Infection Frequency and Allelic Variants of Toxoplasma gondii in Wildlife from the Panama Canal Zone

Abstract

Panama has a large number of wild animal species, which could host a highly diverse amount of genetic variants of Toxoplasma gondii (T. gondii). In this context, we highlight the importance of understanding the population structure of T. gondii in Panamanian wildlife and the genetic variants that can be rapidly transferred to domestic environments. This study analyzed the infection frequency and allelic composition of T. gondii in different tissue samples from wild animals. The infection frequency was measured by the PCR technique using the B1 gene as a molecular marker. The results showed a high frequency (65.6%) of infection in tissue samples collected from 221 wild animals. Stratified analyses for bird and mammal samples showed positivity rates of 67.2% and 70.12%, respectively, with no statistically significant differences. Infection frequency was also measured in five types of organs (brain, liver, heart, lung, and skeletal muscle), which showed homogeneous frequencies. The genetic diversity of the T. gondii population contained in the tissues of wild animals was analyzed by the Multilocus Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) technique, using five genes called SAG1, SAG2, SAG3, GRA6, and Apico. This analysis revealed the presence of alleles of these genes corresponding to T. gondii lineages I, II, and III. Allele III was only identified with the Apico gene in a single reptile individual analyzed. Our findings indicated diverse allelic distribution at the analyzed loci, suggesting that the tissues were probably infected by non-archetypal individuals of T. gondii.

1. Introduction

Toxoplasma gondii (T. gondii) is an obligate intracellular parasite with the ability to infect and multiply in a wide variety of vertebrate hosts from different geographic regions of the world [1]. This parasite has a complex life cycle that includes two forms of reproduction, asexual and sexual [2,3]. The asexual phase can occur in practically any nucleated cell from different classes of animals, such as mammals (terrestrial and marine) and birds, through ingestion of tissue cysts or oocysts [4,5]. T. gondii DNA has also been detected in reptiles, specifically snakes [6]. However, other studies have revealed the inability of this parasite to multiply in cold-blooded animals [7,8]. In the case of mammals and birds, if the infection occurs by oocysts ingestion, the sporozoites are released by the actions of digestive enzymes and then penetrate the host’s intestinal epithelium, where they differentiate into haploid tachyzoites that multiply by endodyogeny, producing new daughter cells genetically identical to the mother cell [9,10]. The sexual phase is restricted only to feline species; this phase takes place only in the enterocytes of the intestines of these animals, where the fusion of haploid macrogametes and microgametes occurs, giving rise to the formation of a diploid zygote [2]. At this point the opportunity opens for gene exchange between different strains of T. gondii. Subsequently, this zygote forms a non-sporulated diploid oocyst, which goes through a period of maturation (sporogony) and meiotic division after shedding in the cats’ feces [2,11]. This meiotic process produces haploid sporozoites within the now-sporulated oocyst, which is ready to infect a new host [12]. Although this phase is key for the generation of new genetic mixtures, this mode of reproduction is not so common in wildlife [13]. The main reason is that intermediate hosts appear to develop strong immunity when experiencing a primary infection with T. gondii, restricting simultaneous infections with similar parasitic loads from two different strains [14]. The multiplication of the parasite through these two reproductive phases has resulted in the generation of the population structure of T. gondii, which can vary significantly depending on the region [12].

Genetic characterization studies of isolates from North America and Europe through Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) showed a clonal population pattern, and subsequently, the study of a larger number of isolates revealed the formation of three main groups called I, II, and III [13,15,16]. In addition, recombination events were described as unusual in these regions [13]. Nonetheless, in South America greater diversity and genetic separation have been found between the reported strains, with genetic characteristics atypical of the previously described lineages I, II, and III [17,18,19,20,21]. In countries such as French Guiana and Brazil, the characterization of T. gondii strains from humans and chickens has shown a high rate of outcrossing between different genotypes [17,18,22,23]. T. gondii strains isolated from immunocompetent patients with severe pathologies in French Guiana are a clear example of atypical genotypes acquired by humans living in tropical forest areas due to their consumption of undercooked food, hunting of wild animals, and ingestion of untreated river water [18]. In Panama little is known about the genetic variability of this parasite and its distribution in domestic, peri-domestic, and wild environments. Currently, the epidemiological data reported in different regions of the province of Panama and in West Panama have shown high prevalence percentages for T. gondii infection in pregnant women (44.41%) and in dogs and cats, both strays (23.73%) and pets (30.73%) [24,25,26]. In addition, a high frequency of infection in pigs (32.1%) from different provinces of Panama has also been reported [27]. Therefore, in this study we perform a preliminary analysis of the population structure of T. gondii in tissue samples from wild animals using multilocus analysis based on PCR-RFLP. In addition, the B1 gene is used as a molecular marker to measure the frequency of infection by this parasite in wildlife from forested regions of the Panama Canal Zone.

