Development of a Quadruplex RT-qPCR for the Detection of Feline Kobuvirus, Feline Astrovirus, Feline Bufavirus, and Feline Rotavirus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reference Strains
2.2. Clinical Samples
2.3. Design of Primers and Probes
2.4. Preparation of Recombinant Plasmid Constructs
2.5. Optimization of Reaction Conditions
2.6. Generation of Standard Curves
2.7. Specificity Analysis
2.8. Sensitivity Analysis
2.9. Reproducibility Analysis
2.10. Application of Clinical Samples
3. Results
3.1. Generation of Standard Plasmid Constructs
3.2. Determination of Optimal Reaction Conditions
3.3. Generation of Standard Curves
3.4. Specificity
3.5. Sensitivity
3.6. Reproducibility
3.7. Test Results of Clinical Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Di Martino, B.; Di Profio, F.; Melegari, I.; Marsilio, F. Feline virome—A review of novel enteric viruses detected in cats. Viruses 2019, 11, 908. [Google Scholar] [CrossRef] [PubMed]
- Di Profio, F.; Sarchese, V.; Fruci, P.; Aste, G.; Martella, V.; Palombieri, A.; Di Martino, B. Exploring the enteric virome of cats with acute gastroenteritis. Vet. Sci. 2023, 10, 362. [Google Scholar] [CrossRef] [PubMed]
- Shao, R.; Ye, C.; Zhang, Y.; Sun, X.; Cheng, J.; Zheng, F.; Cai, S.; Ji, J.; Ren, Z.; Zhong, L.; et al. Novel parvovirus in cats, China. Virus Res. 2021, 304, 198529. [Google Scholar] [CrossRef] [PubMed]
- Van Brussel, K.; Wang, X.; Shi, M.; Carrai, M.; Feng, S.; Li, J.; Holmes, E.C.; Beatty, J.A.; Barrs, V.R. The enteric virome of cats with feline panleukopenia differs in abundance and diversity from healthy cats. Transbound. Emerg. Dis. 2022, 69, e2952–e2966. [Google Scholar] [CrossRef] [PubMed]
- Mira, F.; Schir, G.; Giudice, E.; Purpari, G.; Origgi, F.; Vicari, D.; Di Pietro, S.; Antoci, F.; Gucciardi, F.; Geraci, F.; et al. Viral pathogens in domestic cats in southern Italy: A retrospective analysis in Sicily, 2020–2022. Comp. Immunol. Microbiol. Infect. Dis. 2024, 111, 102209. [Google Scholar] [CrossRef]
- Xiao, X.; Hao, X.; Chen, B.; Zhou, P.; Li, S. Two multiplex PCR methods for detecting several pathogens associated with feline respiratory and intestinal tracts. Vet. Sci. 2022, 10, 14. [Google Scholar] [CrossRef]
- Khamrin, P.; Maneekarn, N.; Okitsu, S.; Ushijima, H. Epidemiology of human and animal kobuviruses. Virusdisease 2014, 25, 195–200. [Google Scholar] [CrossRef]
- Lu, G.; Zhang, X.; Luo, J.; Sun, Y.; Xu, H.; Huang, J.; Ou, J.; Li, S. First report and genetic characterization of feline kobuvirus in diarrhoeic cats in China. Transbound. Emerg. Dis. 2018, 65, 1357–1363. [Google Scholar] [CrossRef]
- Cho, Y.Y.; Lim, S.I.; Kim, Y.K.; Song, J.Y.; Lee, J.B.; An, D.J. Molecular characterization of the full kobuvirus genome in a cat. Genome Announc. 2014, 2, e00420-14. [Google Scholar] [CrossRef]
