Next Article in Journal
Pyuria Is Associated with Dysbiosis of the Urinary Microbiota in Type 2 Diabetes Patients Receiving Sodium–Glucose Cotransporter 2 Inhibitors
Previous Article in Journal
Stenotrophomonas maltophilia and Its Ability to Form Biofilms
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microbiology Research
Volume 14
Issue 1
10.3390/microbiolres14010002
microbiolres-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Serum PCR Diagnosis of Brucella melitensis Infection in Rev. 1 Vaccinated Sheep

by
Shubham Mathur
1,2,
Svetlana Bardenstein
3,
Daniel Cohen
1 and
Menachem Banai
2,*
1
Department of Epidemiology and Preventive Medicine, School of Public Health, Tel Aviv University, Tel Aviv 6997804, Israel
2
Department of Bacteriology, Kimron Veterinary Institute, Beit Dagan 5020000, Israel
3
Department of Serology, Kimron Veterinary Institute, Beit Dagan 5020000, Israel
*
Author to whom correspondence should be addressed.
Microbiol. Res. 2023, 14(1), 21-33; https://doi.org/10.3390/microbiolres14010002
Submission received: 21 November 2022 / Revised: 15 December 2022 / Accepted: 20 December 2022 / Published: 23 December 2022
Browse Figures
Versions Notes

Abstract

:
Serological diagnosis provides a robust and effective approach to monitoring and controlling small ruminant brucellosis. Brucella melitensis Rev. 1 is a live vaccine strain used in prophylactic vaccination against small ruminant brucellosis. Because the vaccine strain shares identical serological antigens with the corresponding field strains, differentiating infected from vaccinated animals (DIVA) serological responses hamper surveillance campaigns and interventions that involve vaccination. We have developed a serum PCR-based approach in which we amplify and sequence Brucella omp2a as a DIVA solution and tRNA (uracil-5-)-methyltransferase as a species marker in the serum samples to determine the etiological agent involved in brucellosis field cases. Using this method, we identified the involvement of both the Rev. 1 vaccine strain and a field strain in an outbreak of brucellosis in a flock. This method represents a novel approach in studying the etiology of brucellosis using serum samples as a source of the pathogen’s DNA.

1. Introduction

Brucellosis is an important global zoonosis that is caused by Gram-negative bacteria of genus Brucella [1]. Historically, Brucella species have been classified based upon their growth characteristics on different substrates, sensitivity to brucellaphages and natural affiliation of a strain to a specific mammal host. With the advent of the post-genomic era, genus Brucella has been expanded to include atypical isolates that did not fit with the conventional scheme and yet shared genomic similarity with classical type strains. To date, 12 species have been validly published, i.e., B. melitensis, B. abortus, B. suis, B. neotomae, B. ovis, B. canis, B. pinnipedialis, B. ceti. B. microti, B. innopinata, B. vulpis, B. papionis, among which the first six species are considered “classical” in accordance with their high genomic and metabolic homogeneity [2,3]. However, only B. melitensis and B. abortus have been frequently documented as severe zoonotic species. Furthermore, being naturally associated with small ruminants and bovines, those animals which are in close contact with man, the requirement to eradicate the disease in these farms does not only emerge from the risk to the farms but mostly refers to the risk these organisms pose to human health. As a result, the combined One Health damage is increased in both the livestock industry and the human health component, respectively. B. suis is the third important human pathogen, however, is less frequently reported to-dates, as it is naturally associated with swine which are grown under an intensive reproductive industry [4].
B. melitensis strain Rev. 1 and B. abortus strain S19 (USA) have been established as live attenuated vaccine strains against brucellosis in their corresponding hosts. These vaccines induce cellular and humoral immune responses in their hosts, the first providing important protection against abortion [5], and the latter involving development of anti-Brucella antibodies, including development of a prominent antibody response against the Brucella O-polysaccharide antigen [6]. Because O-polysaccharide of a vaccine strain shares common epitopes with cognate field strains, vaccination with the live vaccine strains hampers serological diagnosis due to the inability to differentiate infected from vaccinated animals (DIVA) [7]. Serum (Tube) Agglutination Test (SAT), which measures agglutinin IgM antibodies elicited during the acute phase of the disease, and Complement Fixation Test (CFT), which measures complement fixing IgG antibodies development during the chronic stage of the disease or alongside persistence of the pathogen in the host, are two common tests used in surveillance programs. The first one is simple and accessible to low-and middle-income countries (LMIC) and the second conceived as a confirmatory test [8,9]. Nevertheless, the serological tests which not always provide a significant predicting value [10] and possibly involving an inaccurate identification of a Rev. 1 adverse performance in the field [11] still constitute paramount tools in achieving a successful national control program.
Ganesh et al. [7] proposed an alternative novel vaccine as a solution to overcoming the DIVA problems associated with the use of live vaccine strains. They assumed that Brucella O-polysaccharide could be designed and chemically synthesized, so as to achieve modification of the non-reducing M-epitope of the polysaccharide and binding of an immunodominant protein to the polysaccharide as a means of establishing a potent conjugate vaccine together with a DIVA solution [12,13]. Although based on a sound hypothesis, this approach is just at its beginnings regarding the realm of the brucellosis complexity, while animal vaccination with live attenuated strains still remains the major tool in prophylactic protection against Brucella infection. Therefore, finding an alternative DIVA approach that does not rely on serological parameters would establish an important tool in solving the problem of how to integrate vaccination with a test and cull policy.
Serum PCR has been proposed and implemented as a method of indirect diagnosis of brucellosis based upon the presence of Brucella DNA residues in the serum samples [14]. Real-Time PCR amplification of Brucella protein 31 kDa (BCSP31) has been used in confirming human cases [15,16] and this approach has been similarly adopted in diagnosing animal brucellosis [17,18]. We took this diagnostic approach a step further and developed a “nested” PCR method that increased test sensitivity by establishing a visible DNA band on the gel, sufficing for its extraction and sequencing and establishing SNP differences between DNA samples. We demonstrated feasibility of the use of this method in distinguishing between serological responses due to Rev. 1 vaccine and field infections (a non-serological DIVA test), as well as identifying B. abortus and B. melitensis species by their tRNA (uracil-5-)-methyltransferase SNPs.
Metagenomic next generation sequencing (mNGS) is an emerging novel method which similarly identifies sequences of an etiological agent involved in an infection, however, requiring an in-depth pursuit of the tissue of concern as well as whether an untargeted or targeted sequencing approach should be performed [19]. Here, we suggest that being targeted a priori against a specific disease, and in concern of resolving DIVA cases between filed infection and Rev. 1 vaccine induced antibodies, serum “nested PCR” is superior to mNGS in speed and accuracy of performance, as well as being cheaper and regarded non-invasive. In the long run, we envision that this diagnostic approach would also be applicable in mapping Brucella genes of interest based upon testing large numbers of serum samples.

