Exosomes Derived from Dental Pulp Stem Cells Show Different Angiogenic and Osteogenic Properties in Relation to the Age of the Donor
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Exosomes Isolation from Stem Cells
2.3. Characterization of Exosomes Citofluorimetro
2.4. Transmission Electron Microscopy (TEM)
2.5. Real-Time Polymerase Chain Reaction (qPCR)
2.6. MTT Assay
2.7. Population Time Doupling (PDT) Assay
2.8. ALP Activity Assay
2.9. Quantification of Secreted Factors
2.10. Statistical Analysis
3. Results
3.1. Morphological Characterization of Exososomes: Size, Distribution, Superficial Markers
3.2. EXO Influence on the Proliferation of MSCs
3.3. EXO Influence Phenotypic Commitment of MSCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Langer, R.; Vacanti, J.P. Tissue engineering. Science 1993, 260, 920–926. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chan, B.P.; Leong, K.W. Scaffolding in tissue engineering: General approaches and tissue-specific considerations. Eur. Spine J. 2008, 17, 467–479. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, R.; Ma, P.X.; Guo, B. Conductive biomaterials for muscle tissue engineering. Biomaterials 2020, 229, 119584. [Google Scholar] [CrossRef] [PubMed]
- Elsayed, H.; Carraro, F.; Agnoli, S.; Bellucci, D.; Cannillo, V.; Ferroni, L.; Gardin, C.; Zavan, B.; Bernardo, E. Direct ink writing of silica-carbon-calcite composite scaffolds from a silicone resin and fillers. J. Eur. Ceram. Soc. 2018, 38, 5200–5207. [Google Scholar] [CrossRef]
- Gardin, C.; Ferroni, L.; Latremouille, C.; Chachques, J.C.; Mitrečić, D.; Zavan, B. Recent applications of three dimensional printing in cardiovascular medicine. Cells 2020, 9, 742. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rose, J.C.; De Laporte, L. Hierarchical design of tissue regenerative constructs. Adv. Healthc. Mater. 2018, 7, e1701067. [Google Scholar] [CrossRef]
- Nemati, S.; Kim, S.J.; Shin, Y.M.; Shin, H. Current progress in application of polymeric nanofibers to tissue engineering. Nano Converg. 2019, 6, 36. [Google Scholar] [CrossRef] [Green Version]
- Ferroni, L.; Gardin, C.; Sivolella, S.; Bressan, E.; Zavan, B. A hyaluronan-based scaffold for the in vitro construction of dental pulp-like tissue. Int. J. Mol. Sci. 2015, 16, 4666–4681. [Google Scholar] [CrossRef] [Green Version]
- Diomede, F.; Gugliandolo, A.; Cardelli, P.; Merciaro, I.; Ettorre, V.; Traini, T.; Bedini, R.; Scionti, D.; Bramanti, A.; Nanci, A.; et al. Three-dimensional printed PLA scaffold and human gingival stem cell-derived extracellular vesicles: A new tool for bone defect repair. Stem Cell Res. Ther. 2018, 9, 104. [Google Scholar] [CrossRef] [Green Version]
- Wei, F.; Li, M.; Crawford, R.Y.; Xiao, Y. Exosome-integrated titanium oxide nanotubes for targeted bone regeneration. Acta Biomater. 2019, 86, 480–492. [Google Scholar] [CrossRef]
- Zhang, J.; Liu, X.; Li, H.; Chen, C.; Hu, B.; Niu, X.; Li, Q.; Zhao, B.Z.; Wang, Y. Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signaling pathway. Stem Cell Res. Ther. 2016, 20, 136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gardin, C.; Bressan, E.; Ferroni, L.; Nalesso, E.; Vindigni, V.; Stellini, E.; Pinton, P.; Sivolella, S.; Zavan, B. In Vitro concurrent endothelial and osteogenic commitment of adipose-derived stem cells and their genomical analyses through comparative genomic hybridization array: Novel strategies to increase the successful engraftment of tissue-engineered bone grafts. Stem Cells Dev. 2012, 21, 767–777. [Google Scholar] [CrossRef]