- Di Martino, B.; Di Profio, F.; Melegari, I.; Marsilio, F.; Martella, V. Detection of feline kobuviruses in diarrhoeic cats, Italy. Vet. Microbiol. 2015, 176, 186–189. [Google Scholar] [CrossRef] [PubMed]
- Niu, T.J.; Yi, S.S.; Wang, X.; Wang, L.H.; Guo, B.Y.; Zhao, L.Y.; Zhang, S.; Dong, H.; Wang, K.; Hu, X.G. Detection and genetic characterization of kobuvirus in cats: The first molecular evidence from Northeast China. Infect. Genet. Evol. 2019, 68, 58–67. [Google Scholar] [CrossRef] [PubMed]
- Cortez, V.; Meliopoulos, V.A.; Karlsson, E.A.; Hargest, V.; Johnson, C.; Schultz-Cherry, S. Astrovirus biology and pathogenesis. Annu. Rev. Virol. 2017, 4, 327–348. [Google Scholar] [CrossRef] [PubMed]
- Yi, S.; Niu, J.; Wang, H.; Dong, G.; Guo, Y.; Dong, H.; Wang, K.; Hu, G. Molecular characterization of feline astrovirus in domestic cats from Northeast China. PLoS ONE 2018, 13, e0205441. [Google Scholar] [CrossRef] [PubMed]
- Soma, T.; Ogata, M.; Ohta, K.; Yamashita, R.; Sasai, K. Prevalence of astrovirus and parvovirus in Japanese domestic cats. J. Vet. Med. Sci. 2020, 82, 1243–1246. [Google Scholar] [CrossRef] [PubMed]
- Cho, Y.Y.; Lim, S.I.; Kim, Y.K.; Song, J.Y.; Lee, J.B.; An, D.J. Molecular characterisation and phylogenetic analysis of feline astrovirus in Korean cats. J. Feline Med. Surg. 2014, 16, 679–683. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Niu, J.; Yi, S.; Dong, G.; Yu, D.; Guo, Y.; Huang, H.; Hu, G. Development and application of a multiplex PCR method for the simultaneous detection and differentiation of feline panleukopenia virus, feline bocavirus, and feline astrovirus. Arch. Virol. 2019, 164, 2761–2768. [Google Scholar] [CrossRef]
- Brussel, K.V.; Wang, X.; Shi, M.; Carrai, M.; Li, J.; Martella, V.; Beatty, J.A.; Holmes, E.C.; Barrs, R. Identification of novel astroviruses in the gastrointestinal tract of domestic cats. Viruses 2020, 12, 1301. [Google Scholar] [CrossRef]
- Diakoudi, G.; Lanave, G.; Capozza, P.; Di Profio, F.; Melegari, I.; Di Martino, B.; Pennisi, M.G.; Elia, G.; Cavalli, A.; Tempesta, M.; et al. Identification of a novel parvovirus in domestic cats. Vet. Microbiol. 2019, 228, 246–251. [Google Scholar] [CrossRef]
- Gauchan, P.; Sasaki, E.; Nakagomi, T.; Do, L.P.; Doan, Y.H.; Mochizuki, M.; Nakagomi, O. Whole genotype constellation of prototype feline rotavirus strains FRV-1 and FRV64 and their phylogenetic relationships with feline-like human rotavirus strains. J. Gen. Virol. 2015, 96 Pt 2, 338–350. [Google Scholar] [CrossRef]
- Matthijnssens, J.; Otto, P.H.; Ciarlet, M.; Desselberger, U.; Van Ranst, M.; Johne, R. VP6-sequence-based cutoff values as a criterion for rotavirus species demarcation. Arch. Virol. 2012, 157, 1177–1182. [Google Scholar] [CrossRef]