2. Materials and Methods

2.1. Bacterial DNA Isolation

Brucella strains are maintained at the Kimron National, OIE and FAO Reference Laboratory for Brucellosis as glycerol frozen suspensions. A bacteriological loop was loaded with the frozen culture and transferred to a Tryptic Soy Broth medium, which was then incubated on a rotating platform at 37 °C for 24 h, in the presence of 5% CO2. Genomic DNA was purified using DNeasy blood and tissue kit (Qiagen, Aarhus, Denmark) according to the manufacturer’s recommendations. DNA concentration was measured using microvolume spectrophotometer DS11 (DeNovix Inc, Denver, CO, USA).

2.2. Serum Samples and DNA Purification

Sheep vaccination and blood sampling were conducted as part of the routine activity of the Israeli Veterinary Services in compliance with ISO-17025 (https://www.gov.il/he/departments/general/sheep-health-veterinary-services, Hebrew, accessed on 5 September 2022). Blood samples were collected into vacutainer tubes and sent to the Israeli National Reference Laboratory for Brucellosis to be tested by Complement Fixation (CFT) and Microplate Serum Agglutination (MAT) as described in Baum et al. [8].

2.3. DNA Preparation

An aliquot of 100 µL serum sample was added into 300 µL of 1:10 diluted Edwards’ solution [20] in an Eppendorf tube and the mixture was incubated at room temperature for 25–30 min. The reaction mixture was then centrifuged at 15,000 rpm for 5 min, supernatant collected and mixed with 216 µL of ice-cold propanol (kept in a glass bottle overnight at −20 °C) in order to precipitate the DNA. Finally, precipitated DNA was centrifuged at 15,000 rpm for 5 min and supernatant withdrawn. After drying the tube at an ambient temperature, the pellet was dissolved in 70 µL of RNA/DNA-free water and kept in a refrigerator until used.

2.4. PCR

The method comprises two robust techniques, a “nested PCR” amplification of a DNA band first and sequencing of the DNA then after asking for SNP differences between amplicon sequences. Primers were designed according to published target DNA sequences and following the reaction of PCR amplification DNAs were run on agarose gels as a means of developing DNA bands. These DNA bands were then extracted from the gel and DNA contents were sequenced in order to identify SNP differences between analyte genomes.
Primers: For primer design we used chromosomal accession numbers given per a Brucella reference and type strain. B. melitensis 16M (accession number AE008917.1) has been used as a prototype sequence and locations of the large and short—nested PCR sequences on the chromosome have been depicted in Figure 1A and Figure 2A. The other Brucella species included: B. melitensis Rev. 1 (accession number CP024715.1), B. melitensis 63/9 (accession number CP007789.1), B. melitensis Ether (accession number CP007760.1), B. abortus S19 (accession number CP000887.1), B. abortus 2308 (accession number AM040264.1), B. suis 1330 (accession number AE014291.4), B. microti (accession number CP001578.1). Primers used in the amplification of the nested PCR reactions were retrieved from the large sequences. Table 1 depicts the primers which were selected. Designated primers were designed and synthesized at Hylabs (Israel) using geneious prime software (Auckland, New Zealand), based on the NCBI and GenBank databases.
PCR amplification: Two genes, omp2a ((BMEI1306) and tRNA (uracil-5-)-methyltransferase (BMEI1496)), were selected as study targets [21]. In an attempt to verify specificity of the method, gene sequences were chosen for amplification after validating their unique specificity to Brucella. Reactions were conducted in two steps, the first targeting the entire gene and flanking sequences using primers 1 and 2. Then, in preparation for the second reaction, amplified DNA from the first reaction was washed and concentrated into a 6 µL solution by a DNA clean and concentrator kit (Zymo Research, Irvine, CA, USA). The second reaction then targeted an internal sequence within the amplified sequence of the first amplification step using primers 3 and 4.
The first reaction mixture composed of 15 µL of HS Red Taq PCR buffer (PCR Biosystem, London, UK), 1.2 µL of primers 1 and 2 (each at a final concentration of 400 nM), 3 µL of bacterial genomic DNA or 10 µL of a serum DNA sample and volume was increased to 30 µL with DNA/RNA-free water. Reaction was initiated by sample heating at 95 °C for 2 min, followed by 40 cycles of 15 s of DNA denaturation at 95 °C, 15 s of DNA annealing at 58 °C (for omp2a) or 54.5 °C (for tRNA [uracil-5-]-methyltransferase), and ending the reaction with DNA extension at 72 °C for 25 s.
The second amplification cycle was conducted as above, however, using primers P3 and P4 and 6 µL of a concentrated DNA solution obtained at the first reaction and changing the annealing temperature to 50 °C for omp2a and 54.5 °C for tRNA (uracil-5-)-methyltransferase, respectively.

2.5. DNA Sequencing

A 25 µL sample of each of the PCR reaction mixture was loaded onto a 1.2% (w/v) agarose gel (Amresco, Red Bank, NJ, USA), which included Olerup SSP® GelRedTM (Fischer Scientific, Waltham, MA, USA) as a DNA binding dye. Electrophoresis was carried out at 80 V for 45 min and DNA bands detected on a 254 nm UV trans illuminator (Ingenius, Syngene, India) were cut from the agarose using sterile dispensable chirurgic scalpels (Swann Morton, Sheffield, England, UK) and gel pieces were introduced into an Eppendorf tube which was kept under cold until examined. Then, DNA was cleansed using column extraction (DNA Clean up and Concentrater, Zymo, Irvine, CA, USA) before submission to Sanger sequencing at HyLabs, Israel. Finally, sequences were analyzed using geneious prime alignment software (Auckland, New Zealand).