- Li, M.; Xiong, P.; Yan, F.; Li, S.; Ren, C.; Yin, Z.; Li, A.; Li, H.; Ji, X.; Zheng, Y.; et al. An overview of graphene-based hydroxyapatite composites for orthopedic applications. Bioact. Mater. 2018, 3, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Bressan, E.; Ferroni, L.; Gardin, C.; Pinton, P.; Stellini, E.; Botticelli, D.; Sivolella, S.; Zavan, B. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS ONE 2012, 7, e49146. [Google Scholar] [CrossRef] [PubMed]
- Gardin, C.; Ferroni, L.; Bressan, E.; Calvo-Guirado, J.L.; Degidi, M.; Piattelli, A.; Zavan, B. Adult stem cells properties in terms of commitment, aging and biological safety of grit-blasted and acid-etched Ti dental implants surfaces. Int. J. Mol. Cell. Med. 2014, 3, 225–236. [Google Scholar] [PubMed]
- Takeuchi, R.; Katagiri, W.; Endo, S.; Kobayashi, T. Exosomes from conditioned media of bone marrow-derived mesenchymal stem cells promote bone regeneration by enhancing angiogenesis. PLoS ONE 2019, 14, e0225472. [Google Scholar] [CrossRef]
- Narayanan, K.; Kumar, S.; Padmanabhan, P.; Gulyas, B.; Wan, A.C.A.; Rajendran, V.M. Lineage-specific exosomes could override extracellular matrix mediated human mesenchymal stem cell differentiation. Biomaterials 2018, 182, 312–322. [Google Scholar] [CrossRef]
- Pittenger, M.F.; Mackay, A.M.; Beck, S.C.; Jaiswal, R.K.; Douglas, R.; Mosca, J.D.; Moorman, M.A.; Simonetti, D.W.; Craig, S.; Marshak, D.R. Multilineage potential of adult human mesenchymal stem cells. Science 1999, 284, 143–147. [Google Scholar] [CrossRef] [Green Version]
- Yang, K.; Li, D.; Wang, M.; Xu, Z.; Chen, X.; Liu, Q.; Sun, W.; Li, J.; Gong, Y.; Liu, D.; et al. Exposure to blue light stimulates the proangiogenic capability of exosomes derived from human umbilical cord mesenchymal stem cells. Stem Cell Res. Ther. 2019, 10, 358. [Google Scholar] [CrossRef]
- Raimondi, L.; De Luca, A.; Morelli, E.; Giavaresi, G.; Tagliaferri, P.; Tassone, P.; Amodio, N. MicroRNAs: Novel crossroads between myeloma cells and the bone marrow microenvironment. Biomed. Res. Int. 2016, 2016, 6504593. [Google Scholar] [CrossRef] [Green Version]
- Kaplan, R.N.; Psaila, B.; Lyden, D. Bone marrow cells in the ‘pre-metastatic niche’: Within bone and beyond. Cancer Metastasis Rev. 2006, 25, 521–529. [Google Scholar] [CrossRef] [PubMed]
- Morganti, C.; Bonora, M.; Marchi, S.; Ferroni, L.; Gardin, C.; Wieckowski, M.R.; Giorgi, C.; Pinton, P.; Zavan, B. Citrate mediates crosstalk between mitochondria and the nucleus to promote human mesenchymal stem cell In Vitro osteogenesis. Cells 2020, 9, 1034. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gardin, C.; Bosco, G.; Ferroni, L.; Quartesan, S.; Rizzato, A.; Tatullo, M.; Zavan, B. Hyperbaric oxygen therapy improves the osteogenic and vasculogenic properties of mesenchymal stem cells in the presence of inflammation In Vitro. Int. J. Mol. Sci. 2020, 21, 1452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Swanson, W.B.; Zhang, Z.; Xiu, K.; Gong, T.; Eberle, M.; Wang, Z.; Ma, P.X. Scaffolds with controlled release of pro-mineralization exosomes to promote craniofacial bone healing without cell transplantation. Acta Biomater. 2020, 118, 215–232. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, Y.; Takeda-Kawaguchi, T.; Kuroda, I.; Hotta, Y.; Kawasaki, H.; Hariyama, T.; Shibata, T.; Akao, Y.; Kunisada, T.; Tatsumi, J.; et al. Exosomes from dental pulp cells attenuate bone loss in mouse experimental periodontitis. J. Periodontal Res. 2022, 57, 162–172. [Google Scholar] [CrossRef]