- Johne, R.; Schilling-Loeffler, K.; Ulrich, R.G.; Tausch, S.H. Whole genome sequence analysis of a prototype strain of the novel putative rotavirus species L. Viruses 2022, 14, 462. [Google Scholar] [CrossRef]
- Martella, V.; Bányai, K.; Matthijnssens, J.; Buonavoglia, C.; Ciarlet, M. Zoonotic aspects of rotaviruses. Vet. Microbiol. 2010, 140, 246–255. [Google Scholar] [CrossRef] [PubMed]
- Tsugawa, T.; Hoshino, Y. Whole genome sequence and phylogenetic analyses reveal human rotavirus G3P[3] strains Ro1845 and HCR3A are examples of direct virion transmission of canine/feline rotaviruses to humans. Virology 2008, 380, 344–353. [Google Scholar] [CrossRef] [PubMed]
- Kuczera, K.; Orłowska, A.; Smreczak, M.; Frant, M.; Trębas, P.; Rola, J. Prevalence of astroviruses in different animal species in Poland. Viruses 2024, 16, 80. [Google Scholar] [CrossRef] [PubMed]
- Flores, P.S.; Mendes, C.A.S.; Travassos, C.E.P.F.; Mariano, F.A.; Rangel, M.F.N.; Mendes, G.S.; Santos, N. RVA in pet, sheltered, and stray dogs and cats in Brazil. Top. Companion Anim. Med. 2022, 49, 100667. [Google Scholar] [CrossRef] [PubMed]
- Lu, L.; Van Dung, N.; Ivens, A.; Bogaardt, C.; O’Toole, A.; Bryant, J.E.; Carrique-Mas, J.; Van Cuong, N.; Anh, P.H.; Rabaa, M.A.; et al. Genetic diversity and cross-species transmission of kobuviruses in Vietnam. Virus Evol. 2018, 4, vey002. [Google Scholar] [CrossRef]
- Pietsch, C.; Liebert, U.G. Evidence for presumable feline origin of sporadic G6P[9] rotaviruses in humans. Infect. Genet. Evol. 2018, 63, 180–194. [Google Scholar] [CrossRef]
- Hawkins, S.F.C.; Guest, P.C. Multiplex analyses using real-time quantitative PCR. Methods Mol. Biol. 2017, 1546, 125–133. [Google Scholar]
- Zhang, H.; Yan, Z.; Wang, X.; Gaňová, M.; Chang, H.; Laššáková, S.; Korabecna, M.; Neuzil, P. Determination of advantages and limitations of qPCR duplexing in a single fluorescent channel. ACS Omega 2021, 6, 22292–22300. [Google Scholar] [CrossRef]
- Kralik, P.; Ricchi, M. A basic guide to real time PCR in microbial diagnostics: Definitions, parameters, and everything. Front. Microbiol. 2017, 8, 108. [Google Scholar] [CrossRef]
- Zou, J.; Yu, J.; Mu, Y.; Xie, X.; Wang, R.; Wu, H.; Liu, X.; Xu, F.; Wang, J.; Wang, Y. Development of a TaqMan-based multiplex real-time PCR for simultaneous detection of four feline diarrhea-associated viruses. Front. Vet. Sci. 2022, 9, 1005759. [Google Scholar] [CrossRef] [PubMed]
- Dong, G.; Wang, Q.; Niu, J.; Cai, Y.; Guo, Y.; Zhao, H.; Zhang, S.; Wang, K.; Hu, G.; Yi, S. Development and application of a TaqMan-based real-time PCR assay for specifically detecting feline astrovirus. Mol. Cell. Probes 2021, 57, 101729. [Google Scholar] [CrossRef] [PubMed]
- Otto, P.H.; Rosenhain, S.; Elschner, M.C.; Hotzel, H.; Machnowska, P.; Trojnar, E.; Hoffmann, K.; Johne, R. Detection of rotavirus species A, B and C in domestic mammalian animals with diarrhoea and genotyping of bovine species A rotavirus strains. Vet. Microbiol. 2015, 179, 168–176. [Google Scholar] [CrossRef] [PubMed]
