2013, 6, 12–15. Available online: http://dialnet.unirioja.es/servlet/articulo?codigo=4724587&info=resumen&idioma=ENG (accessed on 24 May 2024).
- Fajardo-Loyola, A.; YaretaYareta, J.; Meza-Fernández, H.; Soto-Pastrana, J.; Marcos-Carbajal, P. Molecular characteristics of antibiotic-resistant Escherichia coli and Klebsiella pneumoniae isolates obtained from urine samples of patients with urinary tract infection in Lima and Callao, Peru. Rev. Fac. Med. 2023, 71, e104282. [Google Scholar] [CrossRef]
- Ehlers, M.M.; Veldsman, C.; Makgotlho, E.P.; Dove, M.G.; Hoosen, A.A.; Kock, M.M. Detection of blaSHV, blaTEM and blaCTX-M antibiotic resistance genes in randomly selected bacterial pathogens from the Steve Biko Academic Hospital. FEMS Immunol. Med. Microbiol. 2009, 56, 191–196. [Google Scholar] [CrossRef] [PubMed]
- Sacsaquispe-Contreras, R.; Bailón-Calderón, H. Identificación de genes de resistencia a carbapenémicos en enterobacterias de hospitales de Perú, 2013–2017. Rev. Peru. Med. Exp. Salud Publica 2017, 35, 259–264. [Google Scholar] [CrossRef]
- Kiratisin, P.; Apisarnthanarak, A.; Laesripa, C.; Saifon, P. Molecular characterization and epidemiology of extended-spectrum-β-lactamase-producing Escherichia coli and Klebsiella pneumoniae isolates causing health care-associated infection in Thailand, where the CTX-M family is endemic. Antimicrob. Agents Chemother. 2008, 52, 2818–2824. [Google Scholar] [CrossRef]
- Sharma, A.; Grover, P.S. Application of WHONET for the surveillance of antimicrobial resistance. Indian J. Med. Microbiol. 2004, 22, 115–118. [Google Scholar] [CrossRef]
- Gales, A.C.; Seifert, H.; Gur, D.; Castanheira, M.; Jones, R.N.; Sader, H.S. Antimicrobial Susceptibility of Acinetobacter calcoaceticus-Acinetobacter baumannii Complex and Stenotrophomonas maltophilia Clinical Isolates: Results from the SENTRY Antimicrobial Surveillance Program (1997–2016). Open Forum Infect. Dis. 2019, 6 (Suppl. S1), S34–S46. [Google Scholar] [CrossRef]
- ECDC. Surveillance of Antimicrobial Resistance: Annual Report of the European Antimicrobial Resistance Surveillance Network (EARS-Net) 2018; European Centre for Disease Prevention and Control: Stockholm, Sweden, 2018; Available online: https://www.ecdc.europa.eu/sites/default/files/documents/surveillance-antimicrobial-resistance-Europe-2018.pdf. (accessed on 21 November 2024).
