Determination of NAT2 Genotypes in a Cohort of Patients with Suspected TB in the State of Rio de Janeiro
Abstract
1. Introduction
2. Materials and Methods
2.1. DNA Extraction and Genotyping
2.2. Statistical Analysis
3. Results
3.1. SNP Description
3.2. Haplotype Reconstruction and Characterization of NAT2 Gene Alleles
3.3. Association between SNPs and Unfavorable Outcomes in the Second Month of Treatment among Patients with Pulmonary TB and the Duration of Anti-TB Treatment
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. Global Tuberculosis Report 2022; World Health Organization: Geneva, Switzerland, 2022. [Google Scholar]
- Epidemiological Tuberculosis Bulletin; Ministry of Health: Brasília, Brazil, 2022; p. 44.
- WHO. Global Tuberculosis Report 2021; World Health Organization: Geneva, Switzerland, 2021. [Google Scholar]
- Information System for Notifiable Diseases Tuberculosis. Available online: http://sistemas.saude.rj.gov.br/tabnetbd/webtabx.exe?sinan/tf_tuberculose.def/ (accessed on 14 May 2023).
- Mah, A.; Kharrat, H.; Ahmed, R.; Gao, Z.; Der, E.; Hansen, E.; Long, R.; Kunimoto, D.; Cooper, R. Serum drug concentrations of INH and RMP predict 2-month sputum culture results in tuberculosis patients. Int. J. Tuberc. Lung Dis. 2015, 19, 210–215. [Google Scholar] [CrossRef] [PubMed]
- Yee, S.W.; Brackman, D.J.; Ennis, E.A.; Sugiyama, Y.; Kamdem, L.K.; Blanchard, R.; Galetin, A.; Zhang, L.; Giacomini, K.M. Influence of Transporter Polymorphisms on Drug Disposition and Response: A Perspective from the International Transporter Consortium. Clin. Pharmacol. Ther. 2018, 104, 803–817. [Google Scholar] [CrossRef] [PubMed]
- Ingelman-Sundberg, M. Pharmacogenetics: An opportunity for a safer and more efficient pharmacotherapy. J. Intern. Med. 2001, 250, 186–200. [Google Scholar] [CrossRef]
- Evans, D.A.P. N-acetyltransferase. Pharmacol. Ther. 1989, 42, 157–234. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.; Dombrovsky, L.; Tempel, W.; Martin, F.; Loppnau, P.; Goodfellow, G.H.; Grant, D.M.; Plotnikov, A.N. Structural basis of substrate-binding specificity of human arylamine N-acetyltransferases. J. Biol. Chem. 2007, 282, 30189–30197. [Google Scholar] [CrossRef] [PubMed]
- Hickman, D.; Risch, A.; Buckle, V.; Spurr, N.K.; Jeremiah, S.J.; McCarthy, A.; Sim, E. Chromosomal localization of human genes for arylamine N-acetyltransferase. Biochem. J. 1994, 297, 441–445. [Google Scholar] [CrossRef] [PubMed]
- Hein, D.W.; Doll, M.A.; Fretland, A.J.; Leff, M.A.; Webb, S.J.; Xiao, G.H.; Devanaboyina, U.S.; Nangju, N.A.; Feng, Y. Molecular genetics and epidemiology of the NAT1 and NAT2 acetylation polymorphisms. Cancer Epidemiol. Biomark. Prev. 2000, 9, 29–42. [Google Scholar]
- Teixeira, R.L.D.F.; Morato, R.G.; Cabello, P.H.; Muniz, L.M.K.; Moreira, A.D.S.R.; Kritski, A.L.; Santos, A.R. Genetic polymorphisms of NAT2, CYP2E1 and GST enzymes and the occurrence of antituberculosis drug-induced hepatitis in Brazilian TB patients. Memórias Do Inst. Oswaldo Cruz 2011, 106, 716–724. [Google Scholar] [CrossRef]