- Thieulent, C.J.; Carossino, M.; Peak, L.; Wolfson, W.; Balasuriya, U.B.R. Multiplex one-step RT-qPCR assays for simultaneous detection of SARS-CoV-2 and other enteric viruses of dogs and cats. Viruses 2023, 15, 1890. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.Y.; Wang, Q.; Liang, X.Y.; Zhang, S.; Bao, D.; Zhao, H.; Li, S.B.; Wang, K.; Hu, G.X.; Gao, F.S. An updated review of feline coronavirus: Mind the two biotypes. Virus Res. 2023, 326, 199059. [Google Scholar] [CrossRef]
- Barrs, V.R. Feline panleukopenia: A re-emergent disease. Vet. Clin. N. Am. Small Anim. Pract. 2019, 49, 651–670. [Google Scholar] [CrossRef]
- Biezus, G.; Grima de Cristo, T.; Bassi das Neves, G.; da Silva Casa, M.; Barros Brizola, P.; Silvestre Sombrio, M.; Miletti, L.C.; Assis Casagrande, R. Phylogenetic identification of feline leukemia virus A and B in cats with progressive infection developing into lymphoma and leukemia. Virus Res. 2023, 329, 199093. [Google Scholar] [CrossRef]
- He, M.; Feng, S.; Shi, K.; Shi, Y.; Long, F.; Yin, Y.; Li, Z. One-step triplex TaqMan quantitative reverse transcription polymerase chain reaction for the detection of feline coronavirus, feline panleukopenia virus, and feline leukemia virus. Vet. World 2024, 17, 946–955. [Google Scholar] [CrossRef]
- Zhu, H.; Zhang, H.; Xu, Y.; Laššáková, S.; Korabečná, M.; Neužil, P. PCR past, present and future. Biotechniques 2020, 69, 317–325. [Google Scholar] [CrossRef]
- Xia, L.; Gui, Y.; Yin, R.; Li, N.; Yue, M.; Mu, Y. Concanavalin A-assisted multiplex digital PCR assay for rapid capture and accurate quantification detection of foodborne pathogens. Talanta 2024, 277, 126351. [Google Scholar] [CrossRef]
- Aftab, G.; Arfaee, F.; Akhtardanesh, B.; Nikbakht Brojeni, G. Molecular characterization of canine and feline kobuvirus infections in Iran. Vet. Res. Forum. 2022, 13, 447–450. [Google Scholar] [PubMed]
- Carmona-Vicente, N.; Buesa, J.; Brown, P.A.; Merga, J.Y.; Darby, A.C.; Stavisky, J.; Sadler, L.; Gaskell, R.M.; Dawson, S.; Radford, A.D. Phylogeny and prevalence of kobuviruses in dogs and cats in the UK. Vet. Microbiol. 2013, 164, 246–252. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Guo, X.; Cui, Y.; Zhou, Y.; Yang, K.; Fu, Z.; Sun, J.; Liu, G.; Cheng, B.; Jiang, S.; et al. Genetic characterization and phylogenetic analysis of feline astrovirus from Anhui province in eastern China. 3 Biotech 2020, 10, 354. [Google Scholar] [CrossRef] [PubMed]
- Lawler, P.E.; Cook, K.A.; Williams, H.G.; Archer, L.L.; Schaedel, K.E.; Isaza, N.M.; Wellehan, J.F.X., Jr. Determination of the diversity of astroviruses in feces from cats in Florida. J. Vet. Diagn. Investig. 2018, 30, 275–279. [Google Scholar] [CrossRef] [PubMed]