- Bansal, G.; Allen-McFarlane, R.; Eribo, B. Antibiotic Susceptibility, Clonality, and Molecular Characterization of Carbapenem-Resistant Clin-ical Isolates of Acinetobacter baumannii from Washington DC. Int. J. Microbiol. 2020, 2020, 2120159. [Google Scholar] [CrossRef]
- Hansen, G.T. Continuous Evolution: Perspective on the Epidemiology of Carbapenemase Resistance Among Enterobacterales and Other Gram-Negative Bacteria. Infect. Dis. Ther. 2021, 10, 75–92. [Google Scholar] [CrossRef]
- Casellas, J.M. Resistencia a los antibacterianos en América Latina: Consecuencias para la infectología. Rev. Panam. Salud Publica/Pan Am. J. Public Health 2011, 30, 519–528. [Google Scholar]
- Safiye, U.; Coskun, S.; Caliskan, E.; Copur, A.; Halbay, C.; Sandalli, C. β-lactamase genes in carbapenem resistance Acinetobacter baumannii isolates from a Turkish university hospital. J. Infect. Dev. Ctries. 2019, 13, 50–55. [Google Scholar]
- Rodriguez Buenahora, R.D.; Bustillo Zarate, D.E.; Caicedo Sanchez, D.C.; Cadena Sarmiento, D.C.; Castellanos Gomez, C. Acinetobacter baumannii: Patógeno multirresistente emergente. Rev. Estud. Med. Univ. Ind. Santander. 2016, 29, 113–135. [Google Scholar] [CrossRef]
- Ibrahimagić, A.; Kamberović, F.; Uzunović, S.; Bedenić, B.; Idrizović, E. Molecular characteristics and antibiotic resistance of Acinetobacter baumanniibeta-lactamase-producing isolates, a predominance of intrinsic blaOXA-51, and detection of TEM and CTX-M genes. Turk. J. Med. Sci. 2017, 47, 715–720. [Google Scholar] [CrossRef] [PubMed]
- Beriş, F.Ş.; Budak, E.E.; Gülek, D.; Uzun, A.; Çizmeci, Z.; Mengeloğlu, F.Z.; Direkel, Ş.; Çetinkol, Y.; Ay Altıntop, Y.; Iraz, M.; et al. Investigation of the frequency and distribution of beta-lactamase genes in the clinical isolates of Acinetobacter baumannii collected from different regions of Turkey: A multicenter study. Mikrobiyoloji Bul. 2016, 50, 511–521. [Google Scholar] [CrossRef][Green Version]
- Boral, B.; Unaldi, Ö.; Ergin, A.; Durmaz, R.; Eser, Ö.K. A prospective multicenter study on the evaluation of antimicrobial resistance and molec-ular epidemiology of multidrug-resistant Acinetobacter baumannii infections in intensive care units with clinical and environmental features. Ann. Clin. Microbiol. Antimicrob. 2019, 18, 19. [Google Scholar] [CrossRef]
- Rocha, C.; Bernal, M.; Canal, E.; Rios, P.; Meza, R.; Lopez, M.; Burga, R.; Abadie, R.; Pizango, M.; Diaz, E.; et al. First report of New Delhi metallo-β-lactamase carbapenemase–producing acinetobacter baumannii in Peru. Am. J. Trop. Med. Hyg. 2019, 100, 529–531. [Google Scholar] [CrossRef]
- Castillo, Y.; Nieto, C.; Astocondor, L.; Jacobs, J.; García, C. Bacteriemia por Acinetobacter baumannii productor de oxacilinasa en hospitales de Lima, Perú. Rev. Peru. Med. Exp. Salud Publica 2019, 36, 364–366. [Google Scholar] [CrossRef]
- Djahmi, N.; Dunyach-Remy, C.; Pantel, A.; Dekhil, M.; Sotto, A.; Lavigne, J.-P. Epidemiology of carbapenemase-producing Enterobacteriaceae and Acinetobacter baumannii in Mediterranean countries. BioMed Res. Int. 2014, 2014, 305784. [Google Scholar] [CrossRef]