3. Results

3.1. Design of a DIVA Method

In a publication by Bardenstein et al., (2002) we identified separated by a t-RNAser. Whereas omp2b includes a conserved PstI site an omp2a—PstI site SNP difference between Israeli B. melitensis field strains and Rev. 1 vaccine strain upon which presence or absence of this SNP distinguishes between the two strains [22]. As shown in Figure 1A, the omp2 region comprises two closely identical omp2 gene copies among the strains omp2a varies by its PstI SNP according to the studied strain (broken arrow), Primers P1 and P2 identified by their locations on Chromosome I, 1,354,796 (P1) and 1,355,899 (P2), have been designed to amplify a 1233 bp sequence which includes the intact omp2a gene and flanking sequence [23]. By delineating into the nested PCR amplicon, primers P3 and P4 within omp2a amplify a 282 bp sequence at the 5′ end of the amplicon which may or may not include a PstI site (broken arrow), in accordance with the specific Brucella species and strains. Note that some of the genomes of these strains have been annotated at a reverse complementary sequence to that of B. melitensis 16M and therefore they are marked by an accompanying star to indicate their opposite alignment. As shown in Figure 1B, a zoom in profile into the PstI site identifies a “C/T” SNP within these sequences which differentiates between B. melitensis strain 16M and its cognate Rev. 1 strain and the other Brucella species. A Brucella BLASTn, taxid:234 analysis against the P3–P4 amplified sequence revealed that B. melitensis strains from all around the Eastern Hemisphere of the world including countries from Africa, Western Europe, Eastern Europe, Mediterranean region, and the Gulf [24], as well as China and Mongolia (data not shown) included an intact PstI site in omp2a. This indicated that the DIVA method which was primarily validated for B. melitensis infections in Israeli strains could be practically employed in most of B. melitensis DIVA queries among vaccinated populations worldwide, Unfortunately, the same could not be indicated in cases of Latin American B. melitensis infections as whole genome sequencing (WGS) has not been performed extensively on these strains [24,25,26].
Microbiolres 14 00002 g001 550
Figure 1. (A) Schematic presentation of the B. melitensis strain 16M omp2 region (arrows indicate locations in the chromosome of ORFs and primers). P stands for a primer. The size of the first amplicon (1233 bp) and nested PCR product (282 bp) as well as direction of gene transcription are indicated by broken arrows. Vertical broken short arrows stand for an apparent PstI site. (B) The specific omp2a sequence which aligns with the corresponding PstI site and accession numbers are given. Note that the PstI site is lacking exclusively from strains 16M and Rev. 1. Star (*) stands for a reverse complementary sequence in comparison to that of B. melitensis 16M. SNPs are depicted by letters with an increased font size.
Figure 1. (A) Schematic presentation of the B. melitensis strain 16M omp2 region (arrows indicate locations in the chromosome of ORFs and primers). P stands for a primer. The size of the first amplicon (1233 bp) and nested PCR product (282 bp) as well as direction of gene transcription are indicated by broken arrows. Vertical broken short arrows stand for an apparent PstI site. (B) The specific omp2a sequence which aligns with the corresponding PstI site and accession numbers are given. Note that the PstI site is lacking exclusively from strains 16M and Rev. 1. Star (*) stands for a reverse complementary sequence in comparison to that of B. melitensis 16M. SNPs are depicted by letters with an increased font size.
Microbiolres 14 00002 g001
Figure 2A shows a schematic genetic map of the tRNA (uracil-5-)-methyltransferase gene and flanking sequences in chromosome I of B. melitensis strain 16M. Figure 2B focuses on two SNPs differences between Brucella species. Although this is not applied for B. microti which shares identical SNPs with B. suis, one can rule out involvement of the two species in most if not all brucellosis cases among small ruminants and cattle. Intriguingly, as can be seen in Figure 2A, these sequences are linked to a hypervariable Bruc04 sequence of the MLVA technique [27], possibly implying that this region is a hotspot of mutational events.
Microbiolres 14 00002 g002 550
Figure 2. (A) Schematic presentation of the B. melitensis strain 16M tRNA (uracil-5) methyltransferase region (arrows indicate locations in the chromosome of ORFs and primers). The size of the first amplicon (785 bp) and nested PCR product (256 bp) as well as direction of gene transcription are indicated by broken arrows. Note, tRNA (uracil-5) methyltransferase is linked to an MLVA Bruc04 sequence. P stands for a primer. SNP locations on the nested PCR amplicon are indicated by short vertical broken arrows. (B) The specific tRNA (uracil-5) methyltransferase sequence which aligns with the corresponding SNPs and accession numbers are given. Star (*) stands for a reverse complementary sequence in comparison to that of B. melitensis 16M. SNPs are depicted by letters with an increased font size.
Figure 2. (A) Schematic presentation of the B. melitensis strain 16M tRNA (uracil-5) methyltransferase region (arrows indicate locations in the chromosome of ORFs and primers). The size of the first amplicon (785 bp) and nested PCR product (256 bp) as well as direction of gene transcription are indicated by broken arrows. Note, tRNA (uracil-5) methyltransferase is linked to an MLVA Bruc04 sequence. P stands for a primer. SNP locations on the nested PCR amplicon are indicated by short vertical broken arrows. (B) The specific tRNA (uracil-5) methyltransferase sequence which aligns with the corresponding SNPs and accession numbers are given. Star (*) stands for a reverse complementary sequence in comparison to that of B. melitensis 16M. SNPs are depicted by letters with an increased font size.
Microbiolres 14 00002 g002

3.2. Preliminary Analyses of the Specificity and Reproducibility of the Technique

Two sets of experiments were examined. In the first set, the sensitivity of the amplification reaction of the final omp2a 282 bp product was studied using a series of 10 folds dilutions of genomic DNA in the first cycle of the reaction mixture and detection of a DNA band at the expected size in the “nested” amplification of the smaller sequence. DNA bands have been then sliced out from the gels and the samples sent for DNA sequencing as a validation of the specific sequence. In comparison, it was important to confirm that negative control samples do not produce false positive DNA bands on the gel. Thus, we also sent suspected false bands for sequencing and confirmed that they were non-sense DNA.
After approval of the test sensitivity, we then tested field serum samples from sheep which reacted positive by the CFT tests. In these experiments we validated the established conditions using field serum samples and tried to find how many of the tested serum samples yielded true bands (according to sequencing results). In these studies, we again confirmed our negative control results, using serum samples from brucellosis free animals before vaccination.