- Azuma, J.; Ohno, M.; Kubota, R.; Yokota, S.; Nagai, T.; Tsuyuguchi, K.; Okuda, Y.; Takashima, T.; Kamimura, S.; Pharmacogenetics-Based Tuberculosis Therapy Research Group. NAT2 genotype guided regimen reduces isoniazid-induced liver injury and early treatment failure in the 6-month four-drug standard treatment of tuberculosis: A randomized controlled trial for pharmacogenetics-based therapy. Eur. J. Clin. Pharmacol. 2012, 69, 1091–1101. [Google Scholar] [CrossRef] [PubMed]
- Donald, P.R.; Sirgel, F.A.; Venter, A.; Parkin, D.P.; Seifart, H.I.; van de Wal, B.W.; Werely, C.; van Helden, P.D.; Maritz, J.S. The Influence of Human N-Acetyltransferase Genotype on the Early Bactericidal Activity of Isoniazid. Clin. Infect. Dis. 2004, 39, 1425–1430. [Google Scholar] [CrossRef] [PubMed]
- Choi, R.; Jeong, B.-H.; Koh, W.-J.; Lee, S.-Y. Recommendations for Optimizing Tuberculosis Treatment: Therapeutic Drug Monitoring, Pharmacogenetics, and Nutritional Status Considerations. Ann. Lab. Med. 2017, 37, 97–107. [Google Scholar] [CrossRef] [PubMed]
- Jing, W.; Zong, Z.; Tang, B.; Wang, J.; Zhang, T.; Wen, S.; Xue, Y.; Chu, N.; Zhao, W.; Huang, H. Population Pharmacokinetic Analysis of Isoniazid among Pulmonary Tuberculosis Patients from China. Antimicrob. Agents Chemother. 2020, 64, e01736-19. [Google Scholar] [CrossRef] [PubMed]
- Jung, J.A.; Lee, S.-Y.; Kim, T.-E.; Kwon, O.J.; Jeon, K.; Jeong, B.-H.; Park, H.Y.; Ko, J.-W.; Choi, R.; Woo, H.-I.; et al. A proposal for an individualized pharmacogenetic-guided isoniazid dosage regimen for patients with tuberculosis. Drug Des. Dev. Ther. 2015, 9, 5433–5438. [Google Scholar] [CrossRef] [PubMed]
- Lopes, M.Q.P.; Teixeira, R.L.F.; Cabello, P.H.; Nery, J.A.C.; Sales, A.M.; JR, E.P.N.; Moreira, M.V.; Stahlke, E.V.R.; Possuelo, L.G.; Rossetti, M.L.R.; et al. Human N-acetyltransferase 2 (NAT2) gene variability in Brazilian populations from different geographical areas. Front. Pharmacol. 2023, 14, 1278720. [Google Scholar] [CrossRef] [PubMed]
- Stephens, M.; Donnelly, P. A comparison of bayesian methods for haplotype reconstruction from population genotype data. Am. J. Hum. Genet. 2003, 73, 1162–1169. [Google Scholar] [CrossRef] [PubMed]
- Fretland, A.J.; Leff, M.A.; Doll, M.A.; Hein, D.W. Functional characterization of human N-acetyltransferase 2 (NAT2) single nucleotide polymorphisms. Pharmacogenetics 2001, 11, 207–215. [Google Scholar] [CrossRef] [PubMed]
- Dandara, C.; Masimirembwa, C.M.; Magimba, A.; Kaaya, S.; Sayi, J.; Sommers, D.K.; Snyman, J.R.; Hasler, J.A. Arylamine N-acetyltransferase (NAT2) genotypes in Africans: The identification of a new allele with nucleotide changes 481C:>: T and 590G:>: A. Pharmacogenet. Genom. 2003, 13, 55–58. [Google Scholar] [CrossRef] [PubMed]