2. Materials and Methods

2.1. Permission to Access Resources

Access to biological resources in the Summit Municipal Park (Panama) was evaluated and authorized by the Directorate of Protected Areas and Biodiversity of the Ministry of the Environment (SC/A-7-2020).

2.2. Geographic Area Studied

All biological samples from wild animals used in this study were collected at Summit Municipal Park (9°03′58″ N 79°38′44″ W), which receives rescued or convalescent wild animals from different forested areas adjacent to the Panamá Canal Zone. In this case, the samples came from five forested areas called Gatun Lake (GL), Metropolitan Natural Park (MNP), Camino de Cruces National Park (CCNP), Soberania National Park (SNP), and Arraijan Protected Forest (APF). Summit Municipal Park has a small wildlife refuge where animals receive veterinary care and are returned to their natural environment. Animals that do not recover and are unable to return to the forest are kept in the park under the care of veterinarians and animal welfare professionals. All these forest areas are part of the biological corridor of the Panama Canal Zone (9°04′27″ N 79°39′35″ W) and are located between the provinces of Panama, West Panama, and Colón. The coordinates were defined using GeoDa software, version 1.12 (Center for Spatial Data Science—University of Chicago, Chicago, IL, USA) (Figure 1) [28].

2.3. Sample Collection

Tissue samples were collected during routine necropsy performed at the Summit Municipal Park on wild animals that died naturally. The necropsies were carried out by veterinary medical personnel. Approximately 20 mg of brain, liver, heart, lung, and skeletal muscle were extracted from 221 wild animals, representing 81 species which were distributed as follows: 122 birds (53 species), 77 mammals (21 species), and 22 reptiles (7 species). In addition, it was also possible to collect around 10 mg of eye tissue samples from 30 mammals and 20 birds. The tissues samples were placed in microcentrifuge tubes containing 2 mL of 70% Ethanol. Subsequently, the samples were frozen at −20 °C and stored at the Summit Municipal Park until later analysis.

2.4. DNA Extraction and Quantification

Approximately 10 mg of tissue was weighed and DNA extraction was performed using the commercial QIAGEN kit (Puregene Cell and Tissue Kit, Germantown, MD, USA). The procedure was carried out following the manufacturer’s protocol. DNA was eluted in 100 μL of DNA hydration solution. All extracted samples were stored at −20 °C until analysis.

2.5. Detection of T. gondii DNA in Tissue Samples from Wild Animals

The detection of parasite DNA in the tissue samples was performed using the B1 gene as a molecular marker for screening. The DNA amplification process was carried out by PCR in two stages, following previously described methodologies [29]. The first PCR consisted of the amplification of a 286-base pair (bp) fragment at a DNA concentration of 10 ng/µL in a final reaction volume of 25 µL [30]. The products obtained from the first PCR reaction were subjected to a second reaction using the nested PCR technique. The second round amplified a fragment of 115 base pairs of the sequence encoding the B1 gene using internal primers previously defined at a concentration of 10 µM [31]. For each PCR reaction, T. gondii DNA from the reference strain RH was used as a positive control. The products were examined by 1.5% agarose gel electrophoresis containing ethidium bromide and visualized in a ChemiDoc Imaging System (BIO RAD, Hercules, CA, USA).