3.3. Determining Analytical Sensitivity

As can be seen in the left-hand side of Figure 3, lanes 1 to 8, none of the B. melitensis 16M genomic DNA solutions sufficed to produce an intact gene amplicon of approximately 1200 bp in the first amplification cycle. In contrast, as shown at the right-hand side of Figure 3, 4.5 ng (Lane 1) and 0.45ng (Lane 2) of the original DNA amounts used in the first reaction yielded a visible DNA band of an expected 282 bp in the second “nested” PCR reaction.
Importantly, these DNA amounts yielded a visible band on the gel which could be extracted and sent for DNA sequencing. Further DNA dilutions thereof in the first reaction also produced negative PCR bands in the second reaction, implying that a minimal content of 0.45 ng or more of the genomic DNA in the serum sample should suffice to establish a positive “nested” band for sequencing.

3.4. Validating Serum PCR

In the transition between laboratory validation of the method and conducting field diagnosis, during running preliminary analyses in order to improve the test’s performance, we often encountered a problem of non-reproducibility of results due to quality variations between commercial molecular kits. Hence, conditions described in M&M are advised as being superior to alternative combinations. Further, we only used serum samples which were close to time of collection and confirmed serologically positive by CFT at a titer of 1:20 or higher. CFT is a highly reproducible, specific and sensitive method which stands alone in confirming herds’ exposure to the disease (used as an OIE recommended method in both sheep and goats and in cattle brucellosis). By obtaining a positive CFT result animal infection is confirmed even without bacteriological isolation of the strain (a gold test), which justify animal culling against compensation to the owner. While only addressing CFT positive responders as target animals, aiming at increasing test’s sensitivity, Batrinou et al., (2022) [11] have justifiably indicated that a minor number of undiagnosed responders may also be positive in the test.
In order to validate the versatility of the nested PCR method to fit with several diagnostic purposes, we investigated two genes: omp2a, which is intended to be implemented as a DIVA test, and tRNA (uracil-5-)-methyltransferase, intended to be used as a method that identifies Brucella species. omp2a is common among core Brucella species establishing an identical DNA band of 282 bp. Submission of the DNA for sequencing reveals a C/T SNP difference between vaccine strain Rev. 1 (as well as its counter type strain 16M) and B. melitensis field strains (Figure 1). Brucella tRNA (uracil-5) methyltransferase is found in the three zoonotic Brucella species and therefore all three genomes yield a DNA band of 256 bp. Submission of the DNA for sequencing reveals a difference in a SNP combination between two nucleotides within the sequence which identifies the Brucella species (Figure 2).
The fraction of field serum samples which contain a minimal Brucella genomic DNA amount required to produce a DNA band of expected size on the agarose gel is not known a priori. To address this question, we performed serum PCR analyses in three infected farms, testing 9 (first farm, Figure 4A) and 6 (second farm, Figure 4B) CFT positive serum samples questioning omp2a amplification and 3 (third farm, Figure 5) CFT positive serum samples asking amplification of tRNA (uracil-5-)-methyltransferase, respectively. As can be seen, the omp2a study resulted with four serum samples out of 9 (Lanes 2, 4, 7, 8; 44% sensitivity, Figure 4A) and six out of 6 serum samples (100% sensitivity, Figure 4B) which yielded a positive DNA band of 282 bp. In the tRNA (uracil-5-)-methyltransferase study, two out of 3 (66% sensitivity, Figure 5) serum samples yielded a DNA band of 256 bp. This established a test’s sensitivity which could vary among farms and animals between 44% to 100% with expectation to yield DNA bands of sufficient amount for sequencing. However, the test’s performance per serum sample did not always match between the two genes of study, omp2a and tRNA (uracil-5-)-methyltransferase, indicating that differences between PCR conditions may play a role in the statistics of successful amplification results.
We then asked if vaccination by strain Rev. 1 elicits residual DNA in the serum sample as infection does. To test this hypothesis, we followed development of an omp2a band in ewe-lambs which have been vaccinated by the Rev. 1 vaccine. Serum samples were taken prior to vaccination as a proof of lack of infection and 15 and 25 days postvaccination to determine DNA analyte. CFT and MAT were negative before vaccination and turned positive postvaccination, according to the individual response, indicating that vaccination was achieved successfully (data not shown), We then conducted the serum PCR test twice, obtaining inconclusive DNA bands in 2 out of 2 ewe-lambs in the first experiment and as a result, we caried out a second experiment in which 10 ewe-lambs were tested. In this test, we also included a serum sample from an infected ewe as an internal positive control. After 15 days postvaccination only faded DNA bands were shown in 2 out of 10 serum samples which were not depicted after 25 days postvaccination. In this test, all other serum samples were also negative, yet, the internal control of a serum sample of an infected sheep provided a clear positive DNA band at the expected size, validating the test performance. This ruled out persistence of Rev. 1 DNA in serum samples due to prompt ocular vaccination per se (Data not shown).