- Chang, X.; Ma, Z.; Zhu, G.; Lu, Y.; Yang, J. New perspective into mesenchymal stem cells: Molecular mechanisms regulating osteosarcoma. J. Bone Oncol. 2021, 29, 100372. [Google Scholar] [CrossRef]
- Ji, L.; Bao, L.; Gu, Z.; Zhou, Q.; Liang, Y.; Zheng, Y.; Xu, Y.; Zhang, X.; Feng, X. Comparison of immunomodulatory properties of exosomes derived from bone marrow mesenchymal stem cells and dental pulp stem cells. Immunol. Res. 2019, 67, 432–442. [Google Scholar] [CrossRef]
- Stanko, P.; Altanerova, U.; Jakubechova, J.; Repiska, V.; Altaner, C. Dental mesenchymal stem/stromal cells and their exosomes. Stem Cells Int. 2018, 2018, 8973613. [Google Scholar] [CrossRef] [Green Version]
- Gandolfi, M.G.; Gardin, C.; Zamparini, F.; Ferroni, L.; Esposti, M.D.; Parchi, G.; Ercan, B.; Manzoli, L.; Fava, F.; Fabbri, P.; et al. Mineral-doped poly(l-lactide) acid scaffolds enriched with exosomes improve osteogenic commitment of human adipose-derived mesenchymal stem cells. Nanomaterials 2020, 10, 432. [Google Scholar] [CrossRef] [Green Version]
- Brunello, G.; Brun, P.; Gardin, C.; Ferroni, L.; Bressan, E.; Meneghello, R.; Zavan, B.; Sivolella, S. Biocompatibility and antibacterial properties of zirconium nitride coating on titanium abutments: An In Vitro study. PLoS ONE 2018, 13, e0199591. [Google Scholar] [CrossRef]
- Chachques, J.C.; Gardin, C.; Lila, N.; Ferroni, L.; Migonney, V.; Falentin-Daudre, C.; Zanotti, F.; Trentini, M.; Brunello, G.; Rocca, T.; et al. Elastomeric cardiowrap scaffolds functionalized with mesenchymal stem cells-derived exosomes induce a positive modulation in the inflammatory and wound healing response of mesenchymal stem cell and macrophage. Biomedicines 2021, 9, 824. [Google Scholar] [CrossRef] [PubMed]
- Ghensi, P.; Bressan, E.; Gardin, C.; Ferroni, L.; Soldini, M.C.; Mandelli, F.; Soldini, C.; Zavan, B. The biological properties of OGI surfaces positively act on osteogenic and angiogenic commitment of mesenchymal stem cells. Materials 2017, 10, 1321. [Google Scholar] [CrossRef] [Green Version]
- Liu, W.; Li, L.; Rong, Y.; Qian, D.; Chen, J.; Zhou, Z.; Luo, Y.; Jiang, D.; Cheng, L.; Zhao, S.; et al. Hypoxic mesenchymal stem cell-derived exosomes promote bone fracture healing by the transfer of miR-126. Acta Biomater. 2020, 103, 196–212. [Google Scholar] [CrossRef] [PubMed]
- Costa, L.A.; Eiro, N.; Fraile, M.; Gonzalez, L.O.; Saá, J.; Garcia-Portabella, P.; Vega, B.; Schneider, J.; Vizoso, F.J. Functional heterogeneity of mesenchymal stem cells from natural niches to culture conditions: Implications for further clinical uses. Cell. Mol. Life Sci. 2021, 78, 447–467. [Google Scholar] [CrossRef] [PubMed]
- Bellin, G.; Gardin, C.; Ferroni, L.; Chachques, J.C.; Rogante, M.; Mitrečić, D.; Ferrari, R.; Zavan, B. Exosome in cardiovascular diseases: A complex world full of hope. Cells 2019, 8, 166. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Andjus, P.; Kosanović, M.; Milićević, K.; Gautam, M.; Vainio, S.J.; Jagečić, D.; Kozlova, E.N.; Pivoriūnas, A.; Chachques, J.C.; Sakaj, M.; et al. Extracellular vesicles as innovative tool for diagnosis, regeneration and protection against neurological damage. Int. J. Mol. Sci. 2020, 21, 6859. [Google Scholar] [CrossRef]