- German, A.C.; Iturriza-Gómara, M.; Dove, W.; Sandrasegaram, M.; Nakagomi, T.; Nakagomi, O.; Cunliffe, N.; Radford, A.D.; Morgan, K.L. Molecular epidemiology of rotavirus in cats in the United Kingdom. J. Clin. Microbiol. 2015, 53, 455–464. [Google Scholar] [CrossRef]
- Amoroso, M.G.; Serra, F.; Miletti, G.; Cardillo, L.; de Martinis, C.; Marati, L.; Alfano, F.; Ferrara, G.; Pagnini, U.; De Carlo, E.; et al. A retrospective study of viral molecular prevalences in cats in southern Italy (Campania region). Viruses 2022, 14, 2583. [Google Scholar] [CrossRef]
- Chung, J.Y.; Kim, S.H.; Kim, Y.H.; Lee, M.H.; Lee, K.K.; Oem, J.K. Detection and genetic characterization of feline kobuviruses. Virus Genes 2013, 47, 559–562. [Google Scholar] [CrossRef]
- Wohlgemuth, N.; Honce, R.; Schultz-Cherry, S. Astrovirus evolution and emergence. Infect. Genet. Evol. 2019, 69, 30–37. [Google Scholar] [CrossRef]
- De Benedictis, P.; Schultz-Cherry, S.; Burnham, A.; Cattoli, G. Astrovirus infections in humans and animals- molecular biology, genetic diversity, and interspecies transmissions. Infect. Genet. Evol. 2011, 11, 1529–1544. [Google Scholar] [CrossRef]
- Matthijnssens, J.; De Grazia, S.; Piessens, J.; Heylen, E.; Zeller, M.; Giammanco, G.M.; Bányai, K.; Buonavoglia, C.; Ciarlet, M.; Martella, V.; et al. Multiple reassortment and interspecies transmission events contribute to the diversity of feline, canine and feline/canine-like human group A rotavirus strains. Infect. Genet. Evol. 2011, 11, 1396–1406. [Google Scholar] [CrossRef]
- Chamsai, E.; Charoenkul, K.; Udom, K.; Jairak, W.; Chaiyawong, S.; Amonsin, A. Genetic characterization and evidence for multiple reassortments of rotavirus A G3P[3] in dogs and cats in Thailand. Front. Vet. Sci. 2024, 11, 1415771. [Google Scholar] [CrossRef] [PubMed]
- Charoenkul, K.; Janetanakit, T.; Bunpapong, N.; Boonyapisitsopa, S.; Tangwangvivat, R.; Suwannakarn, K.; Theamboonlers, A.; Poovorawan, Y.; Amonsin, A. Molecular characterization identifies intra-host recombination and zoonotic potential of canine rotavirus among dogs from Thailand. Transbound. Emerg. Dis. 2021, 68, 1240–1252. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.; Zhou, L.; Tian, Y.; Wu, X.; Feng, L.; Zhang, X.; Liu, Z.; Pang, S.; Kang, R.; Yu, J.; et al. Genetic characterization of a novel G9P[23] rotavirus A strain identified in southwestern China with evidence of a reassortment event between human and porcine strains. Arch. Virol. 2019, 164, 1229–1232. [Google Scholar] [CrossRef] [PubMed]
- Kunić, V.; Mikuletič, T.; Kogoj, R.; Koritnik, T.; Steyer, A.; Šoprek, S.; Tešović, G.; Konjik, V.; Roksandić Križan, I.; Prišlin, M.; et al. Interspecies transmission of porcine-originated G4P[6] rotavirus A between pigs and humans: A synchronized spatiotemporal approach. Front. Microbiol. 2023, 14, 1194764. [Google Scholar] [CrossRef]