- Teixeira, R.L.; Miranda, A.B.; Pacheco, A.G.; Lopes, M.Q.; Fonseca-Costa, J.; Rabahi, M.F.; Melo, H.M.; Kritski, A.L.; Mello, F.C.; Suffys, P.N.; et al. Genetic profile of the arylamine N-acetyltransferase 2 coding gene among individuals from two different regions of Brazil. Mutat. Res. Mol. Mech. Mutagen. 2007, 624, 31–40. [Google Scholar] [CrossRef] [PubMed]
- Heinrich, M.M.; Zembrzuski, V.M.; Ota, M.M.; Sacchi, F.P.; Teixeira, R.L.; Acero, P.H.C.; Cunha, G.M.; Souza-Santos, R.; Croda, J.; Basta, P.C. Factors associated with anti-TB drug-induced hepatotoxicity and genetic polymorphisms in indigenous and non-indigenous populations in Brazil. Tuberculosis 2016, 101, 15–24. [Google Scholar] [CrossRef] [PubMed]
- Unissa, A.N.; Sukumar, S.; Hanna, L.E. The role of N-acetyl transferases on isoniazid resistance from Mycobacterium tuberculosis and human: An in silico approach. Tuberc. Respir. Dis. 2017, 80, 255–264. [Google Scholar] [CrossRef] [PubMed]
NAT2 | Genotype Frequency | |||
SNP | Pulmonary TB (%) n = 136 | Non-TB Carriers (%) n = 168 | ||
c.191G>A | GG | 129 (94.8) | 156 (92.8) | |
GA | 4 (2.9) | 3 (1.7) | ||
AA | - | - | ||
c.247G>A | GG | 132 (97) | 159 (94.6) | |
GA | 1 (0.7) | - | ||
AA | - | - | ||
c.282C>T | CC | 53 (38.9) | 75 (44.6) | |
CT | 67 (49.2) | 64 (38) | ||
TT | 13 (9.5) | 20 (11.9) | ||
c.341T>C | TT | 53 (38.9) | 64 (38) | |
TC | 58 (42.6) | 71 (42.2) | ||
CC | 22 (16.1) | 24 (14.2) | ||
c.481C>T | CC | 58 (42.6) | 70 (41.6) | |
CT | 59 (43.3) | 71 (42.2) | ||
TT | 16 (11.7) | 18 (10.7) | ||
c.578C>T | CC | 132 (97) | 158 (94) | |
CT | 1 (7.3) | 1 (0.5) | ||
TT | - | - | ||
c.590G>A | GG | 73 (53.6) | 93 (55.3) | |
GA | 48 (35.2) | 53 (31.5) | ||
AA | 12 (8.8) | 13 (7.7) | ||
c.803A>G | AA | 56 (41.1) | 63 (37.5) | |
AG | 50 (36.7) | 66 (39.2) | ||
GG | 27 (19.8) | 30 (17.8) | ||
c.857G>A | GG | 119 (87.5) | 148 (88) | |
GA | 14 (10.2) | 11 (6.5) | ||
AA | - | - | ||
ND * | 3 | 9 |
Haplotype 2 | Phenotype | Non-TB Carriers (%) n = 168 | Pulmonary TB (%) n = 136 | |
---|---|---|---|---|
NAT2*4 1 | GGGCTCCCACCGAGTCAAGG | Rapid | 75 (23.5) | 40 (20.3) |
NAT2*12A | GGGCTCCCACCGAGTCAGGG | Rapid | 11 (3.4) | 9 (4.6) |
NAT2*12B | GGGTTCCCACCGAGTCAGGG | Rapid | 2 (0.6) | - |
NAT2*13A | GGGTTCCCACCGAGTCAAGG | Rapid | 14 (4.4) | 6 (3.0) |
NAT2*12C | GGGCTCCCATCGAGTCAGGG | Rapid | 2 (0.6) | 3 (1.5) |
NAT2*5A | GGGCCCCCATCGAGTCAAGG | Slow | 8 (2.5) | 5 (2.5) |
NAT2*5B | GGGCCCCCATCGAGTCAGGG | Slow | 99 (31.1) | 62 (31.5) |
NAT2*5C | GGGCCCCCACCGAGTCAGGG | Slow | 12 (3.7) | 6 (3.0) |
NAT2*5D | GGGCCCCCACCGAGTCAAGG | Slow | 2 (0.6) | 1 (0.5) |
NAT2*6A | GGGTTCCCACCAAGTCAAGG | Slow | 73 (22.9) | 45 (22.9) |
NAT2*6B | GGGCTCCCACCAAGTCAAGG | Slow | 4 (1.2) | 3 (1.5) |
NAT2*7B | GGGTTCCCACCGAGTCAAGA | Slow | 11 (3.4) | 8 (4.0) |
NAT2*14B | AGGTTCCCACCGAGTCAAGG | Slow | 3 (0.9) | 4 (2.0) |
NAT2*5J | GGGTCCCCACCAAGTCAAGG | Slow | - | 1 (0.5) |
NAT2*6F | GGGCTCCCACCAAGTCAGGG | ND 3 | 1 (0.3) | - |
NAT2*12E | GGGTTCCCACTGAGTCAGGG | ND | 1 (0.3) | - |