- Rao, D.; Huang, D.; Sang, C.; Zhong, T.; Zhang, Z.; Tang, Z. Advances in mesenchymal stem cell-derived exosomes as drug delivery vehicles. Front. Bioeng. Biotechnol. 2022, 9, 797359. [Google Scholar] [CrossRef]
- Hao, Z.C.; Lu, J.; Wang, S.Z.; Wu, H.; Zhang, Y.T.; Xu, S.G. Stem cell-derived exosomes: A promising strategy for fracture healing. Cell Prolif. 2017, 50, e12359. [Google Scholar] [CrossRef] [Green Version]
- Davis, C.; Dukes, A.; Drewry, M.; Helwa, I.; Johnson, M.H.; Isales, C.M.; Hill, W.D.; Liu, Y.; Shi, X.; Fulzele, S.; et al. MicroRNA-183-5p increases with age in bone-derived extracellular vesicles, suppresses bone marrow stromal (stem) cell proliferation, and induces stem cell senescence. Tissue Eng. Part A 2017, 23, 1231–1240. [Google Scholar] [CrossRef]
- Paino, F.; La Noce, M.; Giuliani, A.; De Rosa, A.; Mazzoni, S.; Laino, L.; Amler, E.; Papaccio, G.; Desiderio, V.; Tirino, V. Human DPSCs fabricate vascularized woven bone tissue: A new tool in bone tissue engineering. Clin. Sci. 2017, 131, 699–713. [Google Scholar] [CrossRef] [Green Version]






| Gene | FOR | REV | Product (bp) |
|---|---|---|---|
| vWF | ATGCTCCTCACGTATGGTC | TGTGTGGGATC GACAAGACAC | 179 |
| SM-actin | TGGGAGAGCATTT TCCAGCCAACTCA | CATACGATCACCATCC | 133 |
| vinculin | GCTAACTTAGTGCTTTGCATGTGTCTT | AGTCTTAGTCACC ACAGGAACCA | 132 |
| fak | GCAGCGAGGAGCAGAGCGACAC | TAGTGAAGAGAC CCTA | 112 |
| paxillin | CATCATTGGCTGGAAAGCGAG | GAGTTGAATGG GCTCATTGCTCT | 192 |
| talin | ACCAGTCTCCAGATCGAGATGTT | GCAGA TGAGCCAGCA | 155 |
| osteopontin | GTGGTAGGTGATGTGGAGAAGAAA | CTCTGGGA CAGCAAGAGCAA | 183 |
| PECAM-1 | CTTGTCACAGGAGATCACA | GAGTATGCCAA TCCT | 149 |
| VE-cadherin | CTGGGTAGATATGGCCTGGGTGA | TTCAAGAGA GATGAGAGTGTGAG | 148 |
| Runx | CCGAGACCAATCATTGCGGTCG | AGGTGAAGACTG CCTGTG | 163 |
| type I collagen | CCGAGACCAAGGTGAAGACTG CCTGA | CATTGCGGTCGTG | 156 |
| osteocalcin | CCGAGACCAAGGTGAAGGCGGTCGT | GACTG CCTGATCATT | 193 |
| osteonectin | CCGAGACCAAGATTG | CGGTCGTGGTGAAGACTG CCTGT | 163 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Brunello, G.; Zanotti, F.; Trentini, M.; Zanolla, I.; Pishavar, E.; Favero, V.; Favero, R.; Favero, L.; Bressan, E.; Bonora, M.; et al. Exosomes Derived from Dental Pulp Stem Cells Show Different Angiogenic and Osteogenic Properties in Relation to the Age of the Donor. Pharmaceutics 2022, 14, 908. https://doi.org/10.3390/pharmaceutics14050908
Brunello G, Zanotti F, Trentini M, Zanolla I, Pishavar E, Favero V, Favero R, Favero L, Bressan E, Bonora M, et al. Exosomes Derived from Dental Pulp Stem Cells Show Different Angiogenic and Osteogenic Properties in Relation to the Age of the Donor. Pharmaceutics. 2022; 14(5):908. https://doi.org/10.3390/pharmaceutics14050908
Chicago/Turabian StyleBrunello, Giulia, Federica Zanotti, Martina Trentini, Ilaria Zanolla, Elham Pishavar, Vittorio Favero, Riccardo Favero, Lorenzo Favero, Eriberto Bressan, Massimo Bonora, and et al. 2022. "Exosomes Derived from Dental Pulp Stem Cells Show Different Angiogenic and Osteogenic Properties in Relation to the Age of the Donor" Pharmaceutics 14, no. 5: 908. https://doi.org/10.3390/pharmaceutics14050908
APA StyleBrunello, G., Zanotti, F., Trentini, M., Zanolla, I., Pishavar, E., Favero, V., Favero, R., Favero, L., Bressan, E., Bonora, M., Sivolella, S., & Zavan, B. (2022). Exosomes Derived from Dental Pulp Stem Cells Show Different Angiogenic and Osteogenic Properties in Relation to the Age of the Donor. Pharmaceutics, 14(5), 908. https://doi.org/10.3390/pharmaceutics14050908