Primer and Probe | Sequence (5′ → 3′) | Targeted Gene | Size/bp |
---|---|---|---|
FeKoV-F | GCCATGGTCTCGCTCTC | VP1 | 86 |
FeKoV-R | ATGTAGGTGAAGCAGGAAAG | ||
FeKoV-P | FAM-GGCAAACCACGACTAACTACACCG-BHQ1 | ||
FeAstV-F | ATCAAACACCAGYGGAACA 1 | ORF2 | 79 |
FeAstV-R | GCTTCCAGTAGCATCCTTAACA | ||
FeAstV-P | CY5-CGTGCATACTCCTCAACCCTGTCC-BHQ3 | ||
FeBuV-F | GCAACAAGACAGGTCCATCT | VP2 | 100 |
FeBuV-R | ATTGTTGGTCTCCCGGTTTAG | ||
FeBuV-P | VIC-ACTCTACCAAACAGACCACGGACCTA-BHQ1 | ||
FRV-F | GTTGAGCTGCCGTCGTC | NSP4 | 132 |
FRV-R | ATTGGTTAAACGGGATTAAGAC | ||
FRV-P | ROX-GGAAGCGGCGGAGTTCTTAACAG-BHQ1 |
Reagent | Volume (µL) | Final Concentration (nM) |
---|---|---|
2 × One Step qPCR Buffer III (TaKaRa) | 10 | / |
Ex Taq HS (TaKaRa) | 0.4 | / |
Prime Script RT Enzyme Mix II (TaKaRa) | 0.4 | / |
FeKoV-F (20 pmol/µL) | 0.2 | 200 |
FeKoV-R (20 pmol/µL) | 0.2 | 200 |
FeKoV-P (20 pmol/µL) | 0.2 | 200 |
FeAstV-F (20 pmol/µL) | 0.3 | 300 |
FeAstV-R (20 pmol/µL) | 0.3 | 300 |
FeAstV-P (20 pmol/µL) | 0.2 | 200 |
FeBuV-F (20 pmol/µL) | 0.4 | 400 |
FeBuV-R (20 pmol/µL) | 0.4 | 400 |
FeBuV-P (20 pmol/µL) | 0.3 | 300 |
FRV-F (20 pmol/µL) | 0.2 | 200 |
FRV-R (20 pmol/µL) | 0.2 | 200 |
FRV-P (20 pmol/µL) | 0.1 | 100 |
Nucleic acid template | 2.0 | / |
Nuclease-free distilled water | 4.2 | / |
Plasmid | Copies/Reaction | Number of Samples | Quadruplex RT-qPCR | |
---|---|---|---|---|
Ct | Hit Rate (%) | |||
p-FeKoV | 400 | 30 | 34.66 | 100 |
200 | 30 | 35.57 | 100 | |
100 | 30 | 36.13 | 86.67 | |
50 | 30 | ND | 0 | |
p-FeAstV | 400 | 30 | 34.64 | 100 |
200 | 30 | 35.55 | 100 | |
100 | 30 | 36.08 | 76.67 | |
50 | 30 | ND | 0 | |
p-FeBuV | 400 | 30 | 35.23 | 100 |
200 | 30 | 36.02 | 100 | |
100 | 30 | 36.39 | 60 | |
50 | 30 | ND | 0 | |
p-FRV | 400 | 30 | 34.55 | 100 |
200 | 30 | 35.50 | 100 | |
100 | 30 | 36.21 | 80 | |
50 | 30 | ND | 0 |
Plasmid | Concentration (Copies/µL) | Intra-Assay Ct Value | Inter-Assay Ct Value | ||||
---|---|---|---|---|---|---|---|
SD | CV/% | SD | CV/% | ||||
p-FeKoV | 1.0 × 108 | 13.253 | 0.130 | 0.98 | 13.571 | 0.215 | 1.59 |
1.0 × 106 | 19.219 | 0.151 | 0.78 | 19.644 | 0.154 | 0.78 | |
1.0 × 104 | 25.762 | 0.199 | 0.77 | 26.039 | 0.062 | 0.24 | |
p-FeAstV | 1.0 × 108 | 13.939 | 0.159 | 1.14 | 13.706 | 0.169 | 1.23 |
1.0 × 106 | 19.915 | 0.072 | 0.36 | 19.692 | 0.029 | 0.15 | |
1.0 × 104 | 25.992 | 0.038 | 0.15 | 26.094 | 0.169 | 0.65 | |
p-FeBuV | 1.0 × 108 | 14.515 | 0.098 | 0.68 | 14.219 | 0.192 | 1.35 |
1.0 × 106 | 19.650 | 0.093 | 0.47 | 20.048 | 0.155 | 0.77 | |
1.0 × 104 | 25.611 | 0.040 | 0.15 | 26.036 | 0.145 | 0.56 | |
p-FRV | 1.0 × 108 | 13.502 | 0.187 | 1.38 | 13.013 | 0.153 | 1.18 |
1.0 × 106 | 19.134 | 0.308 | 1.61 | 19.636 | 0.124 | 0.63 | |
1.0 × 104 | 25.004 | 0.081 | 0.32 | 25.947 | 0.052 | 0.20 |
Region | Number | Positive Samples | |||||||