3.5. A Case Study

At the beginning of June 2019, a person was diagnosed infected with B. melitensis bv. 1 as confirmed by strain isolation.
An epidemiological investigation identified an unregistered sheep flock composed of around 100 heads as a suspected source of this infection. Some of the animals were at late gestation and others had already lambed, most being untagged. After completion of a renewed animal tagging and registration, all adult animals were tested by CFT, revealing 2 males and 7 females positive for the disease. On a second follow up visit, a month later, 3 males and 20 females were tested and found positive, indicating an ongoing spread of the disease in the flock. Because some of the animals were tagged with the original vaccine yellow color ear tags, we were intrigued to find out how many of the animals positive by CFT at ≥1:20 titers responded to Rev. 1 vaccination, or were infected by a field strain. We then implemented an omp2a serum PCR as a DIVA method and tRNA (uracil-5-)-methyltransferase gene analysis as a means of identifying which Brucella species were involved in this event.
As can be seen in Table 2, six out of 10 serum samples yielded a positive omp2a band of which three animals, numbers 4002118, 4898827 and 4898865, produced an amplicon with a DNA sequence that correlated with a Rev. 1 profile, and other 3, numbers 4898849, 3673916 and 4505924, produced a DNA band with a sequence that correlated with a field strain infection. Two of these serum samples, numbers 3673916 and 4002118, also yielded a tRNA (uracil-5-)-methyltransferase band that confirmed the species as B. melitensis. Two additional serum samples, numbers 4813646 and 3991347, which did not amplify an omp2a, still yielded a B. melitensis tRNA (uracil-5-)-methyltransferase positive sequence. The fact that some serum samples yielded amplicons of the 2 genes in parallel, in comparison to others that only yielded a single gene amplicon, highlights on the importance of the double test approach as a means of increasing test sensitivity.
Four serum samples were derived from sheep labeled by the original yellow ear tag, however they differed as to their time of vaccination, e.g., sheep number 3,673,916 was vaccinated in 2014, 3,991,347 in 2016, 4,002,118 in 2017, while 4,813,646 had been vaccinated only recently. This indicates that the animals varied in age, the oldest being at least 6 years old and the youngest being possibly closer to one year old. A closer inspection revealed that animal number 4,002,118 had been vaccinated while in quarantine, three years prior to being tested, while two others that carried the recently labeled red ear tags 4,898,827 and 4,898,865, and therefore could not be directly associated with past vaccinations, were also diagnosed as Rev. 1 carriers of a persisting strain. In contrast, the older animal from the vaccinated group, number 3,673,916, and two others, numbered 4,505,924 and 4,898,849, wearing red ear tags and of undetermined vaccination status, were conclusively infected by a field strain. As this study started with the diagnosis of a patient infected with B. melitensis identification of three animals infected with a non-vaccine B. melitensis strain allowed the conclusion that B. melitensis was the causative agent of this infection.

4. Discussion

Detection of Brucella agents has been historically based upon strain isolation and phenotype characterization according to their growth patterns in presence of dyes, agglutination by A or M monospecific serum and susceptibility to brucellaphages, respectively. Yet, although contributing to our understanding of Brucella epidemiology and taxonomy, these methods, which relied on strain isolation and bacteriological typing beforehand, have become obsolete in the presence of the newly evolving high throughput alternative molecular typing approaches. In contrast, serum PCR, first introduced as a means of diagnosing human brucellosis [15,16] and further used to diagnose camel brucellosis—based upon a consensus protein BCSP31 sequence—has opened a window to profiling Brucella infections in real time without necessitating Brucella isolation [17,18].
Here, granted that a vast number of serum samples are sent to a diagnostic laboratory for serological investigation on a daily basis, we exploited these serum samples in diagnosing Brucella infections according to DNA fingerprints determined by “nested” PCR. In order to show the versatile applicability of the method, we studied two genes: one that identifies strain Rev. 1 DNA based upon an omp2a PstI DIVA site proven relevant to most Brucella genomes by a BLASTn, taxid:234 search (Figure 1B, [24,25,26]), and the second, based upon SNPs within a tRNA (uracil-5-)-methyltransferase gene, which defines the difference between B. abortus and B. melitensis. Our data confirmed the applicability of the method with both genes depicting the corresponding DNA bands in serum samples obtained from B. melitensis field strain infected sheep (Figure 4 and Figure 5).
Analytical sensitivity of the method was highly significant, as it successfully identified between 4.5 ng to 0.45 ng of Brucella genomic DNA in the sample (Figure 3). Thus, achieving a sensitivity which varied between 44% (lowest) and 100% (highest) among infected flocks (Figure 4A,B) indicates that failing in showing DNA bands in a field study most likely correlates with lack of Brucella genomic DNA in the negative serum samples. In other words, confirmation of a positive band, even if obtained from a single sheep, suffices to judge the flock as infected, and as a consequence put it in quarantine and enforce an immediate brucellosis control program in the farm [28].
In a case study, a sheep flock consisting of about 100 heads had been linked to a human illness. Because some animals bore yellow ear tags indicating their vaccination status, serology could not differentiate infected from vaccinated animals (DIVA). We therefore considered our newly developed serum PCR as a means of distinguishing between these possibilities.
From 10 serum samples, the nested PCR approach identified 3 field strain cases which confirmed the infectious status of these animals. This supported the decision to quarantine the flock and test and cull infected animals according to our national policy. However, additional 3 sera samples depicted the presence of Rev. 1 DNA (Table 2) in this flock, suggesting on an ongoing mixed infection between a field strain and the Rev. 1 vaccine strain. Moreover, this revealed that a Rev. 1 infection persisted in a sheep 3 years after vaccination, also accompanied by a serological titer, reopening concerns regarding the safety of Rev. 1 vaccine lots [28,29]. In light of this finding, we renew our call for using a safer Rev. 1 vaccine based upon Elberg strain, passage 101, 1970, which has been validated and standardized as the only safe seed stock [30]. Taken that serum—PCR relies on existence of nucleic acid components of pathognomonic infections in the serum samples, one can design an effective campaign to monitor small ruminant brucellosis among vaccinated populations based upon serum PCR tests.
Together, despite not knowing which would be the conditions that drive Brucella DNA to persist in a serum sample and for how long, our data open up a novel approach in studying the etiology of Brucella infections by serum PCR and facilitate development of a pan-genomic map of prevailing Brucella strains in an epidemiological unit.