2.6. Allelic Variants of T. gondii Determined by Multilocus PCR-RFLP Markers

The population structure of T. gondii was analyzed using eighteen tissue samples obtained from thirteen wild animals previously identified as positive for T. gondii infection through the B1 gene. The alleles of five T. gondii genes, called SAG1, SAG2, SAG3, GRA6, and Apico, were evaluated in each of the tissue samples using the Multilocus PCR-RFLP marker method [15,32]. For the SAG2 marker, the region denominated as Alternative SAG2 (alt. SAG2) was amplified and digested according to Lehmann et al. (2000) and C. Su et al. (2006) [32,33]. Each of the other molecular markers were used individually to amplify the eighteen tissue samples according to previously described procedures [13,15,32,33,34,35,36]. The details of the methodology, such as external and internal primers, sizes of PCR products, restriction enzymes, conditions for enzymatic restriction, and band size after enzymatic digestion, are summarized in

Table 1. Methodological details of multilocus PCR-RFLP analysis.

Molecular Markers	External and Internal Primers	Internal PCR Product Size	Restriction Enzymes	Conditions of Enzymatic Restriction	Band Size (bp) after Enzymatic Digestion	Reference
SAG1 (Chr. VIII)	Fext:GTTCTAACCACGCACCCTGAG Rext2:AAGAGTGGGAGGCTCTGTGA Fs2:CAATGTGCACCTGTAGGAAGC R:GTGGTTCTCCGTCGGTGTGAG	390 pb	Sau96I + HaeII	37 °C 1 h. 2.5% gel.	I: 334, 56 II/III: 293, 97	Grigg et al. (2001) [35]
alt.SAG2 (Chr. VIII)	F:GGAACGCGAACAATGAGTTT R:GCACTGTTGTCCAGGGTTTT Fa:ACCCATCTGCGAAGAAAACG Ra:ATTTCGACCAGCGGGAGCAC	546 pb	HinfI + Taq I	37 °C 30 min, 65 °C 30 min. 2.5% gel.	I: 350, 175 II: 350, 120 III: 360, 175	Khan et al. (2005) [36] C. Su et al. (2006) [37]
SAG3 (Chr. XII)	F:CAACTCTCACCATTCCACCC R:GCGCGTTGTTAGACAAGACA P43S2:TCTTGTCGGGTGTTCACTCA P43AS2:CACAAGGAGACCGAGAAGGA	225 pb	NciI	37 °C 1 h. 2.5% gel.	I: 100, 60 II: 220 III: 180, 60	Grigg et al. (2001) [35]
GRA6 (Chr. X)	F:ATTTGTGTTTCCGAGCAGGT R:GCACCTTCGCTTGTGGTT F-1:TTTCCGAGCAGGTGACCT R1x:TCGCCGAAGAGTTGACATAG	344 pb	MseI	37 °C 1 h. 2.5% gel.	I: 260, 84 II: 181, 163 III: 163, 97, 84	Fazaeli et al. (2000) [34] Khan et al. (2005) [36] C. Su et al. (2006) [38]
Apico (Plastid)	Apico-Fext:TGGTTTTAACCCTAGATTGTGG Apico -Rext: AAACGGAATTAATGAGATTTGAA Apico-F: TGCAAATTCTTGAATTCTCAGTT Apico-R: GGGATTCGAACCCTTGATA	640 pb	AflII + DdeI	37 °C 1 h. 3% gel.	I: 317, 107, 69 II: 167, 150, 107, 69 III: 317, 117, 107, 69	C. Su et al. (2006) [38]

. The percentage of agarose for the gels used in the enzymatic digestion with almost all molecular markers was 2.5%, aside from the Apico marker, which used 3%. DNA samples extracted from the reference strains RH, PDS, and CTG, previously characterized as type I, II, and III, respectively, were used as positive controls for the PCR-RFLP test.

2.7. Statistical Analysis

The frequencies of T. gondii infection found in the bird and mammal classes were analyzed through the chi-squared test, in order to estimate the statistical differences between the two groups. This test was also used to compare the frequencies of T. gondii infection in various organs and tissues of the host (liver, heart, lung, brain, and skeletal muscle). The analyses were performed using GraphPad Prism version 6.1 (GraphPad Software Inc., San Diego, CA, USA), with a statistical significance value of 0.05 [38].