---|---|---|---|---|---|---|---|---|---|
FeKoV | FeAstV | FeBuV | FRV | FeAstV+ FeKoV | FeAstV+ FRV | FeKoV+ FRV | FeKoV+ FeBuV | ||
Beihai | 38 | 2 | 4 | 0 | 0 | 1 | 0 | 0 | 0 |
Hechi | 21 | 0 | 6 | 0 | 1 | 0 | 1 | 0 | 0 |
Guilin | 112 | 1 | 10 | 0 | 0 | 0 | 0 | 0 | 0 |
Baise | 217 | 7 | 39 | 1 | 5 | 5 | 2 | 0 | 0 |
Qinzhou | 146 | 2 | 4 | 0 | 3 | 0 | 1 | 0 | 0 |
Yulin | 361 | 8 | 16 | 1 | 1 | 2 | 0 | 1 | 0 |
Nanning | 572 | 7 | 66 | 2 | 4 | 2 | 1 | 0 | 1 |
Liuzhou | 402 | 9 | 30 | 2 | 0 | 2 | 0 | 0 | 0 |
Total | 1869 | 36 | 175 | 6 | 14 | 12 | 5 | 1 | 1 |
Positivity rate (%) | 1.93 | 9.36 | 0.32 | 0.75 | 0.64 | 0.27 | 0.05 | 0.05 |
The Quadruplex RT-qPCR | The Reported Reference qPCR | Total | Clinical Sensitivity | Clinical Specificity | ||
---|---|---|---|---|---|---|
Positive | Negative | |||||
FeKoV | Positive | 32 | 4 | 36 | 91.43% | 99.78% |
Negative | 3 | 1830 | 1833 | |||
Total | 35 | 1834 | 1869 | |||
FeAstV | Positive | 159 | 16 | 175 | 95.21% | 99.06% |
Negative | 8 | 1686 | 1694 | |||
Total | 167 | 1702 | 1869 | |||
FeBuV | Positive | 6 | 0 | 6 | 100% | 100% |
Negative | 0 | 1863 | 1863 | |||
Total | 6 | 1863 | 1869 | |||
FRV | Positive | 14 | 0 | 14 | 100% | 100% |
Negative | 0 | 1855 | 1855 | |||
Total | 14 | 1855 | 1869 |
Detection Method | Positive Samples | |||
---|---|---|---|---|
FeKoV | FeAstV | FeBuV | FRV | |
The quadruplex RT-qPCR | 1.93% (36/1869) | 9.36% (175/1869) | 0.32% (6/1869) | 0.75% (14/1869) |
The reported reference qPCR | 1.87% (35/1869) | 8.94% (167/1869) | 0.32% (6/1869) | 0.75% (14/1869) |
Overall coincidence rate | 99.63% | 98.72% | 100% | 100% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, K.; He, M.; Long, F.; He, J.; Yin, Y.; Feng, S.; Li, Z. Development of a Quadruplex RT-qPCR for the Detection of Feline Kobuvirus, Feline Astrovirus, Feline Bufavirus, and Feline Rotavirus. Microbiol. Res. 2024, 15, 2129-2145. https://doi.org/10.3390/microbiolres15040143
Shi K, He M, Long F, He J, Yin Y, Feng S, Li Z. Development of a Quadruplex RT-qPCR for the Detection of Feline Kobuvirus, Feline Astrovirus, Feline Bufavirus, and Feline Rotavirus. Microbiology Research. 2024; 15(4):2129-2145. https://doi.org/10.3390/microbiolres15040143
Chicago/Turabian StyleShi, Kaichuang, Mengyi He, Feng Long, Junxian He, Yanwen Yin, Shuping Feng, and Zongqiang Li. 2024. "Development of a Quadruplex RT-qPCR for the Detection of Feline Kobuvirus, Feline Astrovirus, Feline Bufavirus, and Feline Rotavirus" Microbiology Research 15, no. 4: 2129-2145. https://doi.org/10.3390/microbiolres15040143
APA StyleShi, K., He, M., Long, F., He, J., Yin, Y., Feng, S., & Li, Z. (2024). Development of a Quadruplex RT-qPCR for the Detection of Feline Kobuvirus, Feline Astrovirus, Feline Bufavirus, and Feline Rotavirus. Microbiology Research, 15(4), 2129-2145. https://doi.org/10.3390/microbiolres15040143