Author Contributions

Conceptualization, M.B. and S.M.; methodology, M.B., S.B. and S.B.; software, S.M.; validation, M.B., D.C. and S.M.; formal analysis, S.M.; investigation, M.B., S.M. and D.C.; resources, D.C.; data curation, M.B., S.B., S.M. and D.C.; writing—original draft preparation, M.B., S.M. and D.C.; writing—review and editing, M.B., S.M. and D.C.; visualization, M.B., D.C. and S.M.; supervision, M.B. and D.C.; project administration, D.C.; funding acquisition, D.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was conducted as part of Grant No. 13-18-0002, Chief Scientist of Ministry of Agriculture and Rural Development.

Institutional Review Board Statement

Not applicable.

Acknowledgments

The authors would like to thank veterinary practitioners of the Israeli Veterinary Services who conducted field activities that are mentioned in this manuscript. Shubham Mathur is a PhD student at the Tel Aviv University School of Public Health, supported by the PI Foundation Charitable trust, Singhal Farm House, Near Air Force station Rajkori, New Delhi-110038 through the Manna Center Program for Food Safety & Security, Tel Aviv University.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Corbel, M.J. Brucellosis: An overview. Emerg. Infect. Dis. 1997, 3, 213–221. [Google Scholar] [CrossRef]
  2. Scholz, H.C.; Banai, M.; Cloeckaert, A.; Kämpfer, P.; Whatmore, A.M. Brucella. In Bergey’s Manual of Systematics of Archaea and Bacteria; Whitman, W.B., Rainey, F., Kämpfer, P., Trujillo, M., Chun, J., DeVos, P., Hedlund, B., Dedysh, S., Eds.; John Wiley & Sons Inc.: Hoboken, NJ, USA, 2018. [Google Scholar]
  3. Verger, J.M.; Grimont, F.; Grimont, P.A.D.; Grayon, M. Brucella, a monospecific genus as shown by deoxyribonucleic acid hybridization. Int. J. Syst. Evol. Microbiol. 1985, 35, 292–295. [Google Scholar] [CrossRef]
  4. Maes, D.G.D.; Dewulf, J.; Piñeiro, C.; Edwards, S.; Kyriazakis, I. A critical reflection on intensive pork production with an emphasis on animal health and welfare. J. Animal Sci. 2019, 98 (Suppl. S1), S15–S26. [Google Scholar] [CrossRef]
  5. Van Straten, M.; Bardenstein, S.; Keningswald, G.; Bana, M. Brucella abortus S19 vaccine protects dairy cattle against natural infection with Brucella melitensis. Vaccine 2016, 34, 5837–5839. [Google Scholar] [CrossRef]
  6. Mathur, S.; Banai, M.; Cohen, D. Natural Brucella melitensis infection and Rev. 1 vaccination induce specific Brucella O-Polysaccharide antibodies involved in complement mediated Brucella cell killing. Vaccines 2022, 10, 317. [Google Scholar] [CrossRef]
  7. Ganesh, N.V.; Sadowska, J.M.; Sarkar, S.; Howells, L.; McGiven, J.; Bundle, D.R. Molecular recognition of Brucella A and M antigens dissected by synthetic oligosaccharide glycoconjugates leads to a disaccharide diagnostic for brucellosis. J. Am. Chem. Soc. 2014, 136, 16260–16269. [Google Scholar] [CrossRef]
  8. Baum, M.; Zamir, O.; Bergman-Rios, R.; Katz, E.; Beider, Z.; Cohen, A.; Banai, M. Comparative evaluation of microagglutination test and serum agglutination test as supplementary diagnostic methods for brucellosis. J. Clin. Microbiol. 1995, 33, 2166–2170. [Google Scholar] [CrossRef] [Green Version]
  9. Nielsen, K.H.; Kelly, L.; Gall, D.; Balsevicius, S.; Bosse, J.; Nicoletti, P.; Kelly, W. Comparison of enzyme immunoassays for the diagnosis of bovine brucellosis. Prev. Vet. Med. 1996, 26, 17–32. [Google Scholar] [CrossRef]
  10. Lukambagire, A.S.; Mendes, Â.J.; Bodenham, R.F.; McGiven, J.A.; Mkenda, N.A.; Mathew, C.; Rubach, M.P.; Sakasaka, P.; Shayo, D.D.; Maro, V.P.; et al. Performance characteristics and costs of serological tests for brucellosis in a pastoralist community of northern Tanzania. Sci. Rep. 2022, 11, 5480. [Google Scholar] [CrossRef]
  11. Batrinou, A.; Strati, I.F.; Tsantes, A.G.; Papaparaskevas, J.; Dimou, I.; Vourvidis, D.; Kyrma, A.; Antonopoulos, D.; Halvatsiotis, P.; Houhoula, D. The importance of complementary PCR analysis in addition to serological testing for the detection of transmission sources of Brucella spp. in Greek ruminants. Vet. Sci. 2022, 9, 193. [Google Scholar] [CrossRef]
  12. Bundle, D.R.; McGiven, J. Brucellosis: Improved diagnostics and vaccine insights from synthetic glycans. Acc. Chem. Res. 2017, 50, 2958–2967. [Google Scholar] [CrossRef]
  13. Mandal, S.S.; Duncombe, L.; Ganesh, N.V.; Sarkar, S.; Howells, L.; Hogarth, P.J.; Bundle, D.R.; McGiven, J. Novel solutions for vaccines and diagnostics to combat brucellosis. ACS Cent. Sci. 2017, 3, 224–231. [Google Scholar] [CrossRef] [Green Version]
  14. Zerva, L.; Bourantas, K.; Mitka, S.; Kansouzidou, A.; Legakis, N.J. Serum is the preferred clinical specimen for diagnosis of human brucellosis by PCR. J. Clin. Microbiol. 2001, 39, 1661–1664. [Google Scholar] [CrossRef] [Green Version]
  15. Queipo-Ortuño, M.I.; Colmenero, J.D.; Bravo, M.J.; García-Ordoñez, M.A.; Morata, P. Usefulness of a quantitative real-time PCR assay using serum samples to discriminate between inactive; serologically positive and active human brucellosis. Clin. Microbiol. Infect. 2008, 14, 1128–1134. [Google Scholar] [CrossRef] [Green Version]
