Formulation, Characterization, and In Vitro Biological Evaluation of a Triple-Phytochemical Nano Delivery System for Colon Cancer Therapy—A Preliminary Feasibility Study

Abstract

Background/Objectives: Poor oral bioavailability and limited intestinal permeation restrict the clinical translation of phytochemicals for colorectal cancer (CRC) therapy. The present preliminary study explored the development of a nanoparticle-based combinatorial formulation of resveratrol (Resv), acetyl-11-keto-β-boswellic acid (AKBA), and quercetin (Quer), to improve intestinal permeation and anti-cancer efficacy. Methods: A triple phytochemical nano formulation (designated as 3X) was developed and evaluated for morphology, particle size, zeta potential, encapsulation efficiency, and in vitro pharmaceutical characteristics. Safety was evaluated using in vitro cytotoxicity assays, while anticancer efficacy and apoptotic potential were preliminarily evaluated in Caco-2 CRC cell lines. Gene expression analysis was performed to examine the modulation of inflammation and cancer-related markers. Results: The 3X formulation exhibited a particle size of 198.5 nm with a polydispersity index of 0.492 and a zeta potential of −32.7, indicating good nanoscale stability. The encapsulation efficiencies were 90% for AKBA, 80% for Resv, and 75% for Quer. In vitro permeation studies demonstrated a controlled release mechanism. The formulation showed minimal hemolysis (3%) and had acceptable in vitro safety. The IC50 of the formulation was found to be 365 µg in the cytotoxicity assay. Treatment with the 3X nanoformulation significantly modulated anti-inflammatory and cancer-related gene expression in Caco2 cells, evidenced by downregulation of TGFβ (Transforming Growth Factor-beta) and COX-2 (cyclooxygenase-2), and upregulation of TNFα (Tumor necrosis factor-alpha) and nitric oxide (NO) and reduced IL-1β (Interleukins-1 beta) expression compared with control cells. Conclusions: The findings demonstrate that the developed 3X nano formulation exhibits favorable permeation characteristics and exerts anticancer activity against CRC. Based on preliminary findings, the formulation represents a promising phytochemical-based combination strategy for CRC, warranting further in vivo studies to validate its efficacy and elucidate the underlying molecular mechanisms.

1. Introduction

Bioactive phytoconstituents are extractives/secondary metabolites of medicinal plants and are beneficial for regulating natural processes within the body [1]. Due to their bioactivity diversity, they produce pharmacological effects through various molecular pathways, including the inhibition of overexpressed proteins, enzymes, amino acids, and hormones, as well as the stimulation of protective enzyme production. Phytoconstituents have been shown to possess antioxidant and relative oxygen generation capacities, highlighting their potential in cancer management. They also combat chemoresistance [1,2]. Based on the established therapeutic efficacy of phytoconstituents in cancer management, this research article focuses on three selected phytoconstituents (AKBA, Resveratrol, and Quercetin). Two initially published review papers highlight the anticancer effects of these phytoconstituents and support the objectives and combination strategy of the present study [2,3].

Boswellia oleo-gum resin and its components, derived from several Boswellia species, have been extensively used for various therapeutic applications [4]. Comparatively, out of the different Boswellic acids (triterpenoid), viz., α-boswellic acid (ABA), β-boswellic acid (BBA), 11-keto β-boswellic acid (KBA), and 3-acetyl-11-keto-β-boswellic acid (AKBA), AKBA is highly effective therapeutically against colo-rectal cancer (CRC) [5]. Resveratrol (3,5,4′-trihydroxy-trans-stilbene) is a polyphenolic compound found in various sources such as grapes, nuts, berries, dark chocolate, and especially red wine. Trans-resveratrol has been reported to possess biological properties, including high antioxidant, anti-cancer, anti-inflammatory, and anti-aging properties [6]. The flavonoid Quercetin (3,3′,4′,5,7-pentahydroxyflavone) is abundant in vegetables, fruits, and tea. Quercetin exhibits pharmacological effects, including anti-inflammatory, anti-apoptotic, psychostimulant, and anti-platelet aggregation properties. It has also been shown to increase capillary permeability and enhance mitochondrial biogenesis [7]. Figure 1 shows the chemical structures of these phytochemicals.

Poor absorption and low bioavailability blemish the pharmacological properties of all these phytochemicals. Resveratrol and quercetin are classified as BCS (Biopharmaceutics Classification System) class II, while AKBA is classified as a BCS class IV agent. This implies that these phytoconstituents possess low solubility [8,9,10]. Nanoformulation approaches have been proven to be quite effective in enhancing the pharmacokinetic profile of small molecules [9]. Nanotechnology-based delivery of phytochemicals presents numerous advantages, including the passive transport of molecules across biological membranes, improved permeation and bioavailability, site-specific delivery, protection from biological and environmental degradation, and controlled release. A plethora of empirical evidence highlights that these phytochemicals have improved their pharmacokinetic and pharmacological properties in nanoformulated preparations. For the treatment of ischemic stroke, the area under the curve (AUC) in rat plasma increased from 100 to 373 when AKBA was encapsulated in carboxymethyl cellulose (CMC) nanoparticles [11]. A unique formulation of AKBA in chitosan-sodium alginate-calcium chloride nanoparticles enhanced the anticancer activity in HT29 cells. It was shown that the apoptotic rate in HT29 cells was higher with AKBA nanoparticles compared to 5-fluorouracil [12]. Resveratrol nanoparticles prepared using poly lactide (PLA) showed a significant reduction in colon tumors in mice [13]. The formulation of phytochemicals in carriers like phospholipids can overcome the pharmacokinetic limitations as compared to other formulation approaches. Resveratrol encapsulated in phosphatidylcholine is cytotoxic in HT 29 cells. The resveratrol liposomes also showed that the invasive ability of HT-29 tumor cells was reduced by 1.3-fold in the presence of activated fibroblast cells [2]. Such data indicate that AKBA and resveratrol liposomes have potent anticancer capabilities with improved pharmacokinetic patterns. The bioavailability of phytochemicals is limited because of first-pass metabolism by liver enzymes and impaired absorption from the intestine due to the p-glycoprotein efflux pump [3]. Quercetin, one of the phytochemicals, has been found to inhibit P-gp and liver enzymes, thereby acting as a bioenhancer for various cancer drugs, including etoposide, doxorubicin, and paclitaxel. Quercetin nanoparticles have a significant impact on the pharmacokinetics of cancer drugs. It has been reported that the half-life of methotrexate nanoparticles increased by 2.2-fold in the presence of quercetin [14]. Hence, combining quercetin with other phytoconstituents was considered an effective formulation approach.

Among various types of nanoparticle formulations, lipid-based nanoparticles are the most preferred as they can effectively encapsulate various types of drugs and exhibit enhanced stability and controlled release properties [15]. Liposomes are colloidal carriers, usually 0.05–0.5 μm in diameter, and are formed spontaneously when specific lipids are hydrated in aqueous media. The lipid bilayer encloses an aqueous phase where the drug can be stored. Phytosomes are formed from the reaction between stoichiometric amounts of phosphatidylcholine and phytochemicals. The choline head group forms a complex with the phytochemical, and the lipid chain envelopes the complex [16].

Despite extensive research on the anticancer efficacy of nanoparticle-containing AKBA and resveratrol, limited evidence is available on phytochemical combination mechanisms to further improve their therapeutic efficacy [2,3]. This research also aimed to incorporate quercetin, a well-documented bioenhancer with additional therapeutic properties, into this combinatorial formulation (3X). While these phytochemicals have demonstrated potent anticancer effects through multiple mechanisms, the convergence of these mechanisms in a combination formulation suggests the possibility of better therapeutic efficacy. The present preliminary study focuses on the development and characterization of a triple-phytochemical nanoformulation incorporating AKBA, resveratrol and quercetin, which has not been previously evaluated as a unified nanoformulation for CRC. The study further evaluates the intestinal permeation kinetics of nanoformulation along with an integrated assessment of safety, cytotoxicity and apoptosis induction. The study further examines the CRC-specific inflammatory and cancer-related gene expression modulation in Caco-2 cells. Overall, this preliminary investigation supports the feasibility of a combinatorial phytochemical nanoformulation delivery strategy for CRC.

2. Materials and Methods

2.1. Materials

AKBA and resveratrol (high purity > 98%) samples were generously gifted by Sami-Sabinsa Group Limited (Bengaluru, India). Quercetin (purity 97%) and cholesterol were procured from Thermo Fisher Scientific (Cheshire, UK). Soy lecithin (30% phosphatidylcholine) and Span 80 were purchased from Sisco Research Laboratories Private Limited (Mumbai, India). Brine shrimp eggs were purchased from Ocean Nutrition (Samutprakarn, Thailand). For permeation studies, fresh goat intestinal membranes were obtained from a local slaughterhouse (licensed). The study protocol was approved by the Institutional Ethics and Biosafety Committee (FERG-BF/01/21-22 dated 27 February 2022), College of Pharmacy, National University of Science and Technology.

For in vitro studies, Caco-2 cell lines (colon) were procured from the National Centre for Cell Science (NCCS), Pune, India. The cells were maintained in an incubator using cell culture bottles containing cell media. MEM Alpha (cat. no. 12561-049; Gibco, Thermo Fischer Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS) (cat. no.10270106; Gibco, Thermo Fischer Scientific, Waltham, MA, USA) medium containing 1X Antibiotic-Antimycotic (cat. no. 15240096; Gibco, Thermo Fischer Scientific, Waltham, MA, USA) was used for Caco2 cells. Trypsin EDTA 1X and 3-(4,5-dimethylthiazol-2-yl)-2,5-2,5-diphenyltetrazolium bromide (MTT) were purchased from HiMedia Laboratories (Mumbai, India). All other chemicals and reagents used for this research were of analytical grade.

2.2. Methods

2.2.1. Preparation of 3X Formulation

The formulation was prepared using a three-step approach, which included encapsulating AKBA, resveratrol (Resv), and quercetin (Quer) in the lipid formulation. The formulation steps followed are as follows:

Step 1: Formulation of AKBA liposomes

A total of 100 mg AKBA and 10 mg cholesterol were dissolved in 20 mL of 100% ethanol. This solution was then added dropwise at a rate of 0.4 mL/min using a syringe pump (BioX, SPA112, Shanghai, China) into 20 mL of preheated water (70 °C) containing a few drops of Span 80 (100 µL). This mixed solution was continuously stirred at 300 rpm (Stuart CB162, Staffordshire, UK) with the continuous addition of 20 mL AKBA solution, resulting in the formation of AKBA liposomes. This was followed by a homogenization process.

Step 2: Formulation of resveratrol and quercetin phytosomes

Resveratrol (10 mg) and quercetin (5 mg) were weighed and added to 10 mL of absolute ethanol to create Mix 1. In another beaker, soy lecithin (50 mg) and 10 mg cholesterol were mixed with 10 mL chloroform to form Mix 2. The two solutions, mix 1 and 2, were combined and stirred at 100 rpm for 60 min to formulate phytosomes.

Step 3: 3X Formulation

The phytosome mixture was then added to AKBA liposomes dropwise at a rate of 0.4 mL/min using a syringe pump. As shown in Figure 2, the final formulation was designated as the 3X (triple phytochemical) formulation. The solvent from the 3X formulation was removed under vacuum at 45 °C in a round-bottom flask using a rotary evaporator (Stuart RE300DB, Staffordshire, UK), set at 200 rpm. After 2–3 h, the flask was removed and stored overnight in a desiccator. The formulation from the flask was then collected using water, resulting in a creamy liquid with a milk-like consistency. Size reduction in the formulation was performed at 50,000 rpm using a homogenizer (IKA Ultra Turrax, Baden-Württemberg, Germany) for three pulses of 30 s each, followed by a 2 min rest between pulses. The 3X formulation was then characterized using various analytical techniques.

The composition of the nanocontainers was selected based on physicochemical compatibility, formulation performance, stability, and biological relevance. During formulation development, multiple optimization iterations were conducted to refine component ratios and processing conditions. The final nanocontainer composition mentioned in this report exhibited satisfactory stability and reproducibility. This formulation strategy was designed based on the distinct chemical properties of the selected phytoconstituents. AKBA, being highly lipophilic, was first incorporated into liposomes to enhance its dispersibility and stability. In contrast, resveratrol and quercetin possess polyphenolic structures with multiple hydroxyl groups, which favor molecular complexation with phospholipids; therefore, these compounds were formulated as phytosomes. The final 3X formulation was developed by integrating the phytosome system into AKBA-loaded liposomes, enabling the simultaneous incorporation of chemically diverse phytoconstituents within a single nanocarrier system.

2.2.2. Particle Size Estimation

Surface charge of 3X formulation (zeta potential), polydispersity index (PDI), and particle diameter (Z-average) of 3X formulation were measured using a dynamic light scattering (DLS) instrument (Zetasizer Nano ZS, Malvern Instruments, Malvern, UK). Samples were diluted with distilled water before measurement to minimize multiple scattering effects. The PDI value provided a measure of uniformity of the particle size distribution. Samples were diluted 50-fold with distilled water, and the analysis was performed at 25 ± 2 °C.

2.2.3. Particle Morphology Characterization

The particle morphology of the 3X formulation was determined using a Scanning Electron Microscope (SEM) (Axia-SEM, Thermo Fischer Scientific, Waltham, MA, USA), and a field-emission Transmission Electron Microscope (TEM) (JEOL JEM-2100F, JEOL Ltd., Tokyo, Japan) by adopting standard protocols [17,18].

2.2.4. Encapsulation Efficiency

Encapsulation efficiency (EE) was estimated using a T60 UV/Vis spectrophotometer (T60 UV–Vis spectrophotometer (PG Instruments Ltd., Lutterworth, UK). The 3X formulation (1 mL) was centrifuged (Biocen 22R centrifuge, Madrid, Spain)) at 15,000 rpm for 10 min [8]. The supernatant was analyzed for any free constituents at 245 nm (AKBA), 305 nm (resveratrol), and 365 nm (quercetin) using ethanol dilutions. This was considered an unbound fraction. The pellet was dissolved in ethanol (1 mL), and the amount of bound fraction was analyzed at respective wavelengths. EE% was calculated for the respective phytoconstituents [8] using the following equation:

EE (%) = Encapsulated phytoconstituents/Total amount of added phytoconstituents × 100

2.2.5. Fourier Transform Infra-Red Spectroscopy (FTIR) Analysis

The FTIR patterns were recorded using a Shimadzu 8400 S spectrophotometer (Shimadzu Corporation, Kyoto, Japan) at a wavenumber range of 4000–400 cm⁻¹. The KBr-pellet method was used for IR spectroscopy [19,20].

2.2.6. X-Ray Diffraction (XRD) Analysis

The crystalline/amorphous nature of the 3X formulation was investigated by an X-ray diffractometer (Aeris X-ray diffractometer- Malvern Panalytical, Malvern, UK) equipped with a Cu anode at a wavelength of 1.54 Å. Pure compounds did not require preparation because they were in powder form. However, for the 3X formulation, a few drops were spread on an XRD slide and dried at room temperature to form a thin layer. It was analyzed at room temperature at the [°2θ] position of 5–84.

2.2.7. Thermal Behavior and Melting Point Analysis

Differential scanning calorimetry (DSC) analysis was performed using a DSC model (Jade DSC-PerkinElmer, Waltham, MA, USA) to determine the melting point and enthalpy of the 3X formulation. The possibility of any interaction between the phospholipid, AKBA, resveratrol, and quercetin was assessed by thermal analysis of the 3X formulation samples. A sample equivalent to approximately 5 mg was placed in an aluminum pan, and DSC analysis was carried out at a nitrogen flow rate of 20 mL/min and a heating rate of 5 °C/min, from 50 °C to 305 °C. An empty aluminum pan was placed on the reference platform. The thermal analysis of sample parameters in the DSC thermogram included the onset temperature (T0), the peak temperature or the gel-to-liquid-crystalline transition, the end-set temperatures (Te and T0), and the enthalpy change in the transition [21]. The thermal behavior of the formulation was further confirmed by the melting point apparatus (BMP-2C, BIOBASE Group, Jinan, China).

2.2.8. Permeation and Kinetics Pattern

The Franz diffusion cell apparatus (Orchid Scientific and Innovative India Pvt. Ltd., Maharashtra, India) was used to study the permeation pattern and kinetics of the components in the formulation. Intestine membranes from goats obtained from a local slaughterhouse were used in the study [19]. The receiver chamber was filled with PBS (Phosphate-Buffered Saline)-pH 7.4 and was continuously stirred at 50 rpm. The 3X formulation (1.5 mL) was added to the donor chamber of the diffusion cell on the basal side of the intestinal membrane. The receiver and donor chambers were secured with a clip, and the circulating water was adjusted to 37 °C. After stipulated time intervals, 1 mL of the sample was withdrawn, and the sink conditions were maintained by replenishing with 1 mL of PBS. The samples were analyzed using a UV–Vis spectrophotometer (T60 UV–Vis spectrophotometer (PG Instruments Ltd., Lutterworth, UK). The results were expressed as the concentration of each drug released over time, and the standard deviation of three replicates. The permeation data were used to fit five kinetic models, namely the zero-order, first-order, Higuchi, Korsemeyer–Peppas, and Hickson–Crowell models. The release rate constant and release exponent were also calculated using the data. To study the kinetics, data obtained from the permeation study were plotted using various kinetic models [8,12].

2.2.9. Biocompatibility and Toxicity Analysis of 3X Formulation

The following toxicity studies were conducted to assess the safety of the 3X formulation.

Hemocompatibility assay

The hemocompatibility assay was performed according to the standardized protocol [22]. Fresh whole blood collected from the slaughterhouse was washed to remove the platelet-rich plasma, buffy coat layer, and leukocytes (WBCs), and then processed according to the standardized protocol. The washed red blood cells were diluted with PBS buffer (pH 7.4) to achieve a concentration of 40,000 cells/mL. Six microfuge tubes containing 100 μL of RBCs and 900 μL of PBS buffer (pH 7.4) were taken. Different concentrations of the 3X formulation, ranging from 100 mg to 0.05 mg, were prepared and incubated for 30–40 min. A negative control did not consist of the formulation, and one drop of detergent (Tween 80) was added to a positive control. The RBCs were separated by centrifugation at 5000 rpm for 5 min. The supernatant was read at 405 nm in a UV–Vis spectrophotometer using PBS buffer (pH 7.4) as the blank. The experiment was performed in triplicate (average), and the percentage haemolysis was calculated using the standardized formula.

Shrimp toxicity assay

Shrimp eggs were inoculated in 200 mL of water with 1 g of sea salt as per the standard protocol [23]. The glass beaker was kept in a warm place for the shrimps to hatch. A total of 20 shrimps were placed in 10 mL of water in a Petri dish for each concentration of the formulation. The concentrations of the 3X formulation taken were 100 mg, 10 mg, 1 mg, 0.1 mg, and 0.01 mg. The shrimp were observed for mortality over time. The water with sea salt was used as a negative control, and potassium dichromate was used as a positive control. The percentage toxicity and probit value were used to calculate the LC₅₀ value of the formulation.

MTT Cytotoxicity assay

The cytotoxic effect of the 3X formulation on CRC cells was investigated using the Caco-2 cell line. The respective cells were seeded at 10³ cells per well in 96-well plates for 24 h at 37 °C and 5% CO₂. The medium was replaced with media containing either a standard drug mix (AKBA, resveratrol, quercetin) or a 3X formulation in a dilution range of 700–10 μg/mL. After 24 h, the drug-containing media were discarded from the wells, and the cells were washed twice with complete medium. This was followed by the addition of 3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide (MTT) (0.5 mg/mL, pH 7.4). Cells with reagent were incubated for 4.5 h at 37 °C, followed by the addition of 100 μL of dimethyl sulfoxide (DMSO). The plates were further incubated for 30 min to allow dissolution of the drug. The absorbance at 570 nm was monitored by a Multiskan SkyHigh Microplate Spectrophotometer (Catalog number: A51119600C, Thermo Fisher Scientific, Waltham, MA, USA). The physical mix of phytoconstituents was used as a control in the assay. Cell viability was expressed as a percentage of the control cells. Cell viability was calculated as [[Abs]_sample/[Abs]_control × 100%]. All experiments were repeated three times, and data were presented as the mean ± standard deviation (SD). The half-maximal inhibitory concentration (IC₅₀) was calculated using the linear regression method [24].

2.2.10. In Vitro Efficacy of 3X Formulation

Apoptosis assay

The capability of the 3X formulation to induce apoptosis was investigated in CRC cell lines. To study the apoptosis-inducing capability of the 3X formulation, Caco-2 cells (10⁵ cells per well) were seeded in 12-well plates and incubated at 37 °C under 5% CO₂ for 18–24 h to achieve a confluence of approximately 80%. They were then treated with a standard phytoconstituents physical mixture (100 μg) used as the control and the 3X formulation (different concentrations) for 24 h to induce apoptosis. After 24 h, the cells were washed twice with 1x PBS and detached using 0.25% trypsin-EDTA. The cells were collected in tubes and centrifuged at 1500 rpm for 5 min to obtain the cell pellets. The supernatant was discarded, and the cell pellets were rinsed twice with ice-cold PBS. The cell pellets were resuspended in 195 μL 1× Annexin V-FITC binding buffer. Alexa Fluor 488 (5 μL) and propidium iodide (PI) solutions (100 μg mL⁻¹, one μL) were added to each 100 μL cell suspension. The cells were incubated in the dark at room temperature for 10–20 min, after which 400 μL of binding buffer was added to the tubes. The stained cells were analyzed by flow cytometry (Becton Dickinson, Franklin, NJ, USA) at an excitation wavelength of 488 nm. The emission of Alexa Fluor 488 was recorded on the FL-1 channel, while that of PI was recorded on the FL-3 channel. Cells were gated upon acquisition using forward vs. side scatters to eliminate the dead cells and debris, and 10,000 gated events were collected for each sample. Analysis was performed using CellQuest Pro software version 5.1, Becton Dickinson, Franklin, NJ, USA).

Gene expression analysis

RNA was isolated using the TRIzol solubilization method developed by [25]. The harvested cells after drug treatment were treated with 1 mL of TRIzol reagent, followed by homogenization and phase separation at 12,000 rpm. The aqueous layer, consisting of RNA, was washed with isopropanol, and the pellet obtained after centrifugation at 12,000 rpm was then washed with ethanol. The pellet was air-dried and suspended in nuclease-free water. The RNA obtained was used for cDNA synthesis. The cDNA was synthesized according to instructions given in the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher, Cat. no. 4368814). The cDNA was used to analyze the expression of selected genes. Real-time PCR was performed using appropriate primers (Thermo Fisher) for the expression of VEGF (Primer sequence-VEGF-F—GAGATGAGCTTCCTACAGCAC and VEGF-R—TCACCGCCTCGGCTTGTCACAT), TNF-α (Primer sequence-TNF alpha-F—ATGAGCACTGAAAGCATGATCC and TNF alpha-R—GAGGGCTGATTAGAGAGAGGTC), TGF-β (Primer sequence-TGF Beta-F—CCCAGCATCTGCAAAGCTC and TGF Beta-R—GTCAATGTACAGCTGCCGCA) and COX2 (COX2-F TGGGCCATGGAGTGGACTTA and COX2-R—GACGTGGGGAGGGTAGATCA). The reaction was performed using PowerUp™ SYBR™ Green Master Mix for qPCR Cat. No. A25742 in a Quant Studio-5 (Applied Biosystems, Carlsbad, CA, USA) [26].

Chemokines (IL-β and NO) analysis

The cell supernatant obtained after treating the cells with the samples was analyzed for the accumulation of IL-β (Ref: KLR0119/Lot No: RIL1B0224) and NO (Ref: KBH12874/Lot No: RNO0324) as per the manufacturer’s instructions. The quantitation of IL-β and NO was done using human IL-1 β Genlisa Elisa kit (Krishgen Biosystems, Cerritos, CA, USA Ref: KB1063) [27].

2.2.11. Statistical Analysis

Data were presented as mean ± SD and analyzed by the statistical software package GraphPad Prism 5 version (GraphPad Software, San Diego, CA, USA). Some data are presented as an average of triplicate. The statistical analysis included a one-way analysis of variance (ANOVA) followed by the Tukey post hoc test. The difference between the two parameters was considered statistically significant for p < 0.05.

3. Results and Discussion

3.1. Formulation Preparation

The three-step formulation process was successful, resulting in a stable, nanostructured 3X lipid-based formulation that combined the phytoconstituents AKBA, resveratrol, and quercetin. In the first step, uniform stable AKBA liposomes were formed, which were confirmed through optical microscopy. These liposomes maintained their stability during mixing and homogenization. The combination process in steps two and three was also effective, with no phase separation observed throughout. The final 3X formulation appeared as a creamy suspension (Figure 3A), indicating successful encapsulation of all three phytoconstituents. There was no visible aggregation in the formulation, which indicated stability with uniformity, as confirmed through optical microscopy (Figure 3B). A free-flowing powder was obtained after freeze-drying (NB-18N freeze dryer, Nanbei Instrument Co., Ltd., Zhengzhou, China), which remained stable, as shown in Figure 3C. The three-step formulation process was repeated multiple times for validation, and the results were consistent, demonstrating its reliability, reproducibility, and success.

3.2. Morphology and Particle Size of 3X Formulation

As shown in Figure 3A,C, a suspension and a powdered sample of the 3X formulation were obtained with encapsulated phytoconstituents. The formulated suspension and freeze-dried sample dispersed easily in water, thereby resolving the solubility issues of AKBA, resveratrol, and quercetin. The SEM images, at resolutions of 15,000× and 30,000×, shown in Figure 4, indicate the morphology of the formulation. To further confirm the morphology, a transmission electron microscopy (TEM) characterization was performed. The results are shown in Figure 5A,B. The TEM images indicate that the obtained formulation is homogeneous, with good morphology, and most of the particles were in the range of 200 nm. This was further confirmed by a particle size analyser report showing that particles were in the size of 198.5 nm with a zeta potential of −32.7 and a PDI of 0.492 (Figure 6A,B).

These results indicated that the particles of the 3X formulation were almost spherical, uniform, with a smooth surface, and well separated. There was no visible particle aggregation during the observation, and it was further reconfirmed by the zeta potential value. The particle size diameters observed via SEM and TEM showed a range similar to that detected using the particle size analyzer. This morphological observation also suggests that the TEM image provides better morphological insight compared to the SEM for the phytochemical formulation approach. The low PDI also indicated that the 3X formulation was homogeneous. The PDI values depicted the size distribution of the liposomes, which can also be correlated to the stability of the formulation [28]. A PDI value between 0.3 and 0.5 signifies the homogeneity of the particles in the formulation [29]. The PDI value obtained in the 3X formulation was 0.492, indicating a high homogeneity of the 3X formulation particle size. The PDI value remained between the range of 0.3–0.5 when dispersed after freeze-drying.

3.3. Encapsulation Efficiency (EE) of 3X Formulation

The results of the EE of the 3X formulation, calculated using UV spectroscopic analysis, showed 90% for AKBA, whereas resveratrol and quercetin showed 80% and 75%, respectively. The efficiency of several phytochemicals in liposomal formulations ranged from 60 to 90%, and it was markedly affected by the process and formulation factors used in different studies [30]. Some researchers reported that formulation processing temperature and injection rates (flow rate) affected the encapsulation efficiency of phytoconstituents. However, liposomal formulations have received considerable attention for encapsulating phytoconstituents due to their structural validity and ability to encapsulate and transport both hydrophilic and hydrophobic compounds. They also offer targeted delivery, low toxicity, biocompatibility, and protection of the encapsulated compound from adverse environmental conditions, e.g., the tumor microenvironment [31]. The present study encapsulation efficiency values fall within the reported 60–90% range for liposomal phytochemical systems, confirming the effectiveness of the selected formulation parameters.

3.4. Chemical Characterization of 3X Formulation

3.4.1. Fourier Transform Infra-Red Spectroscopy (FTIR) Analysis

The characterization of chemical bonds and their shifts by FTIR analysis is informative for understanding the possible chemical bond formation between lecithin and resveratrol, quercetin, and AKBA. The FTIR spectra (Figure 7A–E) of pure AKBA, resveratrol, quercetin, lecithin, and the 3X formulation were analyzed to understand the possible interactions between them. The pure AKBA exhibited characteristic peaks at 2900–2870 cm⁻¹ (C-H stretching for the aldehyde group) and 1740–1720 cm⁻¹ (strong C=O aldehyde stretching). Pure resveratrol exhibited a characteristic peak at ~3230 cm−1 (O-H stretching) and a strong peak at 1604 cm⁻¹ (C=O aldehyde stretching) [6]. Quercetin resembled resveratrol, with a broad peak between 3580 and 3300 (O-H stretching) and a characteristic peak pattern between 1666 and 1168 signifying the C=C alkene and the carboxylic acid group stretching [32]. The FTIR peaks for lecithin showed strong peaks between 3400 and 2900 representing the O-H stretching for alcohol and carboxylic acid groups. Another strong peak at 1740 in lecithin represented carbonyl carbon stretching. In the 3X formulation, the strong peaks that AKBA represented at 2974–2870 were merged with lecithin at 2928–2854. Another characteristic peak in pure AKBA at 1242, representing the C-O-C stretch, was reduced in intensity. The resveratrol peaks in the 3X formulation showed the merger of its characteristic peaks between 1710 and 1685 into one strong peak at 1740. Quercetin, too, had a merger of its characteristic peak pattern with that of lecithin. The broad peak at ~3300 in resveratrol and quercetin also shifted to ~3400 in the 3X formulation.

Generally, in liposomes, there are no direct interactions between the molecule and lecithin; however, in phytosomes, there is hydrogen bond formation between the polar head group of phospholipid and drug molecules. The broader peaks of resveratrol and quercetin at 3290 and 3390, respectively, shifted to 3429 in the phytosome indicates formation of hydrogen bonds between the hydroxyl (-OH) groups of phenolic rings in RES and the phosphate (P=O) groups in lecithin. The other peaks for resveratrol and quercetin were present in the FTIR spectra of the 3X formulation, indicating that the main chemical interaction between these compounds and lecithin was through hydrogen bonding. The peaks characteristic of AKBA, resveratrol and quercetin merging with peaks of lecithin indicates significant entrapment of the drugs in the liposomal/phytosomal formulation [33]. Similar results reported for rutin, gingerol and silymarin strongly suggest the chemical interaction between these phytochemicals and lecithin [6]. AKBA liposomes showed a decrease in peak intensity, characteristic of pure AKBA powder, as discussed.

3.4.2. X-Ray Diffraction (XRD) Analysis

XRD provided a substantial insight into the crystallinity of the formulation compared to the powder forms of AKBA, resveratrol, and quercetin. The powder forms of AKBA, resveratrol, quercetin and the 3X formulation were investigated in XRD and are shown in Figure 8. The XRD of AKBA showed three peaks: a broad peak at 13.53 °2θ, a sharp peak at 21.81 °2θ and a small peak at 33.67 °2θ. In the 3X formulation preparation, the intensity of all peaks was reduced to such an extent that they could not be counted as individual peaks, except for the peak at 33.67 °2θ, which had a reduced intensity in the 3X formulation preparation. Resveratrol, as reported earlier, showed sharp peaks because of the crystalline structure at °2θ = 6.2, 12. 7, 15.9, 18.7, 21.7, 23.1, 24.8, 27.9 and 31.4 [6,34]. Similarly, with quercetin, which has structural resemblance to resveratrol, there were intense peaks observed in the XRD pattern at °2θ = 10.4, 12.1, 15.6, 21.8, 24.1, 26.9 [35]. The sharp peaks were a clear indication of the highly crystalline nature of quercetin powder. The 3X formulation exhibited an amorphous XRD pattern with peaks at angles ranging from ~10° to 28°. All the major peaks for resveratrol and quercetin were reduced significantly in intensity °2θ = 15.8, 18.6 and 21.9.

The results clearly indicated significant dispersion of AKBA, resveratrol and quercetin in the liposomal/phytosomal form in the 3X formulation (Figure 8A–D). The crystalline nature of the phytochemicals was transformed into an amorphous nature in the formulation, thereby indicating homogenous entrapment of the phytochemicals in the nanocarriers. The 3X formulation had a peak recorded at 15.8°, equivalent to resveratrol at 15.9° and to quercetin at 15.6°; a second peak at 18.6°, equivalent to resveratrol at 18.7°; and a third peak at 21.9°, equivalent to resveratrol at 21.7° and to AKBA and quercetin at 21.8°. These results clearly indicated that AKBA, resveratrol, and quercetin were encapsulated, and their crystalline forms were converted to amorphous forms. The less ordered structure and amorphous state contributed to the higher loading capacity and stability of nanocarriers [36]. Previous studies have also depicted lower intensity of peaks in phospholipid and sterol combination relative to the peaks of pure crystalline forms of chemicals [37,38].

3.4.3. Thermal Behavior and Melting Point Analysis

In DSC analyses, the pure AKBA showed a prominent endothermic peak at 164 °C, whereas resveratrol and quercetin were revealed at approximately 267 and 320 °C, respectively. The 3X formulation showed an endothermic peak at 187.62 °C (Figure 9). The complete disappearance of the other phytoconstituents was observed for this freeze-dried 3X formulation. This observation could be related to the proof of lipid formulation and be an indicator of amorphization and or inclusion of complex formation. The 3X formulation improved solubility and reduced crystallinity, which could be attributed to a decrease in the melting point and enthalpy. These results were further confirmed by analyzing the melting point of the phytoconstituents and formulation. AKBA showed a melting point range from 160 to 168 °C, whereas Quercetin showed 320–350 °C, and resveratrol showed 269–270 °C, respectively. The 3X formulation showed a melting point in the range of 190–200 °C. These melting point results are consistent with the DSC report, and therefore, it can be proposed that the complete disappearance of the endothermic peaks of specific phytoconstituents in the formulation could be due to the loading/encapsulation/lipid bilayer formation/amorphization/complex formation.

3.5. Permeation and Kinetics Pattern of the Formulation

Figure 10A depicts the permeation profile of the three phytoconstituents over 48 h from the 3X formulation. The concentration of AKBA increased rapidly within the first few hours and continued to rise steadily, reaching over 2000 µg/mL at 48 h. Resveratrol showed a slow and steady plateauing around 100 µg/mL after 24 h, and Quercetin demonstrated a gradual and slightly higher plateau than resveratrol, then plateauing around 200 µg/mL. The permeation profile of the 3X formulation follows a uniform pattern rather than the permeation profile of individual phytoconstituents (Figure 10B), which exhibited irregular and non-uniform permeation behavior patterns when evaluated in their free (non-formulated) form under identical experimental conditions. The concentration data of the penetrated phytoconstituents was used to fit five kinetic models: the zero-order, first-order, Korsemeyer–Peppas, Hickson–Crowell, and Higuchi models. Using the data, the release rate constant and release exponent were also calculated. The R² values obtained for all the models for AKBA, resveratrol and quercetin are shown in

Table 1. R-squared values of AKBA, resveratrol and quercetin in different kinetic models.

Release Kinetics	AKBA	Resveratrol	Quercetin
	R-Squared Value—Regression Model
Zero-Order	0.9967	0.9857	0.995
First-Order	0.7755	0.9767	0.8462
Higuchi model	0.9551	0.9107	0.97
Hickson–Crowell model	0.5916	0.7456	0.5203

and

Table 2. K and n values, the rate constant, and release exponent of AKBA, resveratrol, and quercetin from the 3X formulation as deduced from the Korsmeyer–Peppas model (KP model).

KP Model	K Value	n Value	Mechanism
AKBA	0.037477	1.23279	Super case II transport
Resveratrol	0.029087	0.930856	Case I transport
Quercetin	0.095192	0.625125	Anomalous transport

.

The Franz diffusion cell was used as an indicator for permeation study of drugs, specifically hydrophobic agents, including AKBA, resveratrol, and quercetin. It is evident from the kinetics model R² value that AKBA followed zero-order release kinetics from the 3X formulation. Resveratrol had a close R² value between zero-order and first-order kinetics. Resveratrol permeability is dependent both on its concentration and the enhancement in solubility; hence, the R² values for zero-order and first-order are close in value. In the case of quercetin, the R² value shows the best fit for zero-order kinetics, indicating a penetration pattern of the drug independent of its concentration in the formulation, signifying the ease of solubility. However, a R² value of 0.97, indicating a good fit with the Higuchi model of release kinetics, suggests the formation of multilamellar vesicles during thin film hydration during the 3X formulation process. The release exponent values (n) of the 3X formulation analyzed using the Korsmeyer–Peppas model indicate super case II transport for AKBA, case I transport for resveratrol, and anomalous transport for quercetin (Table 2). This indicates that the overall release behavior of the 3X formulation arises from the combined contribution of phytoconstituents with different transport mechanisms. These results provide preliminary insight into intestinal permeation behavior. Further in vivo studies in different animal models may be needed to further explore the pharmacokinetic pattern, and it warrants additional investigation in the future.

3.6. Toxicity Studies

3.6.1. Hemocompatibility Assay

As shown in Figure 11, there is negligible lysis of red blood cells at different concentrations of the 3X formulation. At 20 mg, 3X formulation, there was 3% lysis observed upon incubation for 1 h. The percentage of cell lysis reduced with lower concentrations, and at 1 mg, only 0.15% of the cells were lysed.

3.6.2. Shrimp Toxicity Assay

A total of 20 Artemia salina larvae (nauplii) were exposed to different concentrations of the 3X formulation. All the experimental shrimps tolerated the 3X formulation very well. The shrimps were found to be alive and active up to 6 h at a concentration of 100 μg/mL of 3X formulation. The negative controls showed no mortality up to 6 h, whereas the positive control showed 99.8% mortality. A higher concentration of 1000 μg/mL was also well tolerated for up to 4 h. At very high concentrations, however, partial mortality was observed after 4 h at 10,000 μg/mL and after 2 h at 100,000 μg/mL. Based on the data as shown in Figure 12, the LC₅₀ calculated was found to be 25 mg/mL at 6 h. The LC₅₀ values of the 3X formulation were determined based on the Meyer toxicity index [39]. According to this index, compounds with LC₅₀ values below 1 mg/mL were classified as toxic, while those with LC₅₀ values above 1 mg/mL were regarded as non-toxic, using the brine shrimp as the test organism. Hence, the 3X formulation showed LC₅₀ values above 1 mg/mL for various concentrations and time periods, indicating low nonspecific toxicity of the formulation. It is necessary to consider that all these exposures were conducted without feeding the shrimps.

3.6.3. Cytotoxicity Assay

To evaluate the in vitro anti-cancer activity of the three drugs, the 3X formulation was investigated for its effects on the CRC cell line Caco2 using the MTT assay. The yellow tetrazolium MTT (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) is reduced by metabolically active cells, in part by the action of dehydrogenase enzymes, to generate reduced equivalents such as NADH and NADPH. The physical mix of phytoconstituents was used as a control in the assay. As shown in Figure 13A, the 3X formulation resulted in the attrition of CRC cells in a dose-dependent manner in a concentration range of 700–10 μg. The physical mix of the phytoconstituents used as a standard did not show any correlation with increasing concentration of the drug (Figure 13B). For Caco2 CRC cells, the IC₅₀ of the 3X formulation was found to be 357 μg (Figure 13C), indicating modest activity. The efficacy of the 3X formulation in comparison to the physical mixture is therefore more apparently attributed to improvements in absorption/cell membrane penetration behavior achieved through nanoencapsulation with more consistent dose-dependent activity.

It is evident from the cytotoxicity results that the 3X formulation exhibited dose dependent effect on the attrition of CRC cell Caco-2 compared to the phytoconstituent physical mixture. The haemolysis and shrimp toxicity assay suggested that the 3X formulation was non-toxic to normal human cells. These results hence confirmed that the 3X formulation was selective in targeting cancer cells. Hence, it can be concluded that the cytotoxicity was due to the encapsulated phytoconstituents in the 3X formulation and their favorable pharmacological action. The phytoconstituents mix did not show any corresponding effect of concentration on cell viability because of low solubility.

3.7. In Vitro Efficacy of 3X Formulation

3.7.1. Apoptosis Assay

The ability of the 3X formulation to induce apoptosis in CRC cells was assessed in the Caco2 cell line using Annexin V-FITC dual staining followed by flow cytometry analysis. Figure 14 represents the quantitative distribution of the cell population, and Figure 15 corresponds to quadrant plots. The results (Figure 14) indicated that the population of apoptotic cells increased with increasing concentration of the 3X formulation (concentration-dependent cell death).

The results demonstrate that cell apoptosis increased (6%) with increasing concentration of the 3X formulation. In early apoptosis (Figure 14), both groups (low and high concentrations of 3X) showed only a modest increase (~1%) compared to the control, indicating the initiation of apoptosis. However, an increase in dead cells (13.9%) at 357 μg (high concentration) was observed compared to the control (8%). This observation was supported by the flow cytometry plots (Figure 15C), which showed an increase in the PI-positive cell population. This increase in PI-positive cells relative to early apoptosis suggested that at higher concentrations, the 3X formulation induced cell death through late-stage apoptosis or apoptosis-independent cytotoxic mechanisms rather than a linear increase in apoptotic events. Further studies are warranted with different cell lines to confirm the results of this study. Phase contrast microscopy image (Figure 16) revealed pronounced morphological alterations in Caco2 cells, followed by treatment with 3X formulation, particularly at high concentrations. These results are consistent with the results of Figure 14 and Figure 15. Importantly, the 3X formulation at IC₅₀ resulted in reasonable cell apoptosis compared to the control. This implies phytoconstituents upon formulation showed efficacy and cellular uptake (solubility and bioavailability), and functional activity was maintained upon formulation of the phytoconstituents. This study is a preliminary step to evaluate the cytotoxic potential of the combined phytochemical formulation against Caco2 cell lines.

3.7.2. Impact of 3X Formulation on the Expression of Genes Related to CRC (Using Caco2 Cells)

The mRNA expression of various genes involved in the progression of CRC was altered when treated with IC₂₅ of the 3X formulation (Figure 17A). The COX-2 gene expression was arrested entirely when treated with 178 μg of the 3X formulation compared to untreated (control) Caco2 cells. Similarly, 3X formulation-treated cells showed a 0.25-fold reduction in TGF-β gene expression in the Caco2 cells. The expression of TNF-α, which has been controversial in many cancers, showed a 5-fold increase when treated with 178 μg of the 3X formulation compared to the control cells. To check the response of Caco2 cells in the presence of 3X formulation (concerning the inflammatory status), the levels of IL-1β and nitric oxide (NO) were analyzed. As shown in Figure 17B, the NO levels increased while the IL-1β level decreased in the 3X formulation-treated cells.

As discussed above in the results section, it is evident that the 3X formulation has a role in enhancing apoptosis in CRC, as observed in vitro using Caco2 cells. Inflammation is a hallmark of CRC, where several pathways, such as Wnt/β-catenin, PI3K/AKT, TGF-β, TNF-α, IL-6, etc., are involved. The TGF-β receptor gets stimulated, activating SMAD signaling, which cascades the signal to the nucleus. This results in the overexpression of DNA microsatellite mismatch repair genes, helping the cancer cells proliferate. However, in the presence of the 3X formulation, it was found that the TGF-β expression level was reduced, indicating a positive impact of the 3X formulation on regulating the inflammatory response. The data also showed that the 3X formulation resulted in downregulating COX-2, an important component in the prostaglandin (PG) pathway that eventually causes cell proliferation and tumor progression. The interesting aspect of the present study is the investigation report of TNF-α expression levels, which play a complex role in cancer progression.

While TNF-α has been widely studied, its precise function appears context-dependent, varying across cancer stages and tumor microenvironments [40]. However, there is significant evidence that high TNF-α expression level is associated with advanced stages of CRC, stages III and IV. However, there is also ample evidence that suggests that it can have a dual role in the early stages of cancer [41].

In specific contexts, TNF-α induces apoptosis and suppresses tumor growth by engaging with TNF receptors and activating pro-apoptotic pathways such as the caspase cascade. It is also reported that TNF-α can stimulate NO production in the cells, thereby causing DNA damage and apoptosis of necrotic cells. Interestingly, the present study results indicated that NO production is almost doubled in Caco2 cells when treated with 3X formulation in correlation with the increased expression of the TNF-α gene. The inflammatory marker IL-1β induces NF-κB, which leads the signal cascade to cell proliferation and cancer progression. In our study, to corroborate the data, lower values of IL-1β confirm the ability of the 3X formulation to reduce inflammatory markers and suppress gene expression associated with the progression of CRC.

Although individual phytochemicals have been investigated for anticancer activity, the combinatorial nanoformulation strategy integrating AKBA, resveratrol and quercetin has not been systematically evaluated for anticancer activity. The observed results in this study provide a framework for discussing the mechanistic contributions of these phytochemicals in the 3X formulation. Resveratrol is well documented to modulate multiple molecular pathways associated with inflammation and tumor progression. It inhibits TNF-β (Tumor Necrosis Factor-beta), NF-κB (Nuclear factor kappa B), MMP-9 (Matrix metalloproteinase), EMT (Epithelial–mesenchymal transition)-associated signaling, and CXCR4 (Chemokine receptor type 4) activation and increased caspase-mediated apoptosis [42,43,44]. It has also been shown to decrease the expression of PGs by inhibiting a COX-2 enzyme [2,45]. Quercetin has many effects on CRC that are very similar to resveratrol. Quercetin influences CRC progression through regulation of inflammatory signaling, inhibition of AKT- and NF-κB-associated pathways, and induction of apoptosis, along with modulation of cytokine responses [46,47]. AKBA is recognized for its potent anti-inflammatory action, particularly through inhibition of lipid inflammatory pathways and suppression of COX-2–associated signaling, alongside its antiproliferative and apoptosis-inducing effects across multiple cancer types, including colorectal cancer [12]. Liposomes have demonstrated their potential in cancer drug delivery, but their clinical translation remains challenging, especially due to formulation instability. Alternative formulation strategies may provide complementary support to enhance the delivery of phytoconstituents while addressing limitations associated with clinical translation [48,49].

In the present study, treatment with the 3X nanoformulation resulted in complete arrest of COX-2 mRNA expression and downregulation of TGF-β expression in Caco2 cells. Furthermore, 3X nanoformulation showed an increase in NO levels, reduction in IL-1β inflammatory mediators, induction of cytotoxicity and apoptosis in Caco2 cells. These molecular and inflammatory changes are consistent with the reported biological activities of the individual phytochemicals, suggesting that their combined presence within the nanoformulation contributes to coordinated modulation of CRC-associated inflammatory and cancer-related pathways. However, the formulation represents a combinatorial system; these findings suggest that individual phytoconstituents may contribute, at least in part, to the suppression of pro-tumorigenic inflammatory signaling and modulation of CRC-associated gene expression observed with the 3X formulation. Although the present study does not quantitatively assess synergistic interactions, the observed convergence of anti-inflammatory, pro-apoptotic, and cytotoxic responses supports a functionally complementary combinatorial effect, emphasizing the potential of this combinatorial nanoformulation as a rational strategy for CRC management.

4. Conclusions

The three-step formulation process successfully led to the development of a stable, nano-structured 3X lipid-based delivery system containing AKBA, resveratrol, and quercetin. The approach ensured efficient encapsulation of all actives, compatibility of components, and an acceptable physicochemical profile for downstream in vitro evaluation. This method demonstrated a promising strategy for enhancing the bioavailability and co-delivery of lipophilic and polyphenolic nutraceuticals. The findings suggest that nano formulation primarily facilitates more efficient delivery of phytoconstituents without necessarily implying synergistic mechanisms and such synergistic interactions were not quantitatively evaluated in the present study. Hence, this study is an initial exploratory evaluation of 3X formulation combining three phytoconstituents. Further investigations are required to elucidate the underlying mechanisms and to observe quantitatively whether the efficacy of the 3X formulation extends beyond pharmacokinetic advantages to effective synergistic therapeutic interactions.