3. Results

3.1. Frequency of T. gondii Infection in Different Classes of Wild Animals

The detection of the T. gondii parasite in tissue samples from wild animals was performed using the B1 gene as a molecular marker. An overall frequency of T. gondii infection of 65.6% (145/221) was observed in the total number of wild animals analyzed (

Table 2. Frequency of T. gondii infections in different organs of birds, mammals, and reptiles.

No. (%) (95% CI) of Positive Samples
No. Total Samples		No. Total Positive	No. Total Birds		No. Total Mammals		No. Total Reptiles
221		145 (65.6%) (58.94–71.85)	122	82 (67.2%) (58.13–75.44)	77	54 (70.12%) (58.62–80.03)	22	12 (54.5%) (32.21–75.61)
Organs analyzed
Brain	146	50 (34.24%) (22.60–42.55)	77	25 (32.46%) (22.23–44.10)	56	22 (39.28%) (26.50–53.25)	13	3 (23.07%) (5.04–53.81)
Liver	146	48 (32.87%) (25.34–41.13)	77	25 (32.46%) (22.23–44.10)	56	20 (35.71%) (23.36–49.64)	13	3 (23.07%) (5.04–53.81)
Heart	146	46 (31.50%) (24.08–39.71)	77	23 (29.87%) (19.97–41.38)	56	20 (35.71%) (23.36–49.64)	13	3 (23.07%) (5.04–53.81)
Lung	146	55 (37.67%) (29.79–46.06)	77	25 (32.46%) (22.23–44.10)	56	17 (30.35%) (18.78–44.10)	13	6 (46.15%) (19.22–74.87)
S. muscle	146	47 (32.19%) (24.71–40.42)	77	24 (31.16%) (21.09–42.74)	56	20 (35.71%) (23.36–49.64)	13	3 (23.07%) (5.04–53.81)
Total	730	246 (33.69%) (30.27–37.26)	385	122 (31.68%) (27.07–36.59)	280	99 (35.35%) (29.76–41.27)	65	18 (27.69%) (17.31–40.19)
CI = Confidence Interval

). The animals’ classes, such as birds, mammals, and reptiles, were analyzed separately and positive percentages of 67.2% (82/122), 70.12% (54/77), and 54.5% (12/22) were obtained, respectively (Table 2). Statistical analyses did not show significant differences between the percentages of positivity observed in birds and mammals (χ² = 0.1856, df = 2, p = 0.9114). The reptile population was not included in the statistical analyses carried out due to the low number of individuals sampled.

3.2. Frequency of T. gondii Infection in Five Organs from Different Classes of Wild Animal

We analyzed five different organs (brain, liver, heart, lung, and skeletal muscle) from 77 birds, 56 mammals, and 13 reptiles. The frequency of T. gondii infection observed was quite homogeneous among the five organs analyzed (Table 2). Statistical analyses using the chi-squared test with a significance level of 0.05 showed no significant differences between the percentages of total positivity observed for each of the organs evaluated (brain vs liver, heart, lung, and skeletal muscle: χ² = 1.557, df = 8, p = 0.9917; liver vs heart, lung, and skeletal muscle: χ² = 1.536, df = 6, p = 0.9571; heart vs lung and skeletal muscle: χ² = 1.490, df = 4, p = 0.8284; lung vs skeletal muscle: χ² = 0.9643, df = 2, p = 0.6175). Furthermore, the frequency of T. gondii infection did not vary when the five organs were analyzed in each of the animal classes (bird, mammal, and reptile) (Table 2).