- Cantón, R.; Akóva, M.; Carmeli, Y.; Giske, C.G.; Glupczynski, Y.; Gniadkowski, M.; Livermore, D.M.; Miriagou, V.; Naas, T.; Rossolini, G.M.; et al. Rapid evolution and spread of carbapenemases among Enterobacteriaceae in Europe. Clin. Microbiol. Infect. Off. Publ. Eur. Soc. Clin. Microbiol. Infect. Dis. 2012, 18, 413–431. [Google Scholar] [CrossRef]
- Fonseca, É.L.; Caldart, R.V.; Freitas, F.S.; Morgado, S.M.; Rocha, L.T.; dos Santos, R.C.; Vicente, A.C.P. Emergence of extensively drug-resistant international clone IC-6 Acinetobacter baumannii carrying blaOXA-72 and blaCTX-M-115 in the Brazilian Amazon region. J. Glob. Antimicrob. Resist. 2020, 20, 18–21. [Google Scholar] [CrossRef] [PubMed]
- Antimicrobial Resistance Collaborators. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef] [PubMed]


| Strain | City | Public Hospital Centers | Códe |
|---|---|---|---|
| 04 | Callao | Hospital Essalud Alberto Sabogal Sologuren | CAL |
| 09 | Trujillo | Hospital Belén | TRU |
| 03 | Cusco | Hospital Antonio Lorena | CUS |
| 02 | Loreto | Hospital Regional “Felipe Santiago Arriola Iglesias” | LOR |
| 02 | Puerto Maldonado | IPRESS Jorge Chávez | PM |
| 01 | Tarapoto | Hospital de Tarapoto | TAR |
| Gen | Sequence | Size | Thermocycling Parameter | Ref. |
|---|---|---|---|---|
| blaCTX-M | F: GAA GGT CAT CAA GAA GGT GCG R: GCA TTG CCA CGC TTT TCA TAG | 560 bp | Initial denaturation 94 °C × 5 min; Cycle denaturation 94 °C × 1 min; hybridization 52 °C × 1 min; cycle extension 72 °C × 1 min y final elongation 72 °C × 5 min for 35 cycles | [19] |
| blaTEM | F: TCC GCT CAT GAG ACA ATA ACC R: TTG GTC TGA CAG TTA CCA ATG C | 931 bp | Initial denaturation 94 °C × 5 min; Cycle denaturation 94 °C × 1 min; hybridization 52 °C × 1 min; cycle extension 72 °C × 1 min y final elongation 72 °C × 5 min for 35 cycles | [19] |
| blaSHV | F: ATG CGT TAT ATT CGC CTG TG R: TGC TTT GTT CGG GCC AA | 747 bp | Initial denaturation 94 °C × 5 min; Cycle denaturation 94 °C × 1 min; hybridization 51 °C × 1 min; cycle extension 72 °C × 1 min y final elongation 72 °C × 5 min for 35 cycles | [20] |
| blaKPC | F: AAC AAG GAA TAT CGT TGA TG R: AGA TGA TTT TCA GAG CCT TA | 916 bp | Initial denaturation 94 °C × 5 min; Cycle denaturation 94 °C × 30 seg; hybridization 50 °C × 30 seg; cycle extension 72 °C × 1 min y final elongation 72 °C × 10 min por 35 cycles | [21] |
| blaNDM | F: AGC ACA CTT CCT ATC TCG AC R: GGC GTA GTG CTC AGT GTC | 512 bp | Initial denaturation 94 °C × 5 min; Cycle denaturation 94 °C × 30 seg; hybridization 57 °C × 30 seg; cycle extension 72 °C × 30 seg y final elongation 72 °C × 5 min por 35 cycles | [21] |
| blaVIM | F: AGT GGT GAG TAT CCG ACA G R: ATG AAA GTG CGT GGA GAC | 261 bp | Initial denaturation 94 °C × 5 min; Cycle denaturation 94 °C × 30 seg; hybridization 57 °C × 30 seg; cycle extension 72 °C × 30 seg y final elongation 72 °C × 5 min por 35 cycles | [21] |
| blaIMP | F: GGY GTT TWT GTT CAT ACW TCK TTY GA R: GGY ARC CAA ACC ACT ASG TTA TCT | 404 bp | Initial denaturation 94 °C × 5 min; Cycle denaturation 94 °C × 30 seg; hybridization 50 °C × 30 seg; cycle extension 72 °C × 30 seg y final elongation 72 °C × 5 min por 35 cycles | [21] |