  16. Debeaumont, C.; Falconnet, P.A.; Maurin, M. Real-time PCR for detection of Brucella spp. DNA in human serum samples. Eur. J. Clin. Microbiol. 2005, 24, 842–845. [Google Scholar] [CrossRef]
  17. Fatima, S.; Khan, I.; Nasi, A.; Younus, M.; Saqib, M.; Melzer, F.; Neubauer, H.; El-Adawy, H. Serological, molecular detection and potential risk factors associated with camel brucellosis in Pakistan. Trop. Anim. Health Prod. 2016, 48, 1711–1718. [Google Scholar] [CrossRef]
  18. Gwida, M.M.; El-Gohary, A.H.; Melzer, F.; Tomaso, H.; Rösler, U.; Wernery, U.; Wernery, R.; Elschner, M.C.; Khan, I.; Eickhoff, M.; et al. Comparison of diagnostic tests for the detection of Brucella spp. in Camel sera. BMC Res. Notes 2011, 4, 525. [Google Scholar] [CrossRef] [Green Version]
  19. Gu, W.; Miller, S.; Chiu, C.Y. Clinical metagenomic next-generation sequencing for pathogen detection. Annu. Rev. Pathol. 2019, 14, 319–338. [Google Scholar] [CrossRef]
  20. Edwards, K.; Johnstone, C.; Thompson, C. A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res. 1991, 19, 1349. [Google Scholar] [CrossRef]
  21. DelVecchio, V.G.; Kapatral, V.; Redkar, R.J.; Patra, G.; Mujer, C.; Los, T.; Ivanova, N.; Anderson, I.; Bhattacharyya, A.; Lykidis, A.; et al. The genome sequence of the facultative intracellular pathogen Brucella melitensis. Proc. Natl. Acad. Sci. USA 2002, 99, 443–448. [Google Scholar] [CrossRef]
  22. Bardenstein, S.; Mandelboim, M.; Ficht, T.A.; Baum, M.; Banai, M. Identification of the Brucella melitensis vaccine strain Rev.1 in animals and humans in Israel by PCR analysis of the PstI site polymorphism of its omp2 gene. J. Clin. Microbiol. 2002, 40, 1475–1480. [Google Scholar] [CrossRef] [Green Version]
  23. Cloeckaert, A.; Verger, J.M.; Grayon, M.; Grépinet, O. Restriction site polymorphism of the genes encoding the major 25 kDa and 36 kDa outer-membrane proteins of Brucella. Microbiology 1995, 141 Pt 9, 2111–2121. [Google Scholar] [CrossRef] [Green Version]
  24. Georgi, E.; Walter, M.C.; Pfalzgraf, M.T.; Northoff, B.H.; Holdt, L.M.; Scholz, H.C.; Zoeller, L.; Zange, S.; Antwerpen, M.H. Whole genome sequencing of Brucella melitensis isolated from 57 patients in Germany reveals high diversity in strains from Middle East. PLoS ONE 2017, 12, e0175425. [Google Scholar] [CrossRef] [Green Version]
  25. Lucero, N.E.; Ayala, S.M.; Escobar, G.I.; Jacob, N.R. Brucella isolated in humans and animals in Latin America from 1968 to 2006. Epidemiol. Infect. 2008, 136, 496–503. [Google Scholar] [CrossRef]
  26. Janowicz, A.; De Massis, F.; Ancora, M.; Cammà, C.; Patavino, C.; Battisti, A.; Prior, K.; Harmsen, D.; Scholz, H.; Zilli, K.; et al. Core genome multilocus sequence typing and single nucleotide polymorphism analysis in the epidemiology of Brucella melitensis Infections. J. Clin. Microbiol. 2018, 56, e00517-18. [Google Scholar] [CrossRef] [Green Version]
  27. Le Flèche, P.; Jacques, I.; Grayon, M.; Al Dahouk, S.; Bouchon, P.; Denoeud, F.; Nöckler, K.; Neubauer, H.; Guilloteau, L.A.; Vergnaud, G. Evaluation and selection of tandem repeat loci for a Brucella MLVA typing assay. BMC Microbiol. 2006, 6, 9. [Google Scholar] [CrossRef]
  28. Babetsa, M.; Boukouvala, E.; Gelasakis, A.I.; Papadopoulos, A.I.; Zdragas, A.; Ekaterinadou, L.V. Detection of a Brucella melitensis Rev. 1 vaccine strain and Rev. 1-like strains in unvaccinated small ruminants and aborted fetuses. Open Access J. Vet. Sci. Med. 2019, 1, 103. [Google Scholar]
  29. Banai, M. Control of small ruminant brucellosis by use of Brucella melitensis Rev.1 vaccine: Laboratory aspects and field observations. Vet. Microbiol. 2002, 90, 497–519. [Google Scholar] [CrossRef]
  30. Salmon-Divon, M.; Banai, M.; Bardenstein, S.; Blum, S.E.; Kornspan, D. Complete Genome Sequence of the live attenuated vaccine strain Brucella melitensis Rev.1. Genome Announc. 2018, 6, e00175-18. [Google Scholar] [CrossRef]
Microbiolres 14 00002 g003 550
Figure 3. Calibration of the nested PCR reaction using B. melitensis 16M genomic DNA. Left-hand side, DNA amplification of the intact omp2a gene of a genomic DNA source diluted by a ten-fold factor. An expected band at 1200 bp is not depicted in any of the reactions, Lanes 1–8. Right-hand side, a “nested PCR” DNA amplification of a 282 bp size partial sequence within the intact omp2a gene is seen in Lanes 1 and 2, to the right side of a GeneRuler 1 kb DNA ladder, corresponding to 4.5 and 0.45 ng of the original genomic DNA concentrations in the first amplification reactions (Left hand side, Lanes 1 and 2), respectively.
Figure 3. Calibration of the nested PCR reaction using B. melitensis 16M genomic DNA. Left-hand side, DNA amplification of the intact omp2a gene of a genomic DNA source diluted by a ten-fold factor. An expected band at 1200 bp is not depicted in any of the reactions, Lanes 1–8. Right-hand side, a “nested PCR” DNA amplification of a 282 bp size partial sequence within the intact omp2a gene is seen in Lanes 1 and 2, to the right side of a GeneRuler 1 kb DNA ladder, corresponding to 4.5 and 0.45 ng of the original genomic DNA concentrations in the first amplification reactions (Left hand side, Lanes 1 and 2), respectively.