3.3. Allelic Profiles of T. gondii in Tissues Samples from Wild Animals

DNA samples from tissues of wild animals (birds, mammals, and reptiles) previously identified as having T. gondii infection were analyzed using five molecular markers [SAG1, alternative SAG2 (alt. SAG2), SAG3, GRA6, and Apico], which showed the allelic profile of T. gondii in each of the eighteen samples analyzed. The overall results of the genetic analyses of the tissue samples using five molecular markers showed the characteristic banding patterns used to define alleles I, II, and III of T. gondii (Figure 2 and Figure 3). With the SAG1 gene, we were able to define allele I in four of the analyzed samples (2, 10, 13, and 16), and the other samples presented a single band pattern for allele II or III; it is important to highlight that this marker does not make a clear separation of the bands to define alleles II and III, as has been previously shown in other studies (Figure 2A) [38]. One of the samples analyzed with SAG1 failed when digestion was performed, and sample number five showed an indefinite band pattern. When the tissues samples were analyzed with the alt. SAG2 marker, all samples displayed a banding pattern characteristic of allele II (Figure 2B). The analysis of samples with SAG3 revealed profiles related to the alleles I and II (Figure 2C). GRA6 also showed profiles including I and II in almost all samples analyzed (Figure 3A). Sample number four, from an armadillo brain, could not be defined with the GRA6 gene because it showed a different banding pattern than the positive controls for the reference strains RH, PDS, and CTG (Figure 3A). Allele III was only observed with the Apico gene in two reptile samples; the rest of the samples for this gene were defined as allele I (Figure 3B). The allelic composition of each tissue sample was determined by multilocus analysis of the five genes. This analysis showed allelic patterns that were repeated in different tissue samples. In addition, six unique patterns that were not repeated in any sample were also observed (

Table 3. T. gondii alleles detected in tissue samples from wild animals.

No.	Code	Species	Animal Type	Diet	Behavior	Tissue	Allelic Profiles of Five Genes of T. gondii
							SAG1	alt. SAG2	SAG3	GRA6	Apico
1	135	Hydrochoerus hydrochaeris	Mammal	Herbivorous	Terrestrial	Liver	II/III	II	I	II	I
2	135	Hydrochoerus hydrochaeris	Mammal	Herbivorous	Terrestrial	Brain	I	II	I	I	I
3	103	Tamandua mexicana	Mammal	Myrmecophage	A/T	S. muscle	_	II	II	I	I
4	139	Dasypus novemcinctus	Mammal	M/F	Terrestrial	Brain	II/III	II	I	und	I
5	141	Dasypus novemcinctus	Mammal	M/F	Terrestrial	Heart	_	II	II	II	I
6	128	Potus flavus	Mammal	Omnivore	Arboreal	Liver	II/III	II	II	II	I
7	128	Potus flavus	Mammal	Omnivore	Arboreal	Lung	II/III	II	II	II	I
8	111	Saguinus geoffroyi	Mammal	Omnivore	Arboreal	Brain	II/III	II	II	I	I
9	98	Potus flavus	Mammal	Omnivore	Arboreal	Brain	II/III	II	II	II	I
10	159	Potos flavus	Mammal	Omnivore	Arboreal	Liver	I	II	II	II	I
11	107	Nyctidromus albicolis	Bird	Insectivore	A/T	Eye	II/III	II	II	II	I
12	150	Piaya cayana	Bird	Omnivore	Arboreal	Liver	II/III	II	II	II	I
13	150	Piaya cayana	Bird	Omnivore	Arboreal	Lung	I	II	II	II	I
14	153	Buteo platypterus	Bird	Carnivorous	Arboreal	S. muscle	II/III	II	II	I	I
15	153	Buteo platypterus	Bird	Carnivorous	Arboreal	Liver	II/III	II	II	II	I
16	167	Turdus grayi	Bird	Omnivore	Arboreal	Lung	I	II	I	II	I
17	142	Iguana iguana	Reptile	Omnivore	Arboreal	Lung	II/III	II	II	I	III
18	142	Iguana iguana	Reptile	Omnivore	Arboreal	Heart	II/III	II	I	I	III

The allelic composition analyzed in each of the eighteen samples has been highlighted in black, red, blue, or green. The patterns highlighted in blue were repeated in two different samples, those highlighted in red in six samples, and those highlighted in green in two samples. M/F = Myrmecophage/Frugivore, A/T = Arboreal/Terricolous, S. muscle = Skeletal muscle, I = Allele I, II = Allele II, III = Allele III, II/III = Allele II or III, und = undefined, (_) failure in the enzymatic digestion process.

). Different allelic compositions were also observed in some tissues from the same animal, such as Hydrochoerus hydrochaeris (135), Piaya cayana (150), Buteo platypterus (153), and Iguana iguana (142). Potos flavus (128) was the only animal that presented the same allelic composition in both tissues (Table 3).