| blaOXA | F: AATGGCACCAGATTCAACTT R: CTTGGCTTTTATGCTTGATG | 599 bp | Initial denaturation 94 °C × 5 min; Cycle denaturation 94 °C × 30 seg; hybridization 50 °C × 30 seg; cycle extension 72 °C × 30 seg y final elongation 72 °C × 5 min por 35 cycles | [22] |
| Sample | Sex | Age | City | Hospital | Service | Códe |
|---|---|---|---|---|---|---|
| Bronchial aspirate | M | 55 | Trujillo | H. Belen | Intensive Care Unit | TRU1 |
| Bronchial aspirate | M | 37 | Puerto Maldonado | IPRESS Jorge Chávez | Hospitalization | PM 1 |
| Tracheal secretion | F | 30 | Puerto Maldonado | IPRESS Jorge Chávez | Hospitalization | PM 2 |
| Bronchial aspirate | M | 28 | Cusco | H. Antonio Lorena | Intensive Care Unit | CUS 1 |
| Tracheal secretion | F | 2 | Cusco | H. Antonio Lorena | Intensive Care Unit | CUS 2 |
| Tracheal secretion | M | 50 | Cusco | H. Antonio Lorena | Intensive Care Unit | CUS 3 |
| Endotracheal culture | M | 44 | Callao | H. Alberto Sabogal | Intensive Care Unit | CAL 1 |
| Bronchial aspirate | M | 24 | Callao | H. Alberto Sabogal | Intensive Care Unit | CAL 2 |
| Endotracheal culture | M | 32 | Callao | H. Alberto Sabogal | Intensive Care Unit | CAL 3 |
| Strain | Resistance Gene | AMK | FEP | CAZ | CIP | GEN | IPM | MEM | TOB | SXT |
|---|---|---|---|---|---|---|---|---|---|---|
| TRU1 | blaCTX-M | |||||||||
| PM1 | blaCTX-M | |||||||||
| PM2 | blaCTX-M | |||||||||
| CUS1 | blaCTX-M, blaTEM | |||||||||
| CUS2 | blaCTX-M, blaTEM | |||||||||
| CUS3 | blaCTX-M, blaTEM, blaOXA | |||||||||
| CAL1 | NDM | |||||||||
| CAL2 | blaCTX-M | |||||||||
| CAL3 | blaCTX-M | |||||||||
![]() | ||||||||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Challapa-Mamani, M.R.; Yareta, J.; Fajardo-Loyola, A.; Asmat Marrufo, P.; Siesquen, C.P.; Pino-Dueñas, J.; Meza-Fernández, H.; Cruz-Vargas, J.A.D.L.; Marcos-Carbajal, P. Acinetobacter baumannii Co-Resistant to Extended Spectrum Beta-Lactamases and Carbapenemases in Six Peruvian Hospital Centers. Microbiol. Res. 2024, 15, 2650-2660. https://doi.org/10.3390/microbiolres15040175
Challapa-Mamani MR, Yareta J, Fajardo-Loyola A, Asmat Marrufo P, Siesquen CP, Pino-Dueñas J, Meza-Fernández H, Cruz-Vargas JADL, Marcos-Carbajal P. Acinetobacter baumannii Co-Resistant to Extended Spectrum Beta-Lactamases and Carbapenemases in Six Peruvian Hospital Centers. Microbiology Research. 2024; 15(4):2650-2660. https://doi.org/10.3390/microbiolres15040175
Chicago/Turabian StyleChallapa-Mamani, Mabel R., José Yareta, Alexander Fajardo-Loyola, Percy Asmat Marrufo, Carlos Peralta Siesquen, Jimena Pino-Dueñas, Henry Meza-Fernández, Jhony A. De La Cruz-Vargas, and Pool Marcos-Carbajal. 2024. "Acinetobacter baumannii Co-Resistant to Extended Spectrum Beta-Lactamases and Carbapenemases in Six Peruvian Hospital Centers" Microbiology Research 15, no. 4: 2650-2660. https://doi.org/10.3390/microbiolres15040175
APA StyleChallapa-Mamani, M. R., Yareta, J., Fajardo-Loyola, A., Asmat Marrufo, P., Siesquen, C. P., Pino-Dueñas, J., Meza-Fernández, H., Cruz-Vargas, J. A. D. L., & Marcos-Carbajal, P. (2024). Acinetobacter baumannii Co-Resistant to Extended Spectrum Beta-Lactamases and Carbapenemases in Six Peruvian Hospital Centers. Microbiology Research, 15(4), 2650-2660. https://doi.org/10.3390/microbiolres15040175