Microbiolres 14 00002 g003
Microbiolres 14 00002 g004 550
Figure 4. An omp2a test analysis of field serum samples confirmed positive by CFT serology, obtained from two infected sheep farms, (A,B). (A)—Experiment 1—Serum samples number 2, 4, 7 and 8 out of nine as well as a control sample (lane 10) depict the correct 282 bp DNA band (black arrow). Lane 11 depicts a negative control sample. (B) Experiment 2—six out of six serum samples as well as a control sample (lane 8) depict the correct 282 bp DNA band (black arrow). Lane 7 depicts a negative control sample.
Figure 4. An omp2a test analysis of field serum samples confirmed positive by CFT serology, obtained from two infected sheep farms, (A,B). (A)—Experiment 1—Serum samples number 2, 4, 7 and 8 out of nine as well as a control sample (lane 10) depict the correct 282 bp DNA band (black arrow). Lane 11 depicts a negative control sample. (B) Experiment 2—six out of six serum samples as well as a control sample (lane 8) depict the correct 282 bp DNA band (black arrow). Lane 7 depicts a negative control sample.
Microbiolres 14 00002 g004
Microbiolres 14 00002 g005 550
Figure 5. Serum PCR amplification of tRNA (uracil-5-)-methyltransferase yields a common DNA band among core Brucella species. Differences between species is acknowledged only after submission of the DNA band for sequencing and correlating a SNP combination of two nucleotides within this sequence as fingerprints of the Brucella agent (Figure 2). Lane 1—GeneRuler 1kb DNA ladder. Lane 2—A positive control, genomic DNA from an Israeli field strain (DNA sequence proven to be B. melitensis). Lane 3—A positive control, genomic DNA from B. abortus strain 19 (DNA sequence proven to be B. abortus). Lane 4—A negative control sample. Lane 5—Serum 4002118, negative. Lane 6—Serum 4813646, Lane 7—Serum 3991347. Positive DNA bands confirmed as B. melitensis are indicated by an arrow.
Figure 5. Serum PCR amplification of tRNA (uracil-5-)-methyltransferase yields a common DNA band among core Brucella species. Differences between species is acknowledged only after submission of the DNA band for sequencing and correlating a SNP combination of two nucleotides within this sequence as fingerprints of the Brucella agent (Figure 2). Lane 1—GeneRuler 1kb DNA ladder. Lane 2—A positive control, genomic DNA from an Israeli field strain (DNA sequence proven to be B. melitensis). Lane 3—A positive control, genomic DNA from B. abortus strain 19 (DNA sequence proven to be B. abortus). Lane 4—A negative control sample. Lane 5—Serum 4002118, negative. Lane 6—Serum 4813646, Lane 7—Serum 3991347. Positive DNA bands confirmed as B. melitensis are indicated by an arrow.
Microbiolres 14 00002 g005
Table
Table 1. Primers used in the study.
Table 1. Primers used in the study.
Target GeneIntact GenePartial Sequence within the Gene
Forward (P1)Reverse (P2)Forward (P3)Reverse (P4)
omp2a
BMEI1306 		GGCTATTCAAAATTCTGGCGATCGATTCTCACGCTTTCGTTGGAGGTCAGAAATGAACGAGTGCGAAACGAGCGC
tRNA (uracil-5)-methyl
transferase
BMEI1496		ACACTGGCAGGATGAACCTTGCGTTATAGGGCAGAAGCTCCGGAAATCATCGCGCGTCTAGGCACCTTGCCGAAATG
Table
Table 2. Serum PCR analysis of sheep from a flock partially vaccinated with Rev. 1 *.
Table 2. Serum PCR analysis of sheep from a flock partially vaccinated with Rev. 1 *.
Serial No.Ear Tag No.File No.Amplified Sequences
omp2atRNA (uracil-5-)-methyltransferase Sequence
Rev. 1 SequenceField Strain Sequence
2014898849 RE238264 +Negative
2023673916 Y 2014E238264 ++
2034505960 RE238264NegativeNegativeNegative
2044505924 RE238264 +Negative
2054813646 Y 2020E238264NegativeNegative+
2063991347 Y 2016E238264NegativeNegative+
2074002118 Y 2017E238264+ +
2084898827 RE238264+ Negative
2094898865 RE238264+ Negative
2103651960 RE238264NegativeNegativeNegative
* omp2a and tRNA (uracil-5-)-methyltransferase serum PCR analyses of serum samples from ≥1:20 CFT positive sheep. The sequential order of the ear tag numbers indicates different times of visits of the flock (R—red; Y—yellow). Whereas Yellow labels indicate a true time of animal vaccination as young ewe-lambs, the red tag labeled animals indicate at least four visits of the flock, with some animals being retagged due to loss of the original label.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mathur, S.; Bardenstein, S.; Cohen, D.; Banai, M. Serum PCR Diagnosis of Brucella melitensis Infection in Rev. 1 Vaccinated Sheep. Microbiol. Res. 2023, 14, 21-33. https://doi.org/10.3390/microbiolres14010002

AMA Style

Mathur S, Bardenstein S, Cohen D, Banai M. Serum PCR Diagnosis of Brucella melitensis Infection in Rev. 1 Vaccinated Sheep. Microbiology Research. 2023; 14(1):21-33. https://doi.org/10.3390/microbiolres14010002

Chicago/Turabian Style

Mathur, Shubham, Svetlana Bardenstein, Daniel Cohen, and Menachem Banai. 2023. "Serum PCR Diagnosis of Brucella melitensis Infection in Rev. 1 Vaccinated Sheep" Microbiology Research 14, no. 1: 21-33. https://doi.org/10.3390/microbiolres14010002

Article Metrics

Back to TopTop