4. Discussion

Panama is considered one of the world’s biodiversity hotspots due to its large number of animal and plant species [39]. Its role as a biological corridor, from its emergence as an isthmus until today, has likely contributed to its great biodiversity [40]. The interaction and migration of wild animals between the land masses of North and South America likely facilitated the genetic exchange of the parasites in this region. To date, eighteen species of felines have been reported in the Americas, six of which are found in Panama [41,42,43]. Each of these species has different preferences regarding the prey it hunts [44], leading to diverse interactions with intermediate hosts of the parasite. This can increase the spread of the parasite and the chances of genetic exchange between different genetic variants. In fact, in the South and Central America regions, the population structure of T. gondii seems to be more diverse than in the Northern Hemisphere countries [45]. In these regions, no genotype seems to be dominant. However, genotype #2 (Type III) has been identified as one of the most frequent in Panama, Peru, and Grenada, despite the small sample size [45]. Another genomic analysis of a Panamanian strain showed diverse allelic compositions at different loci of seven (1a, 5, 7a, 8, 9, 10, and 12) of the twelve chromosomes analyzed. Some chromosomes showed a composition of two (alleles II and Amazonian) or even three different alleles (I, III, and Amazonian) [46]. These alleles were consistent with the alleles observed in this study, where the three main clonal alleles (I, II, and III) of T. gondii were identified except for the Amazonian allele, which was not examined in this study. Considering that simultaneous infections by different individuals of T. gondii in the same host are rare, we suggest that most of the tissues analyzed in this study consisted mainly of a clonal population of T. gondii, which was formed by non-archetypal individuals that had a diverse allelic distribution (I, II, and III) across the analyzed loci (Table 3). No evidence of archetypal individuals was observed in the tissues analyzed. The overall analysis of the allelic profiles of five different genes showed three distinct allelic patterns or compositions that were repeated in several tissue samples (Table 3). This finding suggests that these tissues could have been infected by the same clonal population, since these tissues showed the same allelic composition. However, we cannot rule out two important facts: 1. The genetic characterization of T. gondii requires at least ten molecular markers [32,38]. In this study, it was only possible to amplify five of them. Therefore, we do not know the allelic profiles of the other five markers, which could vary between the allelic patterns that were repeated; 2. There is a possibility of finding heterogeneous populations of T. gondii in the same tissue, i.e., mixed infections with two genetically different strains of T. gondii. In the case of a mixed infection, it is possible that some of the genes used in this study detected the allelic profiles of different strains of T. gondii. Unfortunately, it was not possible to use PCR to amplify the fragments of the other five molecular markers used in the genotyping of T. gondii, probably due to the type of sample analyzed in this study. The analysis of tissue samples is more difficult than that of DNA samples from pure cultures of T. gondii. These T. gondii DNA samples, obtained from the tissues of wild animals, probably also contain DNA from other microorganisms that naturally infect these animals. This fact can generate a series of non-specific bands, which hinder the enzymatic digestion process and the visualization of the specific band pattern for each of the molecular markers. Another factor to consider is the phase of infection of the parasite in the host (acute or chronic phase). It is possible that acute infections or the reactivation of an old infection may facilitate the amplification of parasite DNA with different molecular markers. Therefore, the quality of the sample and the stage of infection in the animal could be two factors that probably influenced the direct amplification of the parasite DNA in our tissue samples. Recent studies have revealed mixed infections in tissue samples analyzed using SNP genotyping, a technique primarily based on the identification of single nucleotide polymorphisms (SNP) at specific loci by sequencing. Studies conducted in the Caribbean region of Mexico detected five different sequences of the SAG3 locus in blood samples from a single feline [47]. This variation among the detected sequences indicated simultaneous infection by five different strains of T. gondii in the same feline. Another study carried out on tissue samples from several bobcats (Lynx rufus) from Mississippi (USA) detected, through sequencing techniques, multiple co-infections with recombinant strains of T. gondii which showed the presence of the type II allele in GRA7 and type X alleles (HG-12) at GRA6. The authors suggested that these felines were exposed to several strains of the parasite throughout their lives [48]. In our study, the analysis of different organs from the same animal