NAT2*5KA | GGGTCCCCACCGAGTCAAGA | ND | - | 1 (0.5) |
NAT2*new5 | GGGCCCCCATCAAGTCAAGG | ND | - | 1 (0.5) |
NAT2*new6 | GGATTCCCACCAAGTCAAGG | ND | - | 2 (1.0) |
Total | 318 | 197 | ||
ND | 18 | 76 |
Pulmonary TB | No TB | Total | |
---|---|---|---|
Fast acetylators | 15 (11.3) | 18 (11.3) | 33 (11.3) |
NAT2*4/*4 | 8 | 9 | 17 (5.8) |
NAT2*4/*12A | 1 | 1 | 2 (0.7) |
NAT2*4/*13A | 4 | 6 | 10 (3.4) |
NAT2*12C/*12C | 1 | 1 | 2 (0.7) |
NAT2*12B/*12B | - | 1 | 1 (0.3) |
NAT2*12A/*13A | 1 | - | 1 (0.3) |
Intermediate acetylators | 45 (33.8) | 68 (42.8) | 113 (38.7) |
NAT2*4/*5A | 3 | 4 | 7 (2.4) |
NAT2*4/*5B | 7 | 24 | 31 (10.6) |
NAT2*4/*5C | 2 | 2 | 4 (1.4) |
NAT2*4/*5D | 1 | - | 1 (0.3) |
NAT2*4/*6A | 11 | 16 | 27 (9.2) |
NAT2*4/*6B | 2 | - | 2 (0.7) |
NAT2*4/*7B | 4 | 3 | 7 (2.4) |
NAT2*4/*14B | 1 | 1 | 2 (0.7) |
NAT2*5B/*13A | 2 | 4 | 6 (2.1) |
NAT2*12A/*5B | 5 | 5 | 10 (3.4) |
NAT2*12A/*5C | 1 | - | 1 (0.3) |
NAT2*12A/*6A | 3 | 3 | 6 (2.1) |
NAT2*12A/*6B | - | 1 | 1 (0.3) |
NAT2*12A/*7B | - | 1 | 1 (0.3) |
NAT2*12C/*6A | 1 | - | 1 (0.3) |
NAT2*13A/*6A | 2 | 4 | 6 (2.1) |
Slow acetylators | 69 (51.9) | 71 (44.6) | 140 (47.9) |
NAT2*5A/*14B | 1 (0.75) | - | 1 (0.3) |
NAT2*5A/*6A | 3 | 3 | 6 (2.1) |
NAT2*5B/*14B | 2 (1.5) | 2 | 4 (1.4) |
NAT2*5B/*5B | 15 | 17 | 32 (11.0) |
NAT2*5B/*6A | 21 | 19 | 40 (13.7) |
NAT2*5B/*7B | 7 | 4 | 11 (3.8) |
NAT2*5C/*5B | 5 | 3 | 8 (2.7) |
NAT2*5C/*5C | - | 2 | 2 (0.7) |
NAT2*5C/*5J | 1 (0.75) | - | 1 (0.3) |
NAT2*5C/*6A | - | 1 | 1 (0.3) |
NAT2*5C/*7B | 1 (0.75) | 1 | 2 (0.7) |
NAT2*5D/*5A | - | 1 | 1 (0.3) |
NAT2*5D/*5C | - | 1 | 1 (0.3) |
NAT2*6A/*6A | 8 | 12 | 20 (6.8) |
NAT2*6B/*5B | 1 (0.75) | 2 | 3 (1.0) |
NAT2*6B/*6A | 2 (1.5) | - | 2 (0.7) |
NAT*6B/*6B | - | 1 | 1 (0.3) |
NAT2*7B/*6A | 2 (1.5) | 2 | 4 (1.4) |
Undetermined acetylation | 4 (3) | 2 (1.3) | 6 (2) |
NAT2*new5/*6A | 1 (0.75) | - | 1 (0.3) |
NAT2*12A/*new6 | 1 (0.75) | - | 1 (0.3) |
NAT2*6A/*new6 | 1 (0.75) | - | 1 (0.3) |
NAT2*6A/*12E | - | 1 | 1 (0.3) |
NAT2*6F/*5B | - | 1 | 1 (0.3) |
NAT2*5D/*5KA | 1 (0.75) | - | 1 (0.3) |
Total | 133 (100) | 159 (100) | 292 (100) |
Not determined | 3 | 9 | 12 |
Total | 136 | 168 | 304 |
SNPs | Presence of at Least One Mutant Allele | Unfavorable Outcome in the 2nd Month | ||||
---|---|---|---|---|---|---|
Absence (%) | Presence (%) | Q (p) 1 | OR 2 | |||
NAT2 | 191A | no | 70 (74.5) | 24 (25.5) | 0.001 (0.981) | 0.972 IC (0.096–9.796) |
yes | 3 (75.0) | 1 (25.0) | ||||
247A | no | 72 (74.2) | 25 (25.8) | 0.346 (0.556) | 0.742 IC (0.660–0.835) | |
yes | 1 (100.0) | 0 (0) | ||||
282T | no | 31 (73.8) | 11 (26.2) | 0.018 (0.894) | 0.939 IC (0.376–2.348) | |
yes | 42 (75.0) | 14 (25.0) | ||||
341C | no | 30 (75.0) | 10 (25.0) | 0.009 (0.923) | 1.047 IC (0.415–2.642) | |
yes | 43 (74.1) | 15 (25.9) | ||||
481T | no | 31 (75.6) | 10 (24.4) | 0.047 (0.829) | 1.107 IC (0.439–2.792) | |
yes | 42 (73.7) | 15 (26.3) | ||||
578T | no | 72 (74.2) | 25 (25.8) | 0.346 (0.556) | 0.742 IC (0.660–0.835) | |
yes | 1 (100.0) | 0 (0.0) | ||||
590A | no | 41 (73.2) | 15 (26.8) | 0.112 (0.738) | 0.854 IC (0.339–2.152) | |
yes | 32 (76.2) | 10 (23.8) | ||||
803G | no | 30 (75.0) | 10 (25.0) | 0.009 (0.923) | 1.047 IC (0.415–2.642) | |
yes | 43 (74.1) | 15 (25.9) | ||||
857A | no | 66 (74.2) | 23 (25.8) | 0.056 (0.812) | 0.820 IC (0.159–4.233) | |
yes | 7 (77.8) | 2 (22.2) |
Treatment Period < 9 Months | Treatment Period > 9 Months | |||||||
---|---|---|---|---|---|---|---|---|
Presence of at least one mutant allele of NAT2 | SNPs | Absence (%) | Presence (%) | Absence (%) | Presence (%) | * Mann-Whitney Test | ** Amino Acid Change | Reference Sequence (NCBI) |
191A | 62 (98.4) | 1 (1.6) | 32 (91.4) | 3 (8.6) | - | Arg64Gln | rs1801279 | |
247A | 62 (98.4) | 1 (1.6) | 35 (100) | - | 0.918 | Gly83Ser | rs746734312 | |
282T | 24 (38.1) | 39 (61.9) | 18 (51.4) | 17 (48.6) | 0.063 | Tyr94Tyr | rs1041983 | |
341C | 26 (41.3) | 37 (58.7) | 14 (40.0) | 21 (60.0) | 0.985 | Ile114Thr | rs1801280 | |
481T | 28 (44.4) | 35 (55.6) | 13 (37.1) | 22 (62.9) | 0.656 | Leu161Leu | rs1799929 | |
578T | 62 (98.4) | 1 (1.6) | 35 (100) | - | 0.469 | Thr193Met | rs79050330 | |
590A | 34 (54.0) | 29 (46.0) | 22 (62.9) | 13 (37.1) | 0.273 | Arg197Gln | rs1799930 | |
803G | 26 (41.3) | 37 (58.7) | 14 (40.0) | 21 (60.0) | 0.525 | Lys268Arg | rs1208 | |
857A | 54 (85.7) | 9 (14.3) | 35 (100) | - | 0.008 | Gly286Glu | rs1799931 | |
Total | 63 | 35 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dutra, C.A.; Teixeira, R.L.d.F.; Lopes, M.Q.P.; Silva, V.d.M.; Suffys, P.N.; Carvalho, R.d.S.; Moreira, A.R.; Santos, A.R.; Kritski, A.L. Determination of NAT2 Genotypes in a Cohort of Patients with Suspected TB in the State of Rio de Janeiro. Pharmaceutics 2024, 16, 917. https://doi.org/10.3390/pharmaceutics16070917
Dutra CA, Teixeira RLdF, Lopes MQP, Silva VdM, Suffys PN, Carvalho RdS, Moreira AR, Santos AR, Kritski AL. Determination of NAT2 Genotypes in a Cohort of Patients with Suspected TB in the State of Rio de Janeiro. Pharmaceutics. 2024; 16(7):917. https://doi.org/10.3390/pharmaceutics16070917
Chicago/Turabian StyleDutra, Cecília Alvim, Raquel Lima de Figueiredo Teixeira, Márcia Quinhones Pires Lopes, Victória de Moraes Silva, Philip Noel Suffys, Ricardo de Souza Carvalho, Adriana Rezende Moreira, Adalberto Rezende Santos, and Afrânio Lineu Kritski. 2024. "Determination of NAT2 Genotypes in a Cohort of Patients with Suspected TB in the State of Rio de Janeiro" Pharmaceutics 16, no. 7: 917. https://doi.org/10.3390/pharmaceutics16070917
APA StyleDutra, C. A., Teixeira, R. L. d. F., Lopes, M. Q. P., Silva, V. d. M., Suffys, P. N., Carvalho, R. d. S., Moreira, A. R., Santos, A. R., & Kritski, A. L. (2024). Determination of NAT2 Genotypes in a Cohort of Patients with Suspected TB in the State of Rio de Janeiro. Pharmaceutics, 16(7), 917. https://doi.org/10.3390/pharmaceutics16070917