showed different allelic patterns, suggesting the possibility of co-infections with different strains of T. gondii (Table 3). Considering these findings, it is likely that our results only reflect a fraction of the complexity of the T. gondii population contained in wild animal tissues. The population of T. gondii within the tissues could be composed as follows: 1. Clones derived from the same parent; 2. Clones derived from different parents but descending from the same ancestral lineage; 3. Clones that descend from different ancestral lineages. It is important to highlight that the samples analyzed in this study are not T. gondii isolates that underwent selection in a murine model. Although multilocus analysis is one of the most important, reproducible, and frequently used tools for genotyping T. gondii “isolates”, this method cannot visualize all the polymorphism or nucleotide variability that amplified fragments of a gene may have. Therefore, the results of this study show the allelic composition contained in the tissues of wild animals; this diverse allelic composition suggests that the T. gondii strains circulating in wildlife have probably undergone genetic crosses that produced non-archetypal individuals. However, further analysis of these samples using sequencing tools should be performed. This will provide a better understanding of the actual polymorphism of individual T. gondii strains infecting the tissues of wild animals. Another important analysis performed during this study concerned the frequency of T. gondii infection in wild animals, which was shown to be similar (65.6%) to that in southern countries such as Brazil (62.4%) and Chile (67.7%), where the genetic diversity of T. gondii is quite broad (Table 2) [49,50]. Through these results, it is possible to infer that the likelihood of exposure to the parasite in the forested areas of the Panama Canal Zone is high, and the transmission routes are quite effective. In the wild cycle, the ingestion of tissues infected with T. gondii cysts through oral carnivorism and the consumption of water contaminated with oocysts of the parasite are probably the main sources of infection, followed by interaction with contaminated soil. The bird and mammal populations analyzed in this study maintain similar frequencies of T. gondii infection in wild environments, although they have great differences in terms of species diversity, behavior, and diet. The reptile population showed high percentages of infection (54.5%), but could not be statistically compared with the other populations (birds and mammals) due to the low sample number for this class of animal (Table 2). Although T. gondii DNA was identified in the tissues of these animals, other studies have shown that in cold-blooded animals infected with T. gondii, tachyzoites can remain in the tissues for varying periods of time, but fail to multiply and establish an efficient infection [7,8]. The results of this study show that the T. gondii strains that infected reptile tissues had greater allelic diversity, since the three main T. gondii alleles (I, II, III) were observed. Furthermore, these tissue samples, taken from the lung and heart of a single reptile, showed differences in their allelic compositions (Table 3). It is likely that these infections may be related to the reptile’s capacity to move between terrestrial and aquatic environments, meaning that these animals may have a greater probability of becoming infected with less common strains of T. gondii [51,52]. Although the iguana is a primarily arboreal animal, it can submerge itself in water when it feels the need to regulate its body temperature [53]. These high frequencies of infection found in three different classes of animal suggest that both terrestrial and aquatic wild environments could be highly contaminated with oocysts of the parasite. However, more studies on the contamination of water sources with oocysts of T. gondii are necessary. Our findings also show a high frequency of infection in the tissues of five different organs from the mammalian and bird classes, indicating that the parasite has a great capacity to infect and migrate to different organs.

5. Conclusions

The high frequencies of T. gondii infection observed in the tissues of wild animals reflect the high exposure to the parasite and the effectiveness of transmission cycles in the tropical forests of the Panama Canal Zone. Instances of exposure to the parasite are probably frequent for the wildlife due to high environmental contamination. In addition, the dynamic interaction between the host and the pathogen in different hosts has probably contributed to gene flow and enriched the allelic diversity of T. gondii in these regions. The population structure of T. gondii found in each of the tissues analyzed appears to be composed of non-archetypal individuals that have multiplied and disseminated clonally.

6. Limitations

The main limitations we faced in this work was the inability to amplify the other molecular markers (L358, BTUB, c22-8, c29-2, and PK1) used in the genotyping of T. gondii. This is important since we were unable to determine the presence of other alleles (u-1, u-2) previously described in